58 results about "Clubroot" patented technology

The invention relates to the technical field of biological prevention and treatment, and discloses application of metarhizium anisopliae and beauveria bassiana in preparation of a microbial agent for preventing and treating clubroot of cruciferae, the microbial agent is a complex microbial agent, and the complex microbial agent comprises metarhizium anisopliae and beauveria bassiana. According to the invention, the clubroot of cruciferae is prevented and controlled by utilizing the bacteriostatic activity and composite synergistic effect of metarhizium anisopliae and beauveria bassiana. The fermentation liquor of the metarhizium anisopliae and the beauveria bassiana can directly act on the plasmodiophora brassicae spores, the inactivation rate of the plasmodiophora brassicae spores is remarkably increased, and disease infection is blocked from the source. The problems that disease-resistant varieties lose efficacy due to diversity of physiological races of germs, agricultural management measures have a limited effect on long-term survival spores, and chemical pesticides pollute the environment and induce drug resistance are solved; and the preparation in the technical scheme is environment-friendly, has no residue and is not easy to induce drug resistance of germs.

The invention discloses a Chinese cabbage clubroot-resistant gene BrRLP31 and application of the Chinese cabbage clubroot-resistant gene BrRLP31. The nucleotide sequence of the Chinese cabbage clubroot-resistant gene BrRLP31 is as shown in SEQ ID No. 1. Functional verification results show that after the expression of the endogenous BrRLP31 of the Chinese cabbage is inhibited by utilizing a VIGS technology, the resistance of the plant to clubroot is obviously reduced, and the disease index and the root swelling severity of the plant are obviously higher than those of a control material. On the other hand, the transgenic flowering cabbage plant over-expressed by the BrRLP31 is constructed by an agrobacterium-mediated method, and disease resistance identification proves that the heterologous over-expression of the BrRLP31 obviously improves the resistance of the plant to plasmodiophora brassicae. The results show that the BrRLP31 gene plays a key positive regulation role in the clubroot resistance process of the Chinese cabbage, the disease resistance of cruciferae crops and other horticultural plants is improved by utilizing the gene and the homologous sequence thereof, and the gene and the homologous sequence thereof have important application value.

The application discloses a kind of for preventing and treating cruciferous crops root rot complex microbial inoculant, comprising: the rose chain-forming Streptomyces agent numbered B98035, the Trichoderma citrinoviride agent numbered BMZ102895 and the Bacillus sonorensis agent numbered BMZ065932;The volume ratio of the rose chain-forming Streptomyces agent, Trichoderma citrinoviride agent and Bacillus sonorensis agent is 1:2-4:2, wherein the effective viable count in the rose chain-forming Streptomyces agent, Trichoderma citrinoviride agent is not less than 1×10 8 CFU / ml, and the effective viable count in Bacillus sonorensis agent is not less than 1×10 9 CFU / ml.The complex microbial inoculant of the application can effectively prevent and treat cruciferous crops root rot caused by Plamodiophora brassicae.

The application belongs to the technical field of genetic engineering, and particularly relates to application of AtPEN2 protein and / or its coding gene AtPEN2 in preventing cruciferous plant diseases. The application provides application of AtPEN2 protein and / or its coding gene AtPEN2 in preventing cruciferous plant diseases, and the amino acid sequence of the AtPEN2 protein is shown as SEQ ID NO. 1. The application takes Arabidopsis thaliana as a model plant to verify the prevention and treatment effect of overexpression of AtPEN2 protein on clubroot, and the results show that the AtPEN2 protein overexpression plant can improve the resistance to clubroot, indicating that the coding gene AtPEN2 of the AtPEN2 protein can be applied to molecular breeding of clubroot, and provides a new gene resource for molecular breeding of cruciferous crops.

This invention discloses a combined microbial agent and its application in combating clubroot disease, belonging to the field of microbial pesticide technology. By weight percentage, the combined microbial agent comprises 20%-30% Bacillus subtilis, 15%-25% Bacillus amyloliquefaciens, 10%-25% Lactobacillus fermentum, 10%-20% Isaac's yeast of Orientia, and 10%-20% Actinobacillus sieboldii. There is a synergistic effect among the strains, resulting in a significant effect on the control of clubroot disease, superior to conventional pesticides such as chlorothalonil. Using the combined microbial agent provided by this invention to control clubroot disease can reduce the amount of chemical pesticides used, exhibiting environmental friendliness and high efficiency. Furthermore, field trials have shown that treatment with the combined microbial agent of this invention reduces the incidence of clubroot disease in cruciferous crops while significantly increasing crop yield, resulting in economic benefits. The combined microbial agent of this invention is suitable for practical production and easy to promote and apply.

GAAGGTGACCAAGTTCATGCTGAAGGTCGGAGTCAACGGATTThe invention discloses a KASP molecular marker of a radish clubroot resistance gene RsCr7 and application of the KASP molecular marker, the KASP molecular marker comprises a KASP primer, the KASP primer comprises an upstream primer KASP-F1 and a downstream primer KASP-F2 and a downstream primer KASP-R, the upstream primer KASP-F1 is expressed as 5 '-GAAGGTGACCAAGTTCATGCTATCAACCATGTTTACCATGTTG ATTT-3', the downstream primer KASP-F2 is expressed as 5 '- The upstream primer KASP-F2 is expressed as GAAGGTCGGAGTCAACGGATTATCAACCATGTTTACCATGTTGA TTA-3 ', and the downstream primer KASP-F2 is expressed as And the downstream primer KASP-R is expressed as 5 '-AGGATTTCAAGAGCTTTCAGACCA-3', and the downstream primer KASP-R is expressed as 5 '-

The present application relates to the field of agricultural biotechnology and plant disease control technology, and specifically discloses a composition for preventing and controlling rape root rot, a preparation method and application thereof. The composition is prepared by fermentation of the following components in parts by weight: tea seed cake 10-30 parts, oyster shell powder 20-30 parts, waste molasses 10-20 parts, brewer's yeast powder 1-5 parts, xylo-oligosaccharide industrial residue 1-3 parts, and a composite fermentation agent containing lactobacillus plantarum, bacillus coagulans and propionic acid-producing propionibacterium 1-3 parts. The fermentation process adopts a two-stage pH control timing inoculation process: in the first stage, brewer's yeast is inoculated; in the second stage, the composite fermentation agent is inoculated under acidic conditions, and through synergistic metabolism, the sugar source is efficiently converted into a short-chain fatty acid composite system mainly composed of lactic acid and propionic acid. The prevention and control effect on rape root rot is significantly improved, and the composition also has the functions of improving soil and promoting crop growth, and has the advantages of high efficiency, environmental protection and multi-effect combination.

The present disclosure provides the use of β-1,3-glucan synthase like 5 (GSL5) for the improvement of the clubroot resistance in cruciferous crops as well as related products development, belonging to the area of molecular engineering for plant breeding. GSL5 gene is highly conserved in cruciferous plants and mutation of GSL5 can confer a broad-spectrum and high clubroot resistance to the cruciferous crops, demonstrating that molecular engineering of GSL5 can achieve the improvement of the clubroot resistance in cruciferous crops. The present disclosure provides a key gene and techniques for the improvement of the clubroot disease resistance and durable prevention and control of the clubroot disease in cruciferous crops.

The invention provides a breeding method of a triploid flowering Chinese cabbage variety, which comprises the following steps of: (1) hybridizing cabbage type rape serving as a female parent and flowering Chinese cabbage serving as a male parent to obtain a triploid hybrid F1 generation; (2) performing phenotype identification on the triploid hybrid F1 generation, and screening combