Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

170 results about "Digoxin" patented technology

Digoxin is used to treat heart failure, usually along with other medications. It is also used to treat certain types of irregular heartbeat (such as chronic atrial fibrillation).

Transmucosal administration of drug compositions for treating and preventing disorders in animals

The invention includes compositions for transmucosal administration to an animal comprising at least one active agent and a pharmaceutically acceptable carrier. A preferred active agent is selected from the group consisting of meloxicam, carprofen, enrofloxacin, clemastine, diphenhydramine, digoxin, levothyroxine, cyclosporine, ondansetron, lysine, zolpidem, propofol, nitenpyram, ivermectin, milbemycin, and pharmaceutically acceptable salts, solvates and esters thereof. In another embodiment, the invention includes methods of treating or preventing a condition in an animal comprising transmucosally administering a composition comprising a therapeutically or prophylactically effective amount of an active agent and a pharmaceutically acceptable carrier.
Owner:ZOTTIS BELGIUM

Complex of bi-specific antibody and digoxigenin conjugated to a therapeutic or diagnostic agent

The present invention relates to complexes of a) bi-specific antibodies and antibody fragments against a target protein and b) a digoxigenin conjugated to a therapeutic or diagnostic agent, methods for their production, their use as a delivery platform for therapeutic or diagnostic agents, pharmaceutical compositions containing said antibodies, and uses thereof.
Owner:F HOFFMANN LA ROCHE & CO AG

Antibody composition and passive immunization against pregnancy-induced hypertension

InactiveUS20060134106A1Low endogenous levelAntibody ingredientsImmunoglobulinsGynecologyHigh doses
A composition is provided to prevent, limit the effects of, delay the onset of, or treat one or more of the causes, symptoms or complications of gestational hypertension, preeclampsia, eclampsia and / or intrauterine growth restriction. The composition comprises a therapeutically effective amount of an antibody that reacts immunologically with or binds digoxin and has a high dose of digoxin binding capacity as the active ingredient. There is also provided a method of preventing, limiting the effects of, delaying the onset of, or treating a cause, symptom or complication of gestational hypertension, preeclampsia, eclampsia or intrauterine growth restriction, comprising the step of administering to a mammal a composition comprising a therapeutically effective amount of an antibody that reacts immunologically with or binds digoxin and has a high dose of digoxin binding capacity.
Owner:VELO BIO

Composition for modulating the expression of cell adhesion molecules

A composition is provided for modulating or attenuating the cytokine induced cell surface expression of cell adhesion molecules, comprising an antibody that binds digoxin. There is also provided a method of modulating or attenuating the cytokine induced cell surface expression of a cell adhesion molecule in a patient by administering to a digoxin antibody composition to a patient in need of such treatment.
Owner:GLENVEIGH PHARMA

Transmucosal administration of meloxicam compositions for treating and preventing disorders in non-human domesticated animals

The invention includes compositions for transmucosal administration to an animal comprising at least one active agent and a pharmaceutically acceptable carrier. A preferred active agent is selected from the group consisting of meloxicam, carprofen, enrofloxacin, clemastine, diphenhydramine, digoxin, levothyroxine, cyclosporine, ondansetron, lysine, zolpidem, propofol, nitenpyram, ivermectin, milbemycin, and pharmaceutically acceptable salts, solvates and esters thereof. In another embodiment, the invention includes methods of treating or preventing a condition in an animal comprising transmucosally administering a composition comprising a therapeutically or prophylactically effective amount of an active agent and a pharmaceutically acceptable carrier.
Owner:ZOTTIS BELGIUM

Nano gold mark silver dyeing detection method of gene chip

The present invention relates to gene chip detection method and is one using no radioactive label and no fluorescent label. The detection method includes the following steps: extracting the tested target gene in sample, labeling the gene with digoxin or biotin to obtain labeled DNA or RNA for hybridization with the gene chip; making nano gold labeled digoxin antibody to combined with digoxin or nano gold labeled avidin to combine with biotin; dyeing the hybridized gene chip with silver dyeing reagent; direct microscope oservation, CCD record of signal or scanning detection with common opticalscanning instrument to obtain corresponding crossing result; and further analysis by using relative software.
Owner:刘全俊 +2

