CRISPR (Clustered regularly interspaced short palindromic repeats)/Cas12 one-step nucleic acid detection method and 2019-nCoV detection kit

A technology for detection kits and detection methods, which is applied in the fields of microorganism-based methods, biochemical equipment and methods, and microorganism determination/inspection, etc., which can solve the problem that the results cannot be interpreted visually, the difficulty of popularizing basic inspection institutions, and the increase of complicated operations. problems, such as low cost, fast response, and easy operation

Active Publication Date: 2020-08-28
亚能生物技术(深圳)有限公司
View PDF7 Cites 26 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, on the one hand, the step-by-step operation increases the complexity of the operation, on the other hand, the entire detection takes longer, and at the same time, the operation of opening the cover can easily form aerosols, causing pollution to the nucleic acid laboratory, which is not conducive to clinical application
[0010] In addition, the existing CRISPR / cas12 detection system still needs the help of a fluorescence detector, and the results cannot be interpreted visually, which brings difficulties to the popularization of this technology in grassroots inspection institutions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR (Clustered regularly interspaced short palindromic repeats)/Cas12 one-step nucleic acid detection method and 2019-nCoV detection kit
  • CRISPR (Clustered regularly interspaced short palindromic repeats)/Cas12 one-step nucleic acid detection method and 2019-nCoV detection kit
  • CRISPR (Clustered regularly interspaced short palindromic repeats)/Cas12 one-step nucleic acid detection method and 2019-nCoV detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] A CRISPR / Cas12 one-step nucleic acid detection method, which is a novel general-purpose CRISPR / Cas12-based one-step nucleic acid detection method, using crRNA, Cas protein, primers, buffer systems and single-stranded DNA reporter molecules, RNase inhibition components such as agents;

[0061] The following takes the detection of human β-actin (ACTB) as an example to describe the operation steps of the method:

[0062] 1) Search for the 5'-TTTN-3' sequence in the human β-actin region, and design a forward primer within 0-200bp near the 5' region, and design a reverse primer within 25-200bp near the 3' region . Synthesize and chemically modify the first three and last three phosphodiester bonds of the primers. The primers that can be used in this embodiment are shown in Table 1 below.

[0063] Table 1

[0064] Oligo name Sequence(5'-3') ACTB-F1 TGTGGATCAGCAAGCAGGAGTATGACGAGTCC (SEQ ID NO: 1) ACTB-F2 TGGATCAGCAAGCAGGAGTATGACGAGTCCGG (SEQ ID NO...

Embodiment 2

[0098] A new coronavirus detection kit, including crRNA, Cas protein, primers, buffer system and single-stranded DNA reporter; the comparison of the optimal primer combination of the above new coronavirus detection kit is determined as follows:

[0099] 1) Search for the 5'-TTTN-3' sequence in the conserved ORF1ab and N gene regions of the new coronavirus, and design forward primers within 0-200 bp of the near 5' region, and 25-200 bp in the near 3' region Design reverse primers. Synthesize and chemically modify the first three and last three phosphodiester bonds of the primers. The primers that can be used in this embodiment are shown in Table 11 below.

[0100] Table 11

[0101] Oligo name Sequence(5′-3′) ORF1ab-F1 TTGCCTGGCACGATATTACGCACAACTAATGGT (SEQ ID NO: 11) ORF1ab-F2 ATGGTGACTTTTTGCATTTCTTACCTAGAGTTT (SEQ ID NO: 12) ORF1ab-R AAGTCAGTGTACTCTATAAGTTTTGATGGTGTGT (SEQ ID NO: 13) N-F1 CCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAAT (SEQ ID NO:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene detection, in particular to a CRISPR (Clustered regularly interspaced short palindromic repeats) / Cas12 one-step nucleic acid detection method and a2019-nCoV detection kit. The 2019-nCoV detection kit comprises crRNA, Cas protein, a primer, a buffer system and single stranded DNA reporter molecules; the primer is obtained as follows: 5'-TTTN-3'sequence is sought in a to-be-detected target molecule area, a forward primer is designed in the position near 5' area 0-200bp, a reverse primer is designed in the position near 3' area 25-200bp, theobtained primer is subjected to chemical modification to prevent decomposition of DNA enzyme or Cas12 protein after activation. The method has the benefits that compared with existing PCR-based nucleic acid detection technologies, the nucleic acid detection method and the 2019-nCoV detection kit can allow synchronous amplification and detection, thus, operation is more convenient.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a one-step nucleic acid detection method based on CRISPR / Cas12 and RPA isothermal amplification and a novel coronavirus detection kit. Background technique [0002] On January 12, 2020, the World Health Organization named the new coronavirus, namely "2019-nCoV". The virus can be transmitted by respiratory droplets or by close contact; the crowd is generally susceptible, and the elderly and those with underlying diseases are prone to develop severe infections. With the migration of the population during the Spring Festival, the disease has evolved into a nationwide large-scale vicious infectious disease, which has caused huge losses to the social economy. [0003] Common signs after coronavirus infection are respiratory symptoms, fever, cough, shortness of breath, and dyspnea. In more severe cases, infection can lead to pneumonia, severe acute respiratory syndrome, kidney...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/6848C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6848C12Q2521/327C12Q2521/507C12Q2525/117C12Q2547/101Y02A50/30
Inventor汤光辉薛良代文俊
Owner亚能生物技术(深圳)有限公司