Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

64results about How to "Promote differentiation" patented technology

Mesenchymal stem cell composition as well as preparation method and application thereof in knee joint products

The invention provides a mesenchymal stem cell composition as well as a preparation method and application thereof in knee joint products, and belongs to the technical field of medicines. The invention relates to application of a mesenchymal stem cell combined naringin derivative in preparation of medicines for treating osteoporosis and repairing knee joint injury and arthritis. The naringin derivative is prepared from naringin through an ether esterification reaction, the metabolic cycle of the naringin derivative is prolonged and the water solubility is improved while the original activity is maintained, so that the free drug concentration and tissue infiltration capacity in bones are improved, the bioavailability of the naringin derivative is improved, and the bioavailability of the naringin derivative is improved. The prepared mesenchymal stem cell composition can induce mesenchymal stem cell osteogenic differentiation and improve bone repair capacity, has a good intervention effect on osteoporosis, has a sustained and controlled release effect and prolongs medicinal time.
Owner:BEIJING SINOMENIUM STEM CELL TECH RES INST CO LTD

Time sequence slow-release temperature-sensitive hydrogel as well as preparation method and application thereof

PendingCN121971700ARealize synergyAchieve sustained releaseProsthesisWhite blood cellSodium phosphates
The invention relates to the technical field of biomedical materials and tissue engineering, and discloses sequential slow-release temperature-sensitive hydrogel and a preparation method and application thereof.The preparation method comprises the following steps that a blood sample is subjected to programmed centrifugation, and a gel layer of leukocyte-rich platelet-rich fibrin L-PRF and a gel layer of improved platelet-rich fibrin A-PRF are obtained respectively; and the gel layer is cut into pieces, pre-frozen, freeze-dried, ground and sieved, so that L-PRF freeze-dried powder and A-PRF freeze-dried powder are obtained respectively, and the methacrylic acid gelatin microspheres entrapped with the L-PRF freeze-dried powder are prepared. The microspheres and A-PRF freeze-dried powder are loaded into a temperature-sensitive hydrogel system composed of chitosan, polygalacturonic acid and sodium beta-glycerophosphate, so that the growth factors can be effectively entrapped in the hydrogel structure, and continuous release is realized; the system has good mechanical strength and structural stability, the retention time of the material in vivo is prolonged, and stable three-dimensional network support is provided.
Owner:JILIN UNIVERSITY

Application of reagent for promoting expression of miR-15b-5p in preparation of medicine for promoting muscle injury repair

PendingCN121943943Apromote proliferationInhibit inflammationOrganic active ingredientsAntipyreticNucleotideMuscle injury
The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.
Owner:SICHUAN AGRI UNIV

An aged adipose tissue-derived mesenchymal stem cell pretreated by MK8722, a preparation method and application thereof

ActiveCN122405544Bimprove functional statusreduced motor function
The present application relates to the field of cell therapy and regenerative medicine, and in particular to a kind of old age adipose tissue-derived mesenchymal stem cells pretreated by MK8722, its preparation method and application.The method comprises the following steps: the old age adipose tissue-derived mesenchymal stem cells are inoculated in culture solution containing MK8722 to carry out in vitro treatment, and first cells are obtained;The culture solution containing MK8722 is removed, and the first cells are washed to obtain second cells;Second cells are cultured using culture solution without MK8722, and the old age adipose tissue-derived mesenchymal stem cells pretreated by MK8722 are obtained.The cells obtained by the method, relative to the old age adipose tissue-derived mesenchymal stem cells without the in vitro treatment, show at least one improvement in proliferation capacity, continuous passage amplification capacity, adipogenic differentiation capacity or chondrogenic differentiation capacity, and can be used to prepare products for treating or alleviating osteoarthritis.
Owner:HAINAN MEDICAL UNIV

Use of apelin-13 as a differentiation promoter for dental pulp stem cells

ActiveCN116656599Bclear physiological activitypromote proliferation
The application relates to application of Apelin-13 as a pulp stem cell differentiation promoter. The application research proves that Apelin-13 has an important role in differentiation of pulp stem cells into odontoblasts and mineralization, and application of gelatin sponge containing Apelin-13 in a pulp capping operation can improve the quality and quantity of reparative dentin formation, and the safety and effectiveness of reparative dentin formation, and will have a wide clinical application prospect.
Owner:SHANDONG UNIV

A method for rapid asexual propagation of a new variety of ginger flower

ActiveCN117751779BInducing seedlings quicklyImprove seedling rateRoot crop cultivationHand equipments
This invention discloses a method for the rapid asexual propagation of a new ginger lily variety, comprising the following steps: obtaining rhizomes; treating with gibberellin, stacking several layers of rhizomes in a frame by layering them with wet straw, and then placing the frame containing the rhizomes and straw in a dark environment to promote germination; removing rhizomes with sprouting buds, quickly dipping them in a chlorpyrifos solution, and then cultivating them in a shaded area with humidity, allowing the stem buds to grow and differentiate into root tip tissue; uniformly spraying a growth regulator solution onto the surface of the rhizomes and stem buds, cultivating them in a shaded area with humidity, allowing the stem buds to grow into seedlings, dividing the rhizomes to obtain seedlings with complete root systems, and transplanting them; neatly arranging the transplanted seedlings on a seedbed in a shaded area, cultivating them with humidity, watering with a hymexazol solution at regular intervals, spraying foliar fertilizer when the seedlings develop leaves, and transplanting or releasing them from the nursery when the leaf and stem height reaches the standard. Advantages include: balancing the speed and seedling survival rate of asexual propagation of ginger lily, improving the propagation coefficient and seedling quality of the 'Huayao' ginger lily.
Owner:HUAYUAN LANDSCAPE ARCHITECTURE CO LTD +1

Composite hydrogel loaded with rare human ginsenoside Rh4-ce nanoparticles

The application belongs to the technical field of medical materials, and provides a composite hydrogel loaded with rare ginsenoside Rh4-Ce nanoparticle, wherein the rare ginsenoside Rh4 is complexed with cerium ions to form a nanoparticle, the dispersibility and stability of the rare ginsenoside Rh4 in the hydrogel system are significantly improved, and the Ce 3+ / Ce 4+ valence state is cycled to endow the material with sustained antioxidant and microenvironment regulation capabilities, the GelMA provides a three-dimensional scaffold structure and cell attachment space, the HA provides mechanical enhancement and mineralization induction, and the CeRh4NCs cooperatively improve the local inflammatory oxidative stress microenvironment and potentially promote osteogenesis and angiogenesis. The application overcomes the technical defects of conventional bone repair materials in the application of active factors, microenvironment regulation and mechanical support, forms a multifunctional craniomaxillofacial bone defect repair material with anti-inflammatory and antioxidant properties, and promotes osteogenesis and vascularization, and has application value.
Owner:JILIN UNIVERSITY

Adeno-associated virus targeting sfpq and use thereof in the manufacture of a medicament for treating neuroblastoma

The application provides a guide RNA which targets SFPQ, primer sequences of the guide RNA are as follows: SFPQ sgRNA-FWD: 5'-CGTACTCAAACGTGCCATG-3'; SFPQ sgRNA-REV: 5'-CATGGCACGTTTGAGTACG-3'. The application also provides an adeno-associated virus which targets SFPQ and contains the guide RNA. The application also provides use of the adeno-associated virus which targets SFPQ in preparation of a drug for treating neuroblastoma. The adeno-associated virus which targets SFPQ provided by the application can not only inhibit tumor growth, but also promote NB cell differentiation, thereby providing a new strategy for NB treatment.
Owner:RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE

3D printing tenon-mortise composite drug-loaded femoral head necrosis reconstruction rod and preparation method thereof

PendingCN122581936Aavoid frettingImprove anti-rotation
This invention relates to the field of orthopedic repair technology, and provides a 3D-printed mortise-and-tenon composite drug-loaded femoral head necrosis reconstruction rod and its preparation method. The reconstruction rod includes a skeleton, the inner cavity of which has a three-dimensional, interconnected, micron-scale topological porous structure; both the outer surface of the skeleton and the surface of the micron-scale topological porous structure are covered with a drug composite layer; the outer surface of the skeleton has multiple tenons for forming a mortise-and-tenon lock with the inner wall of the femoral head medullary cavity; the drug composite layer contains a first drug that inhibits osteoclast activity and a second drug that promotes osteoblast differentiation. This invention achieves anti-rotation and anti-settlement mechanical locking with the host bone through a biomimetic mortise-and-tenon structure, and actively regulates the local bone repair microenvironment by loading dual drugs that inhibit osteoclast activity and promote osteoblast differentiation, ultimately achieving bio-integrated fixation mimicking natural bone.
Owner:PEOPLES HOSPITAL OF XINJIANG UYGUR AUTONOMOUS REGION

Traditional Chinese medicine composition for wound repair, preparation, preparation method and application thereof

ActiveCN118743730BHas hemostatic effectpromote differentiationAntipyreticAnalgesics
The application discloses a traditional Chinese medicine composition for repairing a wound, a preparation method and application thereof, and belongs to the technical field of traditional Chinese medicines. The traditional Chinese medicine composition has the effects of clearing heat and resolving toxins, eliminating swelling and removing blood stasis, and has the effects of immune regulation and anti-fibrosis, so that the traditional Chinese medicine composition has the effects of dissipating blood stasis and eliminating muscle nodules in the process of repairing the wound. The traditional Chinese medicine composition also has the effects of reducing swelling and relieving pain. The traditional Chinese medicine composition has the effects of stopping bleeding and relieving pain. The traditional Chinese medicine composition has the effects of promoting cell differentiation and promoting muscle regeneration. The traditional Chinese medicine composition has the effects of promoting blood circulation and the traditional Chinese medicine composition has the effects of promoting muscle regeneration. The traditional Chinese medicine composition has the effects of preventing inflammation and scars and promoting wound healing through specific combinations and synergistic effects according to monarchs, ministers, and assistants.
Owner:FIRST AFFILIATED HOSPITAL OF XINJIANG MEDICAL UNIVERSITY

A bio-adaptive surface composite modification method for beta titanium alloy

This invention provides a biocompatible β This invention relates to a method for composite modification of titanium alloy surfaces, belonging to the technical field of alloy modification methods. The invention includes applications in medical... β This invention involves introducing bioactive particles onto the surface of a titanium alloy substrate, performing friction stir processing (FSP) on the substrate to introduce bioactive particles and construct a gradient grain structure, and then subjecting the FSP-treated substrate to compressed plasma flow (CPF) treatment to achieve uniform distribution of bioactive particles and construct a topology with an average surface roughness of 3-6 μm suitable for cell growth. The invention precisely controls the amount of bioactive particles introduced and constructs a gradient grain structure through friction stir processing (FSP); simultaneously, compressed plasma flow (CPF) technology achieves uniform distribution of bioactive particles and an ideal surface roughness of 3-6 μm on the titanium alloy surface. Ultimately, this significantly improves the cell adhesion, proliferation capacity, and osteogenic properties of the material surface, solving the technical problem of low integration efficiency of traditional titanium alloy implants with human bone tissue.
Owner:SHANGHAI JIAOTONG UNIV

A method for constructing a 3D-printed liver organoid scaffold loaded with fh1 alginate sodium microspheres assembled mesenchymal stem cells

