15 results about "Mitochondrial cytochrome" patented technology

The present invention relates to processes to obtain methyl (E)-2-[2-halomethyl)-3-methyl- phenyl]-3-hydroxy-prop-2-enoates and intermediates thereof. These compounds are used as intermediates for preparing strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution F129L in the mitochondrial cytochrome b protein (also referred to as F129L mutation in the mitochondrial cytochrome b gene) conferring resistance to Qo inhibitors.

The present invention relates to a method of controlling or preventing infestation by phytopathogenic fungi in a plant, wherein said phytopathogenic fungi comprises a F129L mutation in the mitochondrial cytochrome b which confers resistance to Qo inhibitors.

This invention relates to the fields of molecular biology and forensic identification, specifically to a method for bird species identification based on multi-gene co-amplification and nanopore sequencing. The method involves extracting genomic DNA from avian biological samples; using the extracted DNA as a template, amplification is performed using four independent PCR primer pools that specifically target the avian mitochondrial cytochrome C oxidase subunit I gene, cytochrome B gene, 12S rRNA gene, and 16S rRNA gene; after purification of the amplification products, a nanopore sequencing library is constructed and sequenced; finally, bioinformatics analysis, including read length clustering, draft consensus sequence generation, and polishing, is performed on the raw sequencing data to obtain consensus sequences for each target gene. Species identification is then completed by comparing the sequence with a avian sequence database. This method effectively solves the problem that existing technologies cannot simultaneously meet the practical needs of large-scale, rapid, and high-success-rate identification of avian biological samples.

The present invention relates to the use of cytoplasmic compounds of the cytoplasmic type of formula I and N-oxides and salts thereof for combating plant pathogenic fungi which contain the amino acid substitution F129L in the cytochrome b protein of the mitochondria (also referred to as F129L mutation in the cytochrome b gene of the mitochondria) which confers resistance to Qo inhibitors and to methods for combating such fungi. The invention also relates to novel compounds, to processes for preparing these compounds, to compositions comprising at least one of the compounds and to seeds coated with at least one of the compounds.

The application belongs to the technical field of biological identification, and provides a molecular identification reagent for Olotanussus and Endothrips spp., which comprises a pair of primers for detecting COI gene sequence of the thrips: olotCOI-F: 5-ATATTAGGAGCTCCAGATATAGC-3; olotCOI-R: 5-GGGTGACCAAAAAATCAAAATAA-3; and further comprises a BclI enzyme cutting site designed in the sequence of the Olotanussus. According to the sequence difference of the mitochondrial cytochrome C oxidase subunit I gene between the thrips species, a species-specific variation site of the Olotanussus and the Endothrips spp. is found, a molecular identification system for the thrips species is established, and finally the rapid, accurate and efficient identification of the thrips and the closely related species is realized.

The invention discloses a multi-mode vision correction method based on fertility resonance, and particularly relates to the technical field of vision correction.The multi-mode vision correction method comprises a glasses frame, a fertility resonance chip is installed in the glasses frame, and the fertility resonance chip comprises a receiving and transmitting antenna, a resonance circuit, a processor and an oscillating circuit; according to the invention, a fertility resonance chip is arranged in the intelligent glasses frame, and 9.34 [mu] m far infrared light is emitted. The wave band is matched with the vibration frequency of biomacromolecules of a human body, and acts on mitochondrial cytochrome C oxidase in a targeting manner through a resonance effect, so that the ATP synthesis efficiency is improved, and the microcirculation and oxygenation of eyes are improved; by matching with light-guiding eye-protecting gel, the eye cream is smeared around the eyes, capillary vessels are shrunk through physical cooling, intraocular pressure is reduced, and ciliary muscle spasm is relieved; in combination with Schumann wave (7.83 Hz) vision treatment music, brain waves of the brain are adjusted to be in an alpha / theta state, the visual center reaction capacity is improved, and the neuroplasticity and the visual signal processing efficiency are enhanced; the non-invasive design avoids infection and injury risks.

The present invention relates to mixtures of strobilurin type compounds of formula (I) with certain pesticides as defined herein and their use for combating phytopathogenic fungi in particular of fungi containing an amino acid substitution F129L in the mitochondrial cytochrome b protein (also referred to as F129L mutation in the mitochondrial cytochrome b gene) conferring resistance to Qo inhibitors, and to methods for combating such fungi. The invention also relates to compositions comprising such mixtures and their use as fungicide.

The present invention relates to strobilurin-type compounds of formula I and N-oxides and salts thereof and their use for combating plant pathogenic fungi containing an amino acid substituted F129L in the mitochondrial cytochrome b protein (also referred to as the F129L mutation in the mitochondrial cytochrome b gene) that confers resistance to Qo inhibitors, and to a method for combating such fungi. The invention also relates to processes for preparing these compounds, to compositions comprising at least one such compound, and to seeds coated with at least one such compound.

To provide a method for combating phytopathogenic fungi containing an amino acid substitution F129L conferring resistance to Qo inhibitors.SOLUTION: The present invention employs compounds of formula I, their stereoisomers, their N-oxides, and agriculturally acceptable salts thereof. [R1 is O and / or NH; R2 is CH or N; R3 is halogen or the like; R4 is C1-C6 alkyl or the like; Ra is halogen, CN or the like; n is an integer of 0-5].SELECTED DRAWING: None

The present invention relates to strobilurin-type compounds of formula I, as well as N-oxides and salts thereof, and their use for combating plant pathogenic fungi containing the amino acid substitution F129L in the mitochondrial cytochrome b protein (also called the F129L mutation in the mitochondrial cytochrome b gene), which confers resistance to Qo inhibitors, and to methods for combating such fungi. The invention also relates to processes for preparing these compounds, compositions comprising at least one such compound, and seeds coated with at least one such compound.

The invention discloses a visualized rapid detection method for solenopsis invicta, and relates to the technical field of biological detection, and the technical key points are as follows: a rapid molecular detection method for invading species solenopsis invicta is developed on the basis of a loop-mediated isothermal amplification technology, mitochondrial DNA (mitochondrial DNA, mtDNA) cytochrome b (Cytochrome b, Cytb) genes of the solenopsis invicta are taken as targets, and the primers are used for detecting the mitochondrial DNA of the solenopsis invicta and the cytochrome b of the solenopsis invicta; the method comprises the following steps: designing and screening specific LAMP primers (F3 / B3, FIP / BIP); the method can accurately distinguish the solenopsis invicta from nine related species of solenopsis invicta, breaks through the dependence of traditional molecular detection on professional equipment and complex operation, and provides a high-sensitivity and high-specificity field detection tool for solenopsis invicta invasion monitoring and port quarantine.

The application discloses a kind of amplicon variation markers for identifying two kinds of horse hoof screws.The application finds that there is amplicon variation marker in the position of the 214th position of nucleotide sequence shown in SEQ ID NO.1 of mitochondrial cytochrome oxidase I gene of horse hoof screw, which can distinguish Rochia nilotica and Rochia maxima.If the base of the site is A, the horse hoof screw species is Rochia maxima, and if the base of the site is G, the horse hoof screw species is Rochia nilotica, which is suitable for identifying the two species from eDNA sequence when there is no physical sample, or when the physical form cannot distinguish them.

The invention relates to a rapid identification kit and an identification method for culex fatigans based on an RAA technology. The sequence of the rapid identification kit is culex fatigans F2: AGGAGGAGATCAATTTTATATCAACATTT; the culex fatigan-R2 is characterized in that the culex fatigan-R2 is TCAAACAATAAACCCTAATAAACCAATAGC. Traditional mosquito identification is mainly based on morphological identification, but morphological characteristics of vector organisms are possibly damaged in the collection or storage process, and all development stages cannot be identified at the same time, and the RAA technology based on the mitochondrial DNA cytochrome oxidase I gene is applied to mosquito identification and used together with the traditional morphological identification method, so that the identification efficiency is greatly improved. Identification errors can be effectively reduced, and identification efficiency and accuracy are improved.

The present invention provides a method for controlling a soybean rust fungus having an amino acid substitution of F129L on mitochondrial cytochrome b protein. According to the present invention, a compound represented by formula (I) [wherein R1 represents a C1-C3 chain hydrocarbon group and so on, n is 0, 1, 2 or 3, and when is 2 or 3, a plural of R2 may be identical to or different from each other, and R2 represents a C1-C3 chain hydrocarbon group and so on, Q represents a group represented by Q1 (where • represents a binding site to a benzene ring) and so on, L1 represents CH2 or an oxygen atom, and E represents a C1-C6 alkyl group and so on.] can use to control a soybean rust fungus having an amino acid substitution of F129L on mitochondrial cytochrome b protein.

The invention discloses a recombinant adeno-associated virus. The recombinant adeno-associated virus is prepared by the following steps: inserting a coding sequence of UBA52 protein into a pAAV-CMV plasmid; the preparation method comprises the following steps: co-transfecting a recombinant plasmid, a pHelper plasmid and a pAAV-RC9 plasmid to an AAV-293 cell; and culturing the cells, and extracting the recombinant adeno-associated virus. The recombinant adeno-associated virus can improve the motor ability of a cerebral hemorrhage subject; reducing encephaledema, hematoma level and cerebral moisture content in brain tissues of cerebral hemorrhage subjects; the mitochondrial DNA content is increased; the content of cytochrome C in cytoplasm is reduced, and the content of cytochrome C in mitochondria is increased; the content of caspase-3 and caspase-9 in the brain tissue is reduced; the content of ATP in brain tissue is increased; the number of degenerative neurons in brain tissues is reduced, and neuronal degeneration is recovered or slowed down; the apoptosis of brain tissue neurons is retarded. The recombinant adeno-associated virus has an application prospect.