Kit and method for detecting streptococcus suis type 2

The invention provides a kit and a method for detecting streptococcus suis type 2. The kit comprises an upstream primer, a downstream primer and a probe; the 5' end of the upstream primer and / or 5' end of the downstream primer are / is modified by a biotin; the 5' end and / or the 3' end of the of the probe are / is modified by digoxin; the upstream primer and the downstream primer can amplify the DNA molecule D or the fragment of the DNA molecule D through polymerase chain reaction to obtain a double-stranded DNA amplification product; the base sequence of the DNA molecule D is shown as in the sequence table 1; and the probe can hybridize flexibly with a biotin modified single-stranded DNA in the double-stranded DNA amplification product. The kit and the method have the advantages of high sensitivity, high specificity and low detection cost.
Owner:BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI

Method for differentiating indica japonica of weedy rice through two repeated DNA (Deoxyribonucleic Acid) sequences

The invention relates to a method for differentiating indica japonica of weedy rice through two repeated DNA (Deoxyribonucleic Acid) sequences. In the method, plasmid DNAs of cloning pTA71 containing wheat 45SrDNA gene sequences and cloning pOs48 containing repeated serial sequences of subtelocentric rice AA group chromosome are extracted, and 45SrDNA and Os48 probes are formed by using pOs48 labeled by using digoxin-dUTP (deoxyuridine triphosphate) and pTA71 labeled by using biotin-dUTP through a nick translation method to differentiate the indica japonica of the weedy rice. The method comprises the following steps of: flaking and denaturing a metaphase chromosome of the differentiated weedy rice before karyokinesis; carrying out two-color fluorescence in-situ hybridization between the metaphase chromosome and a denatured hybridization solution containing the probes; detecting a signal of the metaphase chromosome in the dark; and classifying the indica japonica of the weedy rice of different sources according to the locus number and distribution characteristics of the 45SrDNA and the Os48 on the metaphase chromosome of the weedy rice before the karyokinesis.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Human PAH gene SNP typing rapid test paper strip detection method with characteristics of no extraction and direct amplification, and kit

The invention discloses a rapid test paper strip detection method for directly amplifying seven hot spot mutation sites (R111X, IVS4-1, Y204C, R243Q, W326X, Y356X and R413P) of a human PAH gene without extraction, and a kit. The rapid test paper strip detection method comprises: directly adding a treatment liquid to a collected sample to prepare a sample liquid; carrying out identification and amplification on SNP allele sites based on an AS-PCR method; and achieving rapid genotyping by using the interaction between amplification fragment labeled digoxin and digoxin monoclonal antibody on thesurface of nanogold magnetic microparticles and by combining with a lateral flow chromatography technology. According to the present invention, with the rapid test paper strip detection method, the DNA separation extraction process is not performed, and the surface modified magnetic gold microparticles are used as the hybrid carrier, such that the problems of high cost, time saving and labor saving due to nucleic acid purification and product treatment can be eliminated, and high sensitivity and high accuracy are achieved.
Owner:XIAN GOLDMAG NANOBIOTECH

Gene chip for detecting vibrio harveyi colony and using method of gene chip

The invention discloses a gene chip for detecting a vibrio harveyi colony and a using method of the gene chip. The gene chip is characterized in that nucleotide probes for detecting vibrio alginolyticus, V. campbellii, V. harveyi, V. natriegens, V. parahaemolyticus and V. rotiferianus are immobilized on a chip carrier; the probes of various vibrios use a toxR gene as a target gene; the gene sequences of the various probes are as shown in SEQ ID NO: 11-14; and in a step of PCR amplification on a sample, the gene sequences of a PCR amplification forward primer designed for the toxR gene of various strains of the vibrio harveyi colony and a reverse primer with a digoxin marker are as shown in SEQ ID NO. 15-26. The gene chip disclosed by the invention has the advantage that the gene chip is capable of rapidly and effectively detecting 6 pathogenic vibrios of the pathogenic vibrio harveyi colony in a parallel mode, and the gene chip is high in accuracy and sensitivity and is strong in specificity.
Owner:NINGBO UNIV

Extraction-free direct-amplification rapid detection method for SNP typing of human methylenetetrahydrofolate reductase (MTHFR) gene via test strips

The invention provides an extraction-free direct-amplification rapid detection method for SNP typing of a human MTHFR gene via test strips. The method comprises the following steps: step 1, mixing samples with a sample treatment fluid and carrying out standing for 5 min, wherein obtained mixtures are used as templates; step 2, separately designing a wild specific primer, a mutant specific primer and a shared primer for identification and amplification of the C677T SNP site of a to-be-detected MTHFR gene, wherein the 5'-terminals of the wild specific primer and the mutant specific primer are both labeled with digoxin and the 5'-terminal of the shared primer is both labeled with biotin; step 3, carrying out parallel two-tube PCR reactions on each sample so as to obtain amplification products; and step 4, subjecting the amplification products obtained in the step 3 to typing detection via the test strips by using chromatographic techniques and action between digoxin and a digoxin monoclonal antibody and between biotin and streptavidin, and then judging and determining genotypes.
Owner:金磁(苏州)纳米科技有限公司

Method and reagent kit for simultaneously detecting resistance site of three nucleotide analogues of hepatitis B virus

The invention provides a method and a reagent kit for simultaneously detecting the resistance sites of the three nucleotide analogues of a hepatitis B virus (HBV). Based on the genotype sequence of the HBV, four nested amplification primers and twenty-seven wild resistance-detection oligonucleotides probes aiming at ten resistance sites are designed in an HBV polymerase area, digoxin-labeled oligonucleotides universal primers are used for conducting nested PRC reaction to amplify a target DNA segment, a target DNA amplification product to be labeled is used for hybridizing with specific oligonucleotide probes on matrix, and the existence of the resistance of the HBV to the three nucleotide analogues is judged through enzymatic color development reaction link-coupled by hybridization conjugates. The method improves the accuracy, the reliability and the sensitivity and can simultaneously detect the ten resistance sites of the three nucleotide analogues, thereby realizing the high-throughput, multi-site, economic and rapid detection and fitting to clinical needs in a better way. The method is of great significance to the realization of early detection and the proper guide of clinical personalized medication.
Owner:CHONGQING MEDICAL UNIVERSITY

Method for screening paralytic shellfish poisoning generation strain by using DNA probe-bacterial colony in-situ hybridization technique

The invention discloses a method for screening paralytic shellfish poisoning generation strains by using a DNA probe-bacterial colony in-situ hybridization technique. The method comprises steps of pretreatment, hybridization and screening. By using specific forward primers and reverse primers, a single chain DNA probe marked by digoxin is synthesized through polymerase chain reaction amplification, DNA of a strain to be tested is hybridized with the DNA probe, and poisoning generation strains are screened according to developing testing hybridization matching results. The method has the beneficial effects that 90 samples can be screened within 8-10 hours by using the method disclosed by the invention, the method is rapid and efficient, good in specificity and high in accuracy, the method is simple in operation step, small in workload and relatively short in cycle, reagents and materials used in the method are all common reagents for biochemical tests, and thus the method is harmless tohuman bodies, environmental-friendly, low in analysis cost, relatively good in market prospect and high in economic value.
Owner:ZHEJIANG OCEAN UNIV

