Method for identifying Lygus pratensis populations by mitochondrial molecular markers

A technology of forage grass bug and molecular marker, applied in the field of molecular biology, can solve the problems of difficulty in distinguishing, inconspicuous differences in external morphological characteristics of insects, difficult identification, etc., and achieves strong repeatability, simple and reliable molecular identification method, Actionable effect

Inactive Publication Date: 2016-06-29
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] A large number of studies have shown that although the population of Lygus forages is large and the damage is serious in Northwest China, the external morphological characteristics of this insect are not significantly different among different geographical populations, and it is difficult to distinguish them. It is very difficult to identify

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying Lygus pratensis populations by mitochondrial molecular markers
  • Method for identifying Lygus pratensis populations by mitochondrial molecular markers
  • Method for identifying Lygus pratensis populations by mitochondrial molecular markers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Design and Synthesis of PCR Primer Combinations for Identifying Lygus Grass Populations

[0033] According to the mitochondrial cytochrome oxidase II (COII) gene, cytochrome b (Cytb) gene, mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and 16SrDNA sequence of Lygus grazing bug, the PrimerPrimer5 software was used to design PCR amplification of the above-mentioned Specific primers for the four genes. The primer sequences are as follows (SEQ ID NO: 1-8):

[0034] ①L-COII-F: 5'–TGGCAGAATAAGTGCCATGA–3'

[0035] L-COII-R: 5'–GAGACCAATGCTTTTCTTTCAGC–3'

[0036] ②L-ND5-F: 5'–AAACATAATTACCTGAACCCATGAA–3'

[0037] L-ND5-R: 5'–TCTTCAACTTTAGTAACTGCAGGAG–3'

[0038] ③L-Cytb-F: 5'–TCTAATTGATCTTCCTAGCCCAAG–3'

[0039] L-Cytb-R: 5'–CCGTGCTCCAATTCATGTTA–3'

[0040] ④L-16S-F: 5'–TCCACAAATATCCCCAATCTG–3'

[0041] L-16S-R: 5'–CCTTGAAATGTCCCTTCTCG–3'

[0042] The above primers were synthesized by Shanghai Bioengineering Technology Service Co., Ltd.

Embodiment 2

[0043] Example 2 Using mitochondrial molecular markers to quickly identify the method of Lygus genus Xinjiang population and Gansu Ningxia population

[0044] 1. Collect individuals of Lygus forages in Xinjiang, Gansu and Ningxia, and extract whole genome DNA

[0045] Representative populations were selected in Xinjiang, Gansu and Ningxia of China, that is, Kuqa, Korla and Shache in Xinjiang, Wuwei in Gansu, and Qingtongxia in Ningxia collected Lygus individuals. The field collection of Lygus grass bugs adopts the net catch method, and the adults are collected by sucking tubes, and then the adults are put into absolute ethanol, and then brought back to the laboratory, and the morphological characteristics of the adults are further identified and confirmed by a body dissecting microscope to ensure the species identification correct.

[0046] When extracting genomic DNA, the abdomen and wings of adults were removed, and the remaining tissue structures were used as test material...

Embodiment 3

[0058] Example 3 Analysis of Specificity and Sensitivity of Using PCR Primers L-Cytb-F / L-Cytb-R to Detect Lygus Grass

[0059] 1. Sample source:

[0060] Two kinds of Lygus lygus are used in the present embodiment, wherein Lygus lygus is from Korla, Gansu, Qingtongxia, Ningxia; Kuqa and Shache areas, these samples are preserved in the Plant Protection Laboratory of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences.

[0061] 2. DNA extraction:

[0062] Described with embodiment 2.

[0063] 3. PCR amplification:

[0064] The PCR reaction system and PCR amplification procedure are the same as those described in Example 2.

[0065] 4. Result analysis:

[0066] Take 5 μL of the PCR amplification product, electrophoresis on 2% agarose gel, the voltage is 150V, and the result is detected under ultraviolet light after 25 to 30 minutes. If a characteristic band with a size of about 910bp appears, it proves that the detected sample is Grass bugs. The r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for rapidly identifying Lygus pratensis populations, especially Xinjiang populations, Gansu populations and Ningxia populations, by mitochondrial molecular markers. According to the method, specific primers are designed according to four gene segments including mitochondrial cytochrome oxidase II (COII), cytochrome b (Cytb), mitochondrial NADH dehydrogenase subunit 5(ND5) and 16S rDNA of Lygus pratensis respectively, and PCR (polymerase chain reaction) amplification products are subjected to series-connection comparison, so that identification for the Lygus pratensis populations in China is realized. The method is simple and reliable and has high operability, good stability and high repeatability.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a method for using mitochondrial molecular markers to identify Lygus species. Background technique [0002] Lyguspratensis, belonging to the family Miridae and the genus Lygus, is one of the important pest species in cotton fields, especially in the past ten years, with the large-scale cultivation of transgenic cotton and the reduction of chemical pesticides With the use, the insect has risen from a secondary pest to a major pest, especially in the northwestern cotton region of my country, which shows a sharp upward trend. The obvious increase in the population of Lygus gravida in a wide range and the expansion of the spatial range have brought great challenges to the control work. [0003] A large number of studies have shown that although the population of Lygus forages is large and the damage is serious in Northwest China, the external morphological characteristics of this ins...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q2600/156
Inventor 张利娟崔金杰雒珺瑜张帅王春义吕丽敏朱香镇王丽李春花
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap