165results about How to "Promote proliferation" patented technology

The invention provides traditional Chinese medicine fermented disaccharide encapsulated nano anti-dandruff, hair-growing and oil-controlling shampoo and a preparation method, and relates to the field of daily chemical products, and the shampoo comprises the following components: a compound fermentation product, lactobacillus crispatus, lactobacillus plantarum, a disaccharide activity protection system, a basic component and a nano oil-controlling component; the compound leavening is prepared from cacumen biotae, radix polygoni multiflori, radix ginseng, fructus cnidii and orchid; the disaccharide activity protection system comprises maltotetraose and trehalose; the disaccharide activity protection system wraps a fermented material formed by fermenting the compound fermentation product, the lactobacillus crispatus and the lactobacillus plantarum to form a disaccharide glassy state layer; the nano oil control component is prepared from calamine powder and chitosan-sodium alginate; the basic component is prepared from tea bran, radix sophorae flavescentis, herba ecliptae, radix notoginseng, fructus ligustri lucidi, tea saponin microcapsules and tremella polysaccharide. According to the invention, through fermentation conversion of the orchid, disaccharide glassy state protection and slow release of the nano calamine, activity enhancement, stable retention and accurate release are realized, and the effects of removing dandruff, relieving itching, controlling oil and growing hair are achieved.

The invention discloses a salt-alkali-tolerant growth-promoting ectopseudomonas DHS-HJ-IAA-2 strain and an application thereof, and belongs to the technical field of microorganisms. According to the invention, a strain of salt-resistant, alkali-resistant and drought-resistant pseudomonas sp. DHS-HJ-IAA-2 is screened, and the pseudomonas sp. DHS-HJ-IAA-2 is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC No.36164. Experimental results show that the ectopseudomonas DHS-HJ-IAA-2 has the functions of producing IAA, fixing nitrogen, dissolving potassium, degrading cellulose and lignin, inhibiting phytopathogen and the like, and can remarkably improve the bacteria abundance of saline-alkali soil, improve soil fertility and promote plant growth in a saline-alkali environment. The invention provides a new strain resource and a technical means for improving saline-alkali soil and planting crops on the saline-alkali soil, and realizes improvement of the saline-alkali soil from two aspects of soil-crop-microorganism comprehensive action and microorganism-plant synergistic action.

The invention provides application of pitaya peel polysaccharide in preparation of a medicine for repairing skin wounds. The monosaccharide components of the pitaya peel polysaccharide comprise rhamnose, arabinose, galactose, glucose, xylose, mannose, galacturonic acid and glucuronic acid. Research finds that the dragon fruit peel polysaccharide remarkably accelerates the wound healing process and promotes granulation tissue formation and collagen deposition. Meanwhile, the pitaya peel polysaccharide can also promote cell proliferation and neovascularization at the skin wound part, exert an anti-inflammatory effect, remodel skin microbiota and provide a more suitable microenvironment for skin wound healing. The invention provides a new drug choice for clinically repairing skin wounds, and can be used for developing new skin wound dressings.

The invention discloses a carnosine targeting a IIB type activin receptor and a preparation method and application of the carnosine, and the amino acid sequence of the carnosine targeting the IIB type activin receptor is as shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. The value of the equilibrium dissociation constant KD of the carnosine and the IIB type activin receptor ranges from 0.514 [mu] M to 1.91 [mu] M. The method disclosed by the invention adopts a multi-technology integration strategy of in vitro digestion simulation, mass spectrum identification, molecular docking, affinity verification and cell function experiment, and has the advantages of high efficiency and strong targeting property. The invention also aims to provide application of the carnosine in preparation of functional food or medicines for preventing and / or treating sarcopenia and promoting muscle growth.