The application discloses a construction method of a 3D printing liver organoid support loaded with mesenchymal stem cells assembled by FH1 sodium alginate microspheres, and comprises the following steps: preparing CaO2@ZIF-8@SL; preparing FH1-loaded sodium alginate microspheres FH1@SA; and preparing a 3D printing liver organoid support. The 3D printing liver organoid support prepared by the method can significantly enhance the differentiation of human umbilical cord mesenchymal stem cells into functional stem cells, and can be used for constructing a human liver organoid model.
Owner:NINGXIA MEDICAL UNIVERSITY GENERAL HOSPITAL

Promoter for differentiation into cartilage cell, cartilage cell propagation promoter, and cartilage matrix production promoter

PendingEP4403178A4superior in stability and safetypromote differentiationOrganic active ingredientsCulture process
The present invention relates to promoters for differentiation into chondrocytes, chondrocyte proliferation promoter, and cartilaginous matrix production promoter, each containing a glycoside of liquiritigenin. According to the present invention, promoters for differentiation into chondrocytes, promoters for proliferation of chondrocytes, and promoters for cartilaginous matrix production, that are superior in the stability and safety, have a superior promoting action on differentiation into chondrocytes, a superior promoting action on proliferation of chondrocytes, and a superior promoting action on cartilaginous matrix production, and effective for regeneration of cartilage and further, prophylaxis or improvement of symptoms and diseases caused by the damage and inflammation of cartilage, or symptoms and diseases showing the loss of cartilage such as osteoarthritis and the like.
Owner:HOKURIKU UNIVERSITY +1

Use of agents related to sarm1 in the preparation of a diagnostic and / or therapeutic product for hemophagocytic lymphohistiocytosis-like liver injury

This invention relates to the field of biopharmaceutical technology, specifically to... SARM1 The application of related reagents in the preparation of products for the diagnosis and / or treatment of hemophagocytic lymphohistiocytosis-like liver injury. The results of this invention demonstrate... SARM1 It is both a circulating biomarker in HLH and an intrinsic regulator of iNKT cell fate. SARM1 By stabilizing LCK and maintaining TCR signaling, excessive iNKT1 bias and IFN-γ-driven liver injury can be prevented. These findings highlight... SARM1 Its important value as a potential diagnostic biomarker and therapeutic target for HLH in children provides a new strategy for the treatment of hemophagocytic lymphohistiocytosis-like liver injury in children.
Owner:AFFILIATED HOSPITAL OF ZUNYI UNIV

Co-culture method of cell culture meat and application of co-culture method in improving meat quality and flavor

The invention discloses a co-culture method of cell culture meat and application of the co-culture method in improving meat quality and flavor. According to the invention, through two-stage differentiation, muscle precursor cells and fat precursor cells are respectively subjected to proliferation culture, then are separately subjected to primary differentiation, and are mixed together for co-culture, and meanwhile, second-stage continuous differentiation is carried out; the problem that differentiation of muscle cells and fat cells cannot be effectively and simultaneously differentiated under the co-culture condition due to different requirements of differentiation of muscle cells and fat cells on the serum environment is solved. In addition, the invention also provides an objective standard for evaluating the flavor quality of cell culture meat generated by co-culture. The cell culture meat with different flavors can be obtained by adjusting the proportion of the co-culture cells through the co-culture method, and the flavor quality of the cell culture meat from other sources can be evaluated and detected through the amino acid detection means.
Owner:CHONGQING ACAD OF ANIMAL SCI +1

Use of a wnt5b inhibitor in the preparation of a medicament for the treatment of fibrous dysplasia of the bone