MiRNA in-situ hybridization probe, its detection kit and its application

The invention provides an miRNA in-situ hybridization probe, its detection kit and its application. A fluorine atom is modified by a 2-carbon atom of the base five-carbon ring of the hybridization probe. The preferable sequence of the probe is represented by SEQ ID NO:1, wherein fluorine atoms are modified by 2-carbon atoms of third, sixth, fifteenth and twentieth base five-carbon rings. The other preferable sequence of the probe is represented by SEQ ID NO:2, wherein the fluorine atoms are modified by 2-carbon atoms of third, eighth, thirteenth and twenty-first base five-carbon rings. Digoxin is modified by 5' and 3' terminals of the probe. The invention also provides an in-situ hybridization detection kit of the hybridization probe. The probe of the invention can be applied to the preparation of miRNA in-situ hybridization detection kits for lung cancer cell lines or lung cancer tissues, and the preparation of miRNA in-situ hybridization detection kits for esophageal cancer cell lines or esophageal cancer tissues. The kit of the invention has the advantages of low price and good specificity.
Owner:GUANGZHOU EXONS BIOLOGICAL TECH

Oligonucleotide microarray technique for detecting pathogen contamination in seawater

The invention relates to an oligonucleotide microarray technique for detecting pathogen contamination in seawater, belonging to the field of seawater contamination monitoring. The technique comprises the main technical schemes that a 16S-23S rRNA gene transcription interval sequence is used as a detection target and is amplified by a one-step polymerase chain reaction, a digoxin mark is obtained simultaneously, and then oligonucleotide hybridization is carried out; and the obtained monitoring result is interpreted in a manner that an enzyme-labeled antibody catalyzes the substrate colour development. Compared with the traditional product for detecting seawater contamination, the invention utilizes microarray detection to obtain the distribution situation of large numbers of pathogens and contamination index bacteria, and has the advantage of high flux; the invention can directly utilize seawater as a sample and truly obtain the contamination situation information of target bacteria under a condition of keeping the natural proportion of the flora number in the seawater; however, most existing detection techniques need the step of enrichment culture, destroy the original proportion of a flora composition, have lower reliability of the result and have longer detection procedure; and the oligonucleotide microarray detection operation has short procedure and is comparatively sensitive and fast.
Owner:NANKAI UNIV

Kit for determining content of digoxin by using magnetic particulate chemiluminescent immunoassay, and detection method thereof

The invention provides a kit for determining the content of digoxin by using magnetic particulate chemiluminescent immunoassay, and a detection method thereof. The invention discloses a preparation method for digoxin antigen derivatives. The kit can realize indirect connection between a digoxin antigen and biotin or enzyme. Two detection systems are established in the kit, wherein one detection system is composed of a biotinylated digoxin antigen derivative, an enzyme-labelled antibody reagent and a calibrator, while the other detection system is composed of an enzyme-labelled digoxin antigenderivative, a biotinylated murine digoxi monoclonal antibody and the calibrator; so the kit is applicable to both solid-phase-coupled and luminescently-labeled digoxin derivatives and adapts to coupling of digoxin antigens with biotin, enzyme labels, or even proteins; and thus, different enterprises can flexibly use the kit during testing and only need to prepare the intermediates, i.e., the digoxin antigen derivatives, to realize testing. The correlations between given values and values measured by using different detection systems established by using the derivatives are 0.96 or more, and the correlation of the two detection systems is 0.9585. The kit of invention has the advantages that the whole reaction system is short in reaction time; radioactive pollution is avoided; the action period of reagents is realized; high sensitivity is obtained; testing results are accurate; and the flow of experimental operation is simplified.
Owner:TAIZHOU ZECEN BIOTECH CO LTD

Typing detection kit for human seasonal influenza viruses and application method thereof

The invention belongs to the field of biotechnologies, and particularly relates to a multi-PCR-ELISA detection kit for human seasonal influenza viruses and an application method thereof. The detection kit disclosed by the invention is composed of a RT-PCR reaction system, an ELISA detection system, four target-gene (an influenza-A-virus M gene, a H1 subtype virus HA gene, a H3 subtype virus HA gene, and a B type virus NS gene) positive plasmids (Pa-m, Ph1-ha, Ph3-ha and Pb-ns), a negative quality control specimen and four target-gene specific primer probes. Specific amplification is performed by using specific primers labeled by using four sets of biotins through RT-PCR, an amplified product after being denatured is hybridized with a specific probe labeled by using digoxin, a hybridized product is enveloped with a streptavidin-enveloped 96-hole micro-plate, and an anti-digoxin antibody labeled by using horse radish peroxidase is added for carrying out detection through an ELISA method, so that a rapid, sensitive and specific typing detection kit for seasonal influenza viruses such as H1 and H3 subtypes and hepatitis B viruses is established. The invention relates to the application of four sets of specific primer probes in the clinical differential diagnosis of influenza virus infection and the typing authentication of influenza virus isolates.
Owner:JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL

Cardiotonic composition

The present invention discloses a cardiotonic composition comprising micronized digoxin, hydrophilic polymer(s) and optionally pharmaceutically acceptable excipient(s) in the form of a tablet that releases not more than 50% digoxin in 5 minutes and at least 85% digoxin in 60 minutes.
Owner:SUN PHARMA INDS +1

Gene chip colorating detection method

In the method, digoxin or biotin mark is added in the PCR augmentatino course of the sample to be tested and then the PCR product is hybridized with the chip, by adding colour developing liquid to obtain the correspounding signal after hybridizing and combining the antibody with digoxin or biotin mark. The correspounding results will be collected and detected with normal optical scanners scanning.
Owner:SHANGHAI INST OF MICROSYSTEM & INFORMATION TECH CHINESE ACAD OF SCI

Pegylated insulin-like-growth-factor assay

InactiveUS20110045510A1Biological material analysisBiological testingDiosminPEGylated insulin
The current invention reports an immunoassay for the determination of PEGylated insulin-like-growth-factor employing an anti-(polyethylene glycol) antibody and an anti-digoxygenin antibody for the detection of an insulin-like-growth-factor / insulin-like-growth-factor-binding-protein-complex.
Owner:F HOFFMANN LA ROCHE & CO AG

Method for detecting aquatic animal pathogenic bacteria by using ribosome interoperonic region probe

The invention discloses a bacteria detecting technology which comprises designing special probes with biological information, including designing 34 pieces oligonucleotide as filtered probes and the corresponding PCR and hybridizing reacting conditions; enlarging via PCR and marking bacteria 16s-23srRNA gene interval array with Digoxin, and hybridizing the PCR products and a group of special oligonucleotide probes; after enzyme-linked immunoassay color-rendering, identifying whether has aquatic infectious pathogeny bacteria from the sample.
Owner:NANKAI UNIV +1

H7N9 subtype avian influenza virus detection kit, and application method thereof

The invention belongs to the field of biotechnology, and relates to a H7N9 subtype avian influenza virus PCR-ELISA detection kit, and an application method thereof. The H7N9 subtype avian influenza virus PCR-ELISA detection kit is composed of a RT-PCR reaction system, an ELISA detection system, three target genes (influenza A virus M gene, H7N9 subtype virus HA gene, and H7N9 subtype virus NA) positive plasmids (pMD-M, Pmd-H7, and Pmd-N9), a negative control, and the specific primer probes of the three target genes. The three biotin-marked specific primers are subjected to specific amplification using RT-PCR, amplification products are denatured, hybridization of the denatured amplification products with digoxin-marked specific probes is carried out, an obtained hybridization product is delivered into a streptavidin-coated 96-well plate, and horse radish peroxidase-marked anti-digoxin antibody is added for ELISA detection. The invention also relates to applications of the three specific primer probes in environmental sample differential diagnosis and H7N9 subtype avian influenza virus isolated strain classification identification.
Owner:JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL

Membrane transfer method for testing gene chip

A membrane transfer method for testing gene chip includes such steps as adding digoxin or biotin label in the PCR amplification process of the specimen to be tested, hybridizing the PCR resultant with chip, binding antibody with digoxin or biotin label, and transferring the hybridized result to nylon or cellulose ucetate membrane wetted by colouring developing liquid for higher intensity of hybridized signals and higher test sensitivity.
Owner:SHANGHAI INST OF MICROSYSTEM & INFORMATION TECH CHINESE ACAD OF SCI

Method for detecting SARS-CoV-2 by combining reverse transcription multi-cross displacement amplification with nano-biology sensing

The invention discloses a method for detecting SARS-CoV-2 by combining reverse transcription multi-cross displacement amplification with nano-biology sensing. The method aims at an open reading frame1a / b(F1ab) fragment and two targets of an N gene of the SARS-CoV-2, a uniquely designed multi-cross displacement amplification primer is used, a digoxin half antigen is marked on the 5'-end of a F1absequence cross primer CP1 in the multi-cross displacement amplification, and a FITC (fluorescein) half antigen is marked on the 5'-end of an N gene cross primer CP1. The method aims at a situation that the Flab fragment of the 2019-novel coronavirus and a product amplified by the N gene can be visually detected through a macromolecule nano-biology sensor. The method is convenient, quick, sensitive and specific and is suitable for the specific detection of the 2019-novel coronavirus.
Owner:贵州省疾病预防控制中心

Method and kit for detecting 19 drugs and metabolites thereof in blood by liquid chromatography-tandem mass spectrometry

The invention belongs to the technical field of drug detection, and particularly relates to a method and a kit for detecting 19 drugs and metabolites thereof in blood through liquid chromatography-tandem mass spectrometry. The substances to be detected comprise sulpiride, pentafluridol, mianserin, buspirone, tandospirone, hydroxyazine, diazepam, venlafaxine, moclobemide, imipramine, paroxetine, reboxetine, amitriptyline, sertraline, digoxin, clonazepam, clopidogrel, toluenesulfobutyl urea, glimepiride, 1-pyrimidinepiperazine, desmethylvenlafaxine, 6-hydroxy buspirone and normipramine, and the substances to be detected are selected from the group consisting of sulpiride, pentafluridol, mianserin, venlafaxine, metandospirone, metandospirone, hydroxazine, diazepam, venlafaxine, moclobemide, the pharmaceutical composition is prepared from noramitriptyline, nordiazepam and clopidogrel metabolite; the detection method comprises the following steps: calibrating a standard solution, treating a to-be-detected sample, and detecting the to-be-detected sample by adopting high performance liquid chromatography-mass spectrometry. The embodiment of the invention can quickly and accurately measure the content, and the sample treatment method is simple and easy to implement, high in sensitivity and accurate in quantification.
Owner:BEIJING HARMONY HEALTH MEDICAL DIAGNOSTICS CO LTD

Method for identifying all chromosomes of poplar by using oligonucleotide probe

The invention discloses a method for identifying all chromosomes of poplar by using oligonucleotide probes. The method comprises the following steps: obtaining a specific oligonucleotide sequence of each chromosome through bioinformatics analysis according to genome information of poplar tomentosa; synthesizing an oligonucleotide library corresponding to chromosome 1-19 of poplar; marking the oligonucleotide probes by using biotin or digoxin; identifying the chromosomes of the poplar by using a fluorescence in-situ hybridization technology; and repeatedly carrying out fluorescence in-situ hybridization for 7 times on the same metaphase splitting phase by using the oligonucleotide probes of up to three chromosomes simultaneously in each cycle of hybridization, so that 19 pairs of chromosomes of poplar species can be accurately identified.The method has the advantages of good universality in poplar species, good experimental repeatability and high resolution.The methoddisclosed by the invention provides a novel method for accurately identifying each chromosome of the poplar species, and lays a solid working foundation for molecular cytogenetics research of poplar.
Owner:NANJING FORESTRY UNIV

Colloidal gold immunodetection kit for detecting transgenic protein Cry1Ab/Ac and use thereof

The invention discloses a colloidal gold immunodetection kit for detecting a transgenic protein Cry1Ab / Ac. The colloidal gold immunodetection kit comprises a pretreatment PCR tube and a test paper. The test paper is composed of a sample pad, a label pad, a nitrocellulose membrane and an absorbent pad, and the sample pad, the label pad, the nitrocellulose membrane and the absorbent pad are orderly lap-connected to and bonded to a base plate. The label pad is coated with a colloidal gold-labeled anti-digoxin antibody. The nitrocellulose membrane comprises a detection zone coated with an anti-FITC antibody and a control zone coated with a secondary antibody. The pretreatment PCR tube comprises a digoxin-labeled sequence, a FITC-labeled sequence, a Taq enzyme, dNTP and buffer. The digoxin-labeled sequence is GCTCCTACAAATGCCATCATTGC and the FITC-labeled sequence is GATAGTGGGATTGTGCGTCATCCC. The colloidal gold immunodetection card can realize fast and on-site sensitive detection of the PCR amplification product, is easy to operate, realizes visual inspection of the PCR amplification result and can finish detection in 8-10min.
Owner:WUXI FUYANG BIOTECH

In-situ hybridization detection probe of shrimp and crab spiroplasma pathogens, and kit thereof

The invention relates to an in-situ hybridization detection probe of shrimp and crab spiroplasma pathogens, and a kit thereof. The sequences of the probe are represented by SEQIDNO.1 and SEQIDNO.2 respectively. The above two oligonucleotide probes are labeled with digoxin, the labeled probes are hybridized with spiroplasma 16SrDNA in shrimp and crab tissue slices, signal enlargement is carried out through an antigen-antibody reaction, and then enzyme reaction color development is carried out; the pathogen detection and pathological change can be visually combined; the infection rate and the infection intensity are analyzed on sample slices while spiroplasma is efficiently and accurately detected; the hybridization of the probes and the 16SrDNA is specific, and the signal is amplified step by step, so the probes are more sensitive and accurate than routine dyeing observation; and the slices obtained after the detection result hybridization color development can be preserved for a long term.
Owner:NANJING NORMAL UNIVERSITY

Eriocheir sinensis Microsporidia in-situ hybridization detection probe and kit

The invention discloses an Eriocheir sinensis Microsporidia in-situ hybridization detection probe and kit. The sequence of the probe is disclosed as SEQ ID NO.1. After the probe is labeled by digoxin and combined with Microsporidia 18S subunit ribosome DNA (18S SSU rDNA) by hybridization, the Microsporidia infection can be judged under a microscope after alkaline phosphatase detection system color development. The invention also discloses a kit containing the probe, which has favorable specific, is simple to operate and can intuitively combine the pathogen detection and pathological changes. On the premise of efficiently and accurately detecting the Spiroplasma, the kit can analyze the infection rate and infection intensity of the sample section. The hybridization between the probe and 18S SSU rDNA is specific, the signal is progressively amplified, and thus, the kit disclosed by the invention is more sensitive and accurate than the conventional dyeing observation detection. The detection result proves that the section subjected to hybridization color development can be stored for a long time.
Owner:FRESHWATER FISHERIES RES INSITUTE OF JIANGSUPROVINCE

Kit

The invention belongs to the technical field of medical appliances, and discloses a kit which comprises primary antibody digoxin antibody, secondary antibody rat anti-goat IgG, 3H labeled divaricoside, polyethyleneglycol 6000, phosphate buffer solution (PBS) with the pH value of 7.4, 3H scintillation solution, and tris(hydroxymethyl)metyl aminomethan buffer solution (Tris buffer solution) with the pH value of 7.4, and / or divaricoside. The kit provided by the invention is simple and convenient to operate, has the advantages of high sensitivity, high specificity and the like, and can perform stable and reliable early diagnosis on gestational period eclamptism, thereby providing favorable support for subsequent treatment.
Owner:SHUNHAO CELL BIOTECHNOLOGY (TIANJIN) CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More