Unlock instant, AI-driven research and patent intelligence for your innovation.

Fluorescence PCR detection method of Thelenota ananas, and primers and probe for detecting Thelenota ananas

A plum flower ginseng and probe technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., to meet the requirements of rapid screening and identification, high sensitivity and specificity, and simple operation Effect

Pending Publication Date: 2020-01-17
ZHEJIANG ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional sea cucumber identification methods mainly rely on the external morphology and anatomical characteristics of sea cucumbers, such as the characteristics of bone fragments and the presence or absence of respiratory trees, etc., but this often requires the rich experience of the identification personnel

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescence PCR detection method of Thelenota ananas, and primers and probe for detecting Thelenota ananas
  • Fluorescence PCR detection method of Thelenota ananas, and primers and probe for detecting Thelenota ananas
  • Fluorescence PCR detection method of Thelenota ananas, and primers and probe for detecting Thelenota ananas

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Implementation Example 1: Design of Primers and Probes

[0036] Based on the highly species-specific mitochondrial COI gene sequence (GenBank: AF486424.1), a pair of specific amplification primers TA-F and TA-R were screened out, and a set was set in the amplification region of the primer pair. A specific probe TA-P, and a fluorescent signal is labeled on the probe to realize real-time fluorescence detection. The specific amplification primers and probe sequences of the plum blossom ginseng are respectively:

[0037] TA-F:GCTCAACCAGGATCCCTTCT

[0038] TA-R: CCGGCTCCTCTTTCTACTCC

[0039] TA-P: FAM-CCTTCCCCCGAATGAACAAC-Eclipse.

[0040] And according to GB / T25165-2010, prepare primers 18SrRNA-F, 18SrRNA-R and probe 18SrRNA-P for detecting eukaryotes, which can be used as internal reference primers and probes to test the quality of the extracted DNA. The internal reference primer and probe sequences are respectively:

[0041] 18SrRNA-F:CCTGAGAAACGGCTACCAT

[0042] 18...

Embodiment 2

[0044] Implementation Example 2: Sample DNA Extraction

[0045] Take 2 g of plum flower ginseng tissue after foaming in cold water for 12 h, grind it thoroughly, use a DNA extraction kit (DNeasynericon Food Kit, QIAGEN), and perform DNA extraction according to the instructions, and dissolve the extracted DNA in 30 μL-100 μL water (can be Adjust as needed for concentration). In the extraction process, sea cucumbers of other species that do not contain plum ginseng components were set as negative controls.

Embodiment 3

[0046] Implementation Example 3: Detection of samples by real-time fluorescent PCR, judgment of results, and preparation of detection kits

[0047] Real-time fluorescent PCR amplification reaction. The primer and probe sequences are shown in Table 1. The real-time fluorescent PCR reaction system is as follows: 10 μL Premix Ex Taq (Takara), 0.4 μL of upstream primer (10 pmol / μL), 0.4 μL of downstream primer (10 pmol / μL), probe (10 pmol / μL) μL) 0.4 μL, take 2 μL of the DNA solution extracted above, and make up the volume to 20 μL with water. Real-time fluorescent PCR instrument lightcycle 480 (Roche) was used for the reaction, and the reaction program was (1) 95°C, 10sec; (2) 95°C, 5sec; 60°C, 23sec; 50 cycles.

[0048]In addition to the samples in the detection process, a positive control (that is, a DNA sample of plum blossom ginseng, and a sample with a DNA concentration ≥ 60 ng / μL should be set as a positive control as much as possible to meet the Ct value ≤ 35, so that the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a real-time fluorescence PCR detection method of Thelenota ananas; and moreover, primers and a probe with species specificity are designed on basis of a highly species-specific Thelenota ananas mitochondrial cytochrome oxidase subunit I sequence (GenBank: FJ589205.1) so as to realize species identification on the Thelenota ananas by adopting a Real-Time PCR method. Owe torelatively high specificity and sensitivity of the primers and the probe, the real-time fluorescence PCR detection method of the Thelenota ananas can be used for identifying authenticity of deep processed sea cucumber products.

Description

technical field [0001] The invention relates to a real-time fluorescent PCR detection method for plum flower ginseng (Thelenota ananas). The invention discloses the detection and identification of species components of plum blossom ginseng by using TaqMan probe real-time fluorescent PCR detection technology, and belongs to the field of biotechnology. Background technique [0002] Sea cucumbers belong to the class Holothuroidea of ​​the phylum Echinodermata. There are more than 1,400 species of sea cucumbers in the world, belonging to 6 orders and 25 families, and more than 140 species are distributed in China. But there are about 40 kinds of edible sea cucumbers in the world, and there are more than 20 kinds of sea cucumbers produced in China's sea area. However, the prices of various sea cucumbers vary greatly due to differences in nutritional components and contents of some important biologically active substances (such as sea cucumber polysaccharides, polypeptides, sea c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/686C12N15/11
CPCC12Q1/6888C12Q1/686C12Q2561/113C12Q2563/107C12Q2545/114
Inventor 张晓峰吴姗张明哲虞惠贞尹文秀张荃孙超
Owner ZHEJIANG ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More