PendingCN122582274Apromote differentiation
The application belongs to the technical field of biological medicine, and specifically discloses application of a WNT5B inhibitor in preparation of a medicament for treating fibrous dysplasia (FD). The inventor finds that WNT5B gene and protein are significantly highly expressed in lesion tissues of FD patients, WNT5B acts as a downstream effector molecule of GNAS mutation, on the one hand, can inhibit osteoblast activity through a WNT5B / SPP1 axis, leading to bone formation disorder, on the other hand, can directly promote osteoclast differentiation and enhance bone resorption activity. The WNT5B inhibitor in the application is selected from an anti-WNT5B antibody or an antigen binding fragment thereof, a nucleic acid inhibitor targeting WNT5B or a combination thereof, can inhibit a WNT5B related signal pathway, simultaneously block the inhibition of WNT5B on osteogenesis and the promotion of WNT5B on osteoclasts, restore the balance between bone formation and bone resorption, and provide a new specific treatment strategy for FD treatment.
Owner:SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE

A method for promoting differentiation of lycoris squamiferum scales and reducing scale browning

ActiveCN119790987Bpromote differentiationHigh differentiation rate
The present application relates to the technical field of plant tissue culture, and particularly relates to a method for promoting scale differentiation of Lilium auratum and reducing scale browning. ‑1 When NAA is 0.05 mg / L ‑1 , TDZ is 0.25 mg / L ‑1 , and AC is 6 g / L, the scale differentiation rate of Lilium auratum can reach 71.66%±6.00ab, the browning rate is reduced to 26.66%±6.00c, and the bulb growth is significantly promoted, and the bulb size can reach (0.52 cm±0.01ab)×(0.4 cm±0.02a), which can provide support for efficient propagation of Lilium auratum bulbs.
Owner:INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES

A growth regulator for promoting female and reducing male of chinese chestnut and its preparation method and application

ActiveCN117256612BPromote estrogen and reduce malenessIncrease male to female ratioBiocidePlant growth regulatorsBiotechnologyPaclobutrazol
The present application relates to the field of Chinese chestnut planting, and in particular, relates to a Chinese chestnut female-promoting and male-reducing growth regulator as well as a preparation method and application thereof. The Chinese chestnut female-promoting and male-reducing growth regulator comprises the following components: paclobutrazol, 6-benzylaminoadenine and a surfactant; wherein the concentration of the paclobutrazol is 20-100 mg / L; the concentration of the 6-benzylaminoadenine is 20-100 mg / L; and the volume concentration of the surfactant is 1%-3%. The Chinese chestnut female-promoting and male-reducing growth regulator is safe and reliable, has obvious effects, is good in stability and easy to operate, can be applied to the production of chestnut farmers, promotes the increase of female flowers and the reduction of male flowers of Chinese chestnut, promotes the differentiation of female flowers of Chinese chestnut, increases the female-male ratio of Chinese chestnut, and obviously increases the yield of a single Chinese chestnut tree.
Owner:BEIJING UNIV OF AGRI

Composite hydrogel for promoting tissue regeneration and repair as well as preparation method and application of composite hydrogel

PendingCN121927130AImprove smart responsivenessImprove biological activityProsthesisDisulfide bondingPropanoic acid
The invention provides composite hydrogel for promoting tissue regeneration and repair as well as a preparation method and application of the composite hydrogel, and belongs to the field of hydrogel materials. The method comprises the following steps: carrying out anhydride aminolysis ring-opening reaction on a styrene-maleic anhydride alternating copolymer, amino polyethylene glycol methyl ether, 3-aminophenylboronic acid and cysteamine hydrochloride; the preparation method comprises the following steps: carrying out a first amidation reaction on GRGDS pentapeptide and an SPDP cross-linking agent, then carrying out a disulfide bond exchange reaction on the obtained product and GPLGIAGQ-PEG-SH, and finally carrying out a second amidation reaction on the obtained product and 3-maleimide propionic acid-NHS ester; the preparation method comprises the following steps: carrying out a modification reaction on a PEDOT: PSS aqueous dispersion and 3-aminopropyltriethoxysilane; the preparation method comprises the following steps: mixing a multifunctional polymer, a signal molecule, a conductive component, four-arm PEG-hydrazide and oxidized sodium alginate, and sequentially carrying out physical gelation and chemical crosslinking to obtain the composite hydrogel. Therefore, the intelligent responsiveness, the biological activity and the conductivity of the hydrogel are synergistically improved.
Owner:HUNAN UNIV OF CHINESE MEDICINE

Liquid-solid two-phase coupling culture method of coriolus versicolor and application thereof to rapid identification of introduction of coriolus versicolor

The present application relates to edible mushroom culture identification technical field, specifically a liquid-solid dual-phase coupling culture method of Coriolus hirsutus and application thereof in rapidly identifying correct introduction of Coriolus hirsutus.The method of the present application constructs a liquid-solid dual-phase coupling culture system, combines with sugar agar layer regulation, low-temperature stimulation, etc., realizes rapid determination of Coriolus hirsutus strain characteristics based on the obtained fruiting body, avoids introduction confusion phenomenon, and can also judge strain activity through the fruiting body state, significantly improves the efficiency and benefit of cultivation production and other links.
Owner:GUIZHOU BIOTECHNOLOGY RES & DEV BASE CO LTD

Biomarker for diagnosing pulmonary fibrosis and application of biomarker

The invention discloses a biomarker for diagnosing pulmonary fibrosis and application of the biomarker, and belongs to the technical field of biomarkers in clinical medicine. The biological marker for preparing and diagnosing pulmonary fibrosis is a nerve growth factor NGF, the nerve growth factor NGF can remarkably promote differentiation of lung fibroblast MRC5 cells, and along with expression increase of a receptor TrkA of the lung fibroblast MRC5 cells, the migration capacity and the multiplication capacity of the lung fibroblast MRC5 cells are remarkably enhanced. Meanwhile, the NGF also aggravates the formation of the BLM-induced pulmonary fibrosis of the mouse. Therefore, the nerve growth factor NGF as the biomarker has accurate and specific detection and auxiliary diagnosis on pulmonary fibrosis, especially idiopathic pulmonary fibrosis (IPF).
Owner:GUIZHOU PROVINCIAL PEOPLES HOSPITAL

Preparation method of a double-crosslinked 3D printing bone repair scaffold

ActiveCN121338091Bachieve controllabilityachieve biological activityAdditive manufacturing apparatusProsthesis3d printBiphasic calcium phosphate
The application relates to the technical field of biomedical materials, and specifically discloses a preparation method of a double-crosslinked 3D-printed bone repair scaffold. The scaffold is made of a biphasic calcium phosphate matrix and a gelatin methacrylate hydrogel outer layer. The preparation method comprises the following steps: firstly, preparing biphasic calcium phosphate ink, and constructing a porous scaffold blank through 3D printing; then, carrying out double-crosslinking treatment of calcium chloride solution and glutaraldehyde solution in sequence to obtain a scaffold matrix with enhanced mechanical properties; then, preparing gelatin methacrylate hydrogel loaded with modified teriparatide, and compounding the gelatin methacrylate hydrogel with the scaffold matrix; and finally, obtaining the final product after blue light crosslinking and solidification. The bone repair scaffold has good biocompatibility and osteogenic activity, and can effectively promote bone defect repair. In addition, the preparation method is controllable and has good repeatability, the structure of the scaffold is accurately controlled through the 3D printing technology, and a new approach is provided for the preparation of personalized bone repair materials.
Owner:LANZHOU UNIV SECOND HOSPITAL

Pearl mussel source miRNA and application thereof, biological preparation and application thereof

The invention relates to the technical field of biological medicines and functional nucleic acid molecules, and discloses pearl mussel source miRNA and application thereof, a biological preparation and application thereof. The pearl mussel source miRNA is miRNA derived from a pearl mussel pallium exosome, contains a sequence shown in SEQ ID NO: 1, and can be modified by phosphorylation, locked nucleic acid and the like to enhance the stability. The biological preparation containing the miRNA can be used for preparing a medicine for preventing and / or treating osteoporosis or functional food for promoting bone mineralization, and the bone mineral density and the bone microstructure are improved by promoting osteoblast proliferation, differentiation and mineralization. According to the invention, marine biological resources which are natural in source and high in safety are utilized, and new active ingredients and technical schemes are provided for prevention and treatment of osteoporosis.
Owner:SHENZHEN UNIV