The present application belongs to the technical field of oral care, and particularly relates to an oral care composition and a preparation method thereof. The oral care composition comprises, by mass percentage, chitosan oligosaccharide 0.1-0.3%, sea hao polysaccharide 0.08-0.14%, forskolin 0.07-0.12%, corn sprout extract 0.05-0.09%, thickening agent 1-3%, humectant 40-50%, and the balance being water. The oral care composition of the present application can effectively inhibit the activity of glucosyltransferase, inhibit the production of dextran, interfere with the formation process of dental plaque, and reduce the adhesion sites of pathogenic bacteria in the oral cavity. In addition, the composition of the present application can promote the proliferation and repair of oral mucosa epithelial cells, and help repair oral mucosa damage. Furthermore, the use of each component in the composition of the present application can balance the oral microbial flora, while achieving the effect of inhibiting pathogenic bacteria and improving the oral environment.

The application discloses a preparation method of a hydrocolloid dressing for oral cavity, and relates to the technical field of medical supplies. Baicalin extract and a polyvinyl pyrrolidone solution are mixed to obtain a baicalin extract solution; chitosan fibers, hydroxymethyl cellulose and the baicalin extract solution are mixed to obtain a mixed solution; vacuum degassing: the prepared mixed solution is vacuumized, pressure is maintained, and primary degassing is performed; ultrasonic degassing: the mixed solution after primary degassing is subjected to ultrasonic degassing; static degassing: the solution after ultrasonic degassing is sealed by using a preservative film, and is subjected to secondary degassing at room temperature; a PU film is fixed in a film laying frame, the degassed mixed solution is poured into the film laying frame, and the film laying frame is placed into an air-blowing drying box to solidify and form a protective layer, so that the hydrocolloid dressing is obtained. The hydrocolloid dressing prepared by the method has good adhesion, can be used on a wound for a long time, and can effectively promote the repair of damaged cells and wounds, so that the healing of the wound in the oral cavity is promoted.

The invention discloses an anaerobic denitrifying bacterial agent as well as a preparation method and application thereof, and belongs to the technical field of water environment treatment. The anaerobic denitrifying bacterium agent is prepared from the following components in parts by weight: 15 to 30 parts of sterile water, 15 to 60 parts of normal saline, 5 to 10 parts of micro-capsule embedded anaerobic denitrifying bacteria, 5 to 20 parts of a porous composite modified carrier, 10 to 30 parts of a carbon source, 4 to 7 parts of nutrient elements, 2.5 to 4 parts of a buffering agent and 1 to 5 parts of a stabilizer, the micro-capsule embedded anaerobic denitrifying bacteria are obtained by embedding anaerobic denitrifying bacteria with an alginic acid gel solution and a calcium chloride solution; the porous composite modified carrier is obtained by crosslinking modified nano iron oxide, modified nano titanium dioxide, a functional polymer solution and glutaraldehyde. The anaerobic denitrifying bacterial agent provided by the invention can effectively improve the efficiency of treating nitrogen pollution of a water body.

This invention belongs to the field of plant extract technology, specifically relating to a plant extract composition for enhancing immunity. By weight, it is composed of the following raw materials: 3-5 parts Astragalus membranaceus extract, 2.5-4 parts Echinacea purpurea extract, and 1.5-3.5 parts Rhodiola rosea extract. This plant extract composition, through the scientific formulation of Astragalus membranaceus, Echinacea purpurea, and Rhodiola rosea, and an enzymatic extraction process, enhances the immunomodulatory effect. The combination of the three extracts increases the secretion of TNF-α and IL-6 by macrophages. Furthermore, the spleen lymphocyte stimulation index (SI) of the three extracts reaches 5.57, and the lymphocyte transformation rate increases from 191% to 457%. These results indicate that this plant extract composition effectively enhances the body's non-specific and cellular immune functions by activating macrophages and promoting T lymphocyte proliferation through multiple pathways, providing more comprehensive immune protection.

The application belongs to the technical field of biological medicine, and discloses an in-situ vaccine type mRNA-tLNP preparation for solid tumor treatment and preparation and application thereof. The preparation is designed by double targets, so that CAR-T kills more tumor cells to overcome tumor heterogeneity, changes the tumor immune microenvironment through autocrine fusion proteins (anti-PD-1 scFv and TGFbetaRII, IL-15 and Flt3L, CD40L), promotes T cell proliferation, and recruits and activates dendritic cells, cross-presents new antigens in the tumor local part, and produces in-situ vaccination effects; circular RNA encoding the above proteins is prepared, and the circular RNA is wrapped by lipid nanoparticles modified by CD3 antibodies, so as to be directly delivered to the body, and a significant solid tumor treatment effect is produced.

The present application provides a kind of porous poly-L-lactic acid microspheres, and its preparation method and injection preparation comprising porous poly-L-lactic acid microspheres, the porous poly-L-lactic acid microspheres are prepared by emulsification-solvent evaporation method from first component, second component and optional auxiliary component, wherein the first component is poly-L-lactic acid, the second component is sodium carboxymethyl cellulose, the content of the first component is 98%-99.9% of the total mass of the first component and the second component, the content of the second component is 0.1%-2% of the total mass of the first component and the second component, and the porous poly-L-lactic acid microspheres have topological morphology.

The invention provides application of periplocin in preparation of anti-PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) drugs, and belongs to the technical field of antiviral drugs. Experimental results show that periplocin has extremely remarkable inhibiting and blocking effects on a 1-bit ribosome framing process of the PRRSV virus, and can be used for effectively inhibiting the replication of the PRRSV virus so as to inhibit the proliferation of the PRRSV virus; in addition, the compound has an extremely remarkable inhibition effect on the frame shift process of-1-bit ribosomes of different strains of PRRSV viruses; the periplocin can effectively inhibit replication and proliferation of PRRSV in vitro and in vivo of live pigs, can be used for preparing products for inhibiting proliferation of the PRRSV and can be used for preparing drugs for treating and preventing diseases caused by PRRSV infection, and the drugs are broad-spectrum anti-PRRSV drugs and have wide application prospects.

The invention discloses a roe polypeptide composition with an immunity enhancing function, a preparation method, application and a preparation, and belongs to the technical field of bioactive polypeptides, the composition comprises at least one of polypeptides with the amino acid sequence being RWFPGKPLFWRA, FWKPLRGALFPW or KWRFPGALPWFA, the molecular weight is 1400-1550 Da, the preparation method comprises roe protein extraction, composite enzymolysis, ultrafiltration separation, chromatographic purification and solid-phase synthesis, and the roe polypeptide composition is prepared from the roe polypeptide composition with the immunity enhancing function. Animal experiments prove that the polypeptide can significantly enhance cellular immunity, humoral immunity, mononuclear-macrophage functions and NK cell activity, the mechanism relates to TLR2 / TLR4 receptor activation and NF-kB / MAPK signal pathways, and the polypeptide is good in safety and suitable for being developed into immunological enhancement health food or medicine.

The invention relates to the technical field of medical biological materials, and discloses a mussel mucin-chondroitin sulfate composite hydrogel and a preparation method and application thereof, and the preparation method comprises the following steps: respectively preparing a mussel mucin aqueous solution and a chondroitin sulfate aqueous solution; the mass volume concentration of the mussel mucoprotein aqueous solution is 1%-10%, the mass volume concentration of the chondroitin sulfate aqueous solution is 1%-10%, the mass ratio of the mussel mucoprotein to the chondroitin sulfate is 3: 1-1: 3, the two solutions are mixed and stirred or oscillated under the conditions that the temperature is 4-37 DEG C and the pH value is 7.0-9.0, a cross-linking reaction is conducted, and hydrogel is formed; the cross-linking mode is physical cross-linking, chemical cross-linking or physical-chemical dual cross-linking; according to the invention, excellent tissue adhesion, injectability, self-healing property and biodegradability are realized, cell adhesion and proliferation can be effectively promoted, and the gel is suitable for various medical beauty scenes such as skin filling, wound repairing and anti-aging nursing.

The application relates to the technical field of cell culture, in particular to application of Gremlin1 protein in promoting proliferation of adipose-derived cells. The application also provides a culture medium containing the Gremlin1 protein, which is used for culturing the adipose-derived cells, can significantly promote proliferation of the adipose-derived cells, and is significantly superior to a commercial special culture medium.

This invention provides an oyster peptide and its application in enhancing immunity. The oyster peptide has a novel amino acid structure. The oyster peptide can enhance the activity of immune cells, promote the proliferation of immune cells, promote the development and maturation of immune organs, regulate the in vivo immune environment, promote the secretion of immunoglobulins, and improve humoral immunity.

The present application relates to a kind of high activity Matcha yoghurt and its low-temperature microwave preparation method, belong to food processing technical field.The present application uses organic raw cow milk, Matcha powder, white granulated sugar, corn starch etc.as raw material, using the combination process of adding Matcha before fermentation, low-temperature pre-solution dispersion, microwave low-temperature sterilization, replace traditional high-temperature mixing and high-temperature sterilization, solve the existing Matcha yoghurt chlorophyll browning, tea polyphenol degradation, tea aroma loss, water retention decreases, lactic acid bacteria activity low etc.Problems.The optimal formula of the present application: Matcha powder 10g / 1000mL milk;Using 60~65 ℃ low-temperature dissolution avoids powder agglomeration;Using 40~60 ℃ microwave low-temperature sterilization maximizes to retain heat-sensitive ingredients;Add before fermentation to promote lactic acid bacteria proliferation.The yoghurt prepared has uniform green color, rich tea aroma, delicate and smooth taste, high tea polyphenol retention rate, lactic acid bacteria viable count can reach 8.85×10 8 CFU / mL, water retention ≥80%, sensory score ≥90 points.The process of the present application is simple, and can be industrialized production, suitable for high-quality functional Matcha yoghurt development.

The invention relates to the technical field of immunization. The invention discloses parabacteroides dieldrii and parabacteroides goldsteinii, an application of the parabacteroides dieldrii and / or the parabacteroides goldsteinii in preparation of an immunopotentiator of a vaccine, and the immunopotentiator of the vaccine, and particularly discloses the parabacteroides dieldrii and the parabacteroides goldsteinii, the application of the parabacteroides dieldrii and / or the parabacteroides goldsteinii in preparation of the immunopotentiator of the vaccine. The parabacteroides dieldrii and / or the parabacteroides gold can be used as an immunopotentiator, can activate immunity, enhance antibody titer and shorten antibody generation reaction time, and can remarkably promote proliferation of B cells, plasma cells and memory B cell subgroups in a hair growth center.

The invention relates to the technical field of biomedical materials and tissue engineering, and discloses sequential slow-release temperature-sensitive hydrogel and a preparation method and application thereof.The preparation method comprises the following steps that a blood sample is subjected to programmed centrifugation, and a gel layer of leukocyte-rich platelet-rich fibrin L-PRF and a gel layer of improved platelet-rich fibrin A-PRF are obtained respectively; and the gel layer is cut into pieces, pre-frozen, freeze-dried, ground and sieved, so that L-PRF freeze-dried powder and A-PRF freeze-dried powder are obtained respectively, and the methacrylic acid gelatin microspheres entrapped with the L-PRF freeze-dried powder are prepared. The microspheres and A-PRF freeze-dried powder are loaded into a temperature-sensitive hydrogel system composed of chitosan, polygalacturonic acid and sodium beta-glycerophosphate, so that the growth factors can be effectively entrapped in the hydrogel structure, and continuous release is realized; the system has good mechanical strength and structural stability, the retention time of the material in vivo is prolonged, and stable three-dimensional network support is provided.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.

This invention discloses a topical Chinese medicine preparation for treating erosive tinea pedis and its preparation method, belonging to the technical field of topical Chinese medicine preparations. The preparation consists of 15-25 parts clove, 10-20 parts alum, 20-30 parts Polygonum cuspidatum, and 10-18 parts Psoralea corylifolia, and is prepared into a spray using a 45% low-alcohol countercurrent extraction process. This invention achieves synergistic effects through a three-stage targeting mechanism: eugenol inhibits fungal CYP51A1 enzyme, blocking ergosterol synthesis (targeted enrichment rate 62.1%), resveratrol inhibits the NF-κB pathway, reducing inflammatory response, and psoralen activates the PI3K / AKT pathway, promoting epidermal repair (repair rate 69.2%). The alcohol concentration of the preparation is reduced to 45%, eliminating irritation to broken wounds. A single application takes only 1 minute, and a 7-day treatment course has a clinical efficacy rate of 84.7%, saving 320 yuan per person compared to traditional methods. This invention overcomes the shortcomings of existing drugs for treating erosive tinea pedis, such as strong irritation, cumbersome operation, and limited efficacy, and fills the gap in the category of specialized preparations, with significant social benefits and market prospects.

This invention discloses a method for preparing cell-derived exosome subsets, as well as products and applications, belonging to the field of biomedical technology. The preparation method includes: filtering cell culture medium to obtain a cell culture supernatant; concentrating the supernatant 5-30 times using a tangential flow system with a 300-500 kDa hollow fiber filter, followed by 10-20 times washing to obtain a concentrated solution; and performing Sephacryl S-400 HR gel filtration column chromatography, collecting the eluent from two 280 nm UV absorption peaks to obtain exosome subsets S1 and S2; the protein concentration of the concentrated solution is 20-50 mg / mL. This invention achieves, for the first time, precise separation of functional exosome subsets. Subset S1 exhibits strong immunomodulatory activity, and subset S2 demonstrates excellent cell regeneration promotion effects. Furthermore, the process is highly versatile and suitable for large-scale production. These subsets can be used to prepare immunomodulatory or cell regeneration-promoting drugs, providing precise technical solutions for the treatment of related diseases.

The application relates to application of Apelin-13 as a pulp stem cell differentiation promoter. The application research proves that Apelin-13 has an important role in differentiation of pulp stem cells into odontoblasts and mineralization, and application of gelatin sponge containing Apelin-13 in a pulp capping operation can improve the quality and quantity of reparative dentin formation, and the safety and effectiveness of reparative dentin formation, and will have a wide clinical application prospect.

The invention provides a silk fibroin composition for injection and a preparation method thereof, and belongs to the technical field of medical cosmetology. The silk fibroin composition is prepared from the following components in percentage by mass: 0.1 to 0.7 weight percent of hyaluronic acid or salt thereof, 0.1 to 10 weight percent of silk fibroin and the balance of phosphate buffer solution. The silk fibroin composition is used for water-light injection, can promote collagen production and inhibit collagen fibrosis, does not have adverse reactions such as skin allergy, hardening and the like, and has the effects of quickly improving the dry state of skin, fading fine wrinkles or wrinkles, replenishing water, preserving moisture and tightening the skin.

The application discloses a kind of low morbidity feed for California bass antibiotic-free breeding and preparation method thereof, belong to aquatic feed field.The feed is composed of 60~80 parts of basic feed component, 10~20 parts of fermented plant protein, 2~6 parts of functional compound additives.Fermented plant protein is prepared by compound fermentation of butyric acid clostridium and bacillus subtilis from soybean meal, bran, rice bran, brown sugar and the like.Functional compound additives include pre-embedded material and microcapsule coated sodium butyrate, and the pre-embedded material is prepared by embedding treatment of astaxanthin, lutein and rosemary extract with β-cyclodextrin and gum arabic.The application significantly reduces the incidence of intestinal inflammation of California bass through the synergistic effect of fermented plant protein, pre-embedded antioxidant combination and microcapsule sodium butyrate, enhances antioxidant capacity, improves body color, improves the stability of active ingredients and feeding rate, and realizes low morbidity under antibiotic-free breeding conditions.

The present application belongs to the field of foot and ankle surgical implant devices and biomedical material surface engineering technology, and discloses a tibial component of ankle prosthesis with a composite coating, which comprises: a metal substrate which is a bionic trabecular three-dimensional interconnected porous titanium alloy structure, the porosity is 50-80%, the average pore size is 400-900 mu m, and the connected porosity is greater than or equal to 85%, so that the elastic modulus is controlled in the range of 5-20 GPa, and is matched with the cancellous bone of the tibia; a composite functional coating is in situ grown on the surface of the metal substrate, and the composite functional coating comprises a bioactive layer and a functional ion doped layer. The tibial component of the present application comprises a porous titanium alloy metal substrate and a composite functional coating constructed in situ on the surface thereof, the porous titanium alloy substrate is designed in a bionic trabecular structure to form a three-dimensional interconnected porous structure, so as to provide an elastic modulus matched with the cancellous bone of the tibia and promote the growth of bone tissue.