Transpterygoid implant and its processing technology

PendingCN122253097AReduce risk of early looseningImprove adhesionDental implantsCleaning using liquidsAcid etchingOsteoblast adhesion
The application relates to the technical field of dental implants, in particular to a trans-zygomatic implant and a processing technology thereof, and the processing technology comprises variable-distance multi-stage sand blasting and acid etching surface treatment on an anchoring part with threads of the trans-zygomatic implant and electrochemical polishing surface treatment on an extension part without threads. The trans-zygomatic implant is treated by variable-distance multi-stage sand blasting combined with acid etching, so that a uniform micron-level rough base and a multi-stage micropore structure can be formed on the titanium surface, osteoblast adhesion and differentiation are facilitated, the early bone combination speed is accelerated, the combination strength is improved, the early implant loosening risk is reduced, the extension part of the trans-zygomatic implant is treated by electrochemical polishing, a smooth surface can be obtained, plaque adhesion and bacterial colonization are greatly reduced, the implant peri-implantitis risk is reduced, and soft tissue adhesion is promoted; the dual optimization of bone anchoring and tissue adhesion is realized, and the long-term function and health of the trans-zygomatic implant under complex stress are guaranteed.
Owner:WEIHAI DUOPULE MEDICAL EQUIP CO LTD

Composition for promoting myotube formation and maintaining muscle health

The invention discloses a composition for promoting myotube formation and maintaining muscle health. The problem that in the prior art, leucine or a simple combination of leucine and other BCAA is poor in muscle regeneration promoting effect is solved. A composition for promoting myotube formation and maintaining muscle health includes leucine, isoleucine, and alpha-ketoglutaric acid. The invention proves that the combination of the three has a remarkable combination effect in promoting myoblasts to differentiate into myotubes. The test data shows that the differentiation promoting effect of the combination of the three components is obviously better than that of any single component or double component combination, and the cell proliferation test proves that the composition has no obvious influence on the proliferation of C2C12 myoblasts and even eliminates toxic interference at high concentration. It is shown that the beneficial effect of promoting the increase of myotube number is specifically achieved by enhancing the differentiation process of cells rather than simple proliferation promoting action and pointing to more mature muscle function formation, and therefore the composition can be applied to the situation that muscle regeneration needs to be promoted, and muscle atrophy is improved or prevented.
Owner:SHANGHAI YUANZHIJIANKANG DIGITAL TECHNOLOGY CO LTD

Spinal cord injury repairing method based on biphase fibroin and methacryloyl hydrogel

A spinal cord injury repair method based on biphase fibroin and methacryloyl hydrogel comprises the following steps: firstly, encapsulating NT-3 and NSCs in PLGA microspheres through a microsphere technology, and integrating Ang-(1-7) into SilMA hydrogel, so as to construct the biphase SilMA multifunctional hydrogel (DPSH) with time-specific drug controlled release. The hydrogel shows a remarkable anti-inflammatory effect in an in-vivo experiment, can effectively inhibit the inflammatory reaction at the early stage of spinal cord injury, promotes NSCs to be differentiated into neurons by improving a microenvironment and inhibits formation of glial scars, so that the nerve repair efficiency is improved.
Owner:SHANDONG UNIV

Titanium alloy matching elastic modulus of human cortical bone and preparation method thereof