This invention provides a composition comprising milk thistle extract and Akkella myxophilus. This composition can rapidly increase the abundance of Akkella myxophilus in the intestinal environment, promote its proliferation in the intestine, increase the variety and abundance of beneficial intestinal bacteria, colonize beneficial bacteria, and eliminate harmful bacteria. It has the effects of improving intestinal microecology, relieving fatigue, protecting the liver, reducing fat, relieving hangovers, anti-inflammatory, antioxidant, anti-aging, and beautifying the skin.

The application belongs to the technical field of medical materials, and provides a composite hydrogel loaded with rare ginsenoside Rh4-Ce nanoparticle, wherein the rare ginsenoside Rh4 is complexed with cerium ions to form a nanoparticle, the dispersibility and stability of the rare ginsenoside Rh4 in the hydrogel system are significantly improved, and the Ce 3+ / Ce 4+ valence state is cycled to endow the material with sustained antioxidant and microenvironment regulation capabilities, the GelMA provides a three-dimensional scaffold structure and cell attachment space, the HA provides mechanical enhancement and mineralization induction, and the CeRh4NCs cooperatively improve the local inflammatory oxidative stress microenvironment and potentially promote osteogenesis and angiogenesis. The application overcomes the technical defects of conventional bone repair materials in the application of active factors, microenvironment regulation and mechanical support, forms a multifunctional craniomaxillofacial bone defect repair material with anti-inflammatory and antioxidant properties, and promotes osteogenesis and vascularization, and has application value.

The invention relates to the technical field of daily chemical products and cosmetics, in particular to a scalp repair composition containing epidermis repair polysaccharide and saccharomycetes lysate. The skin repairing composition is prepared from the following raw materials in percentage by mass: 1 to 5 percent of skin repairing polysaccharide; 1%-5% of a yeast lysate; 1%-10% of PEG-5 (Polyethylene Glycol) glycerate triisostearate; and the balance of cosmetically acceptable matrix. The polysaccharide is mannan which is obtained by fermenting Paenibacillus sp.1538, and the weight-average molecular weight of the mannan is 6.15 * 10 < 6 > Da. The specific ultra-high molecular weight polysaccharide is compounded with the saccharomyces cerevisiae extract, and the low-irritation PEG-5 glycerate triisostearate is introduced, so that the compatibility problem that the high molecular weight polysaccharide is easy to flocculate is effectively solved. The composition can form a film immediately, deeply resist inflammation, relieve and repair a physical barrier of scalp, has an excellent synergistic effect, and solves the problem of scalp chemical stimulation injury caused by a traditional surfactant from the source.

This invention belongs to the field of saline-alkali land improvement technology, specifically relating to a compound microbial agent and its application in saline-alkali land improvement. This invention prepares a compound microbial agent for improving saline-alkali land using microorganisms such as Chaetomium coccidioides, Bacillus subtilis, Bacillus licheniformis, Bacillus belye, and humic acid. When applied to saline-alkali land improvement, this agent not only significantly improves the soil's physical and chemical properties but also significantly reduces the number of stunted cotton seedlings, increases cotton seed yield, and improves fiber quality.

The application belongs to the field of treating blood vessel-bone coupling imbalance diseases in traditional Chinese medicine, and particularly relates to a composition for treating blood vessel-bone coupling imbalance diseases, a pharmaceutical preparation and application. Geniposide alone or in combination with crocin I can effectively reduce endothelial cell damage under pathological stimulation conditions, reduce the level of cell apoptosis and the degree of oxidative stress, improve the vascular endothelial function state, and can also significantly inhibit osteoclast differentiation, reduce the number of mature osteoclasts, and reduce bone resorption activity, thereby being conducive to restoring the dynamic balance between bone formation and bone resorption.