PendingCN122588406AMatching cortical bone needsavoid stress concentration
The application discloses a titanium alloy matched with the elastic modulus of human cortical bone and a preparation method thereof. The titanium alloy comprises 27-29% of Nb, 0.3-3% of Mn, 0.2-0.6% of Mg, 0.15-0.6% of O, and the balance of Ti and inevitable impurities. The titanium alloy spontaneously forms a connected multi-level pore network through in-situ reaction of metal and O elements. The elastic modulus of the titanium alloy is 12-28 GPa, and the yield strength is greater than or equal to 550 MPa. The titanium alloy adopts the path of in-situ precipitation induced pore formation. On the premise of ensuring the compactness of the overall surface, the connected multi-level pore network is spontaneously formed in the interior. The elastic modulus is precisely controlled in the range of 10-30 GPa, the requirement of human cortical bone is matched, the stress concentration problem caused by macro-pores is avoided, the yield strength of the alloy can be kept above 550 MPa, and the low modulus and high strength are considered.
Owner:GUANGDONG INST OF NEW MATERIALS

A SNP marker for promoting preadipocyte differentiation and identifying broilers with high abdominal fat percentage and its application

This invention proposes a SNP marker for promoting preadipocyte differentiation in chickens and identifying broilers with high abdominal fat percentage, and its application, belonging to the field of animal molecular genetics. It includes an SNP marker for promoting preadipocyte differentiation in chickens and identifying broilers with high abdominal fat percentage. The SNP marker uses the sequence shown in SEQ ID NO.1 as its starting sequence, with position 51 being either A or G. If the SNP is of the GG genotype, it indicates a broiler with high abdominal fat percentage. Replacing A with G at position 51 promotes preadipocyte differentiation in chickens. It is mainly used to promote preadipocyte differentiation in chickens and identify broilers with high abdominal fat percentage.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Femtosecond laser-based implant with neck controllable hierarchical microporous structure and preparation method thereof

PendingCN121944220AEnhanced sealing qualityImplement orderly releaseSurgeryProsthesisFemto second laserLaser scanning
The invention discloses a femtosecond laser-based implant with a neck controllable hierarchical microporous structure and a preparation method thereof, and relates to the technical field of dental implant preparation. According to the method, aiming at the neck area of the implant, the processing characteristics of high precision and low heat influence of femtosecond laser are utilized, and a graded micropore structure with controllable aperture size and spatial distribution is constructed in the neck area by regulating and controlling the laser scanning times; the graded microporous structure comprises at least two stages of micropores with different pore diameters and is used for realizing graded loading of functional particles or bioactive components. Compared with an existing dental implant surface treatment mode, on the premise that the overall mechanical property of the implant is not damaged, precise regulation and control over the surface appearance of the neck area are achieved, the hydrophilicity, biological activity and antibacterial and anti-inflammatory performance of the surface are remarkably improved, the soft and hard tissue interface environment is improved, and the long-term stability of the implant is improved.
Owner:YUEMEI BIOTECHNOLOGY (SUZHOU) CO LTD

Polyacidic mild acne-removing compositions, processes for their preparation and use

PendingCN122499049AGuaranteed powerful anti-acne abilityless irritating
This invention discloses a polyacid-based mild acne-removing composition, its preparation method, and its application, belonging to the field of acne treatment preparation technology. By mass percentage, the polyacid-based mild acne-removing composition comprises 1%–10% bee venom peptide, 0.25%–5% microcapsules containing polydeoxyribonucleotides, 0.2%–1.5% soothing active ingredients, 0.5%–3% biosaccharide gum-1, 0.2%–2% biosaccharide gum-2, 0.05%–0.5% astragalus gum, 0.1%–1% pH buffering compound, 2%–10% acid mixture, and 3%–20% alcohol mixture, with the balance being water. This acne-removing composition achieved a low-irritation user experience with a high-concentration polyacid formula in subjects with sensitive, mild to moderate facial acne, effectively improving the problems of poor tolerance and limited applicability of traditional acid-based acne products for sensitive skin, significantly broadening the applicable skin types and application scenarios for high-efficacy acid-based acne products, and balancing effective acne removal with safety suitable for sensitive skin.
Owner:XIAN BOHE MEDICAL TECH CO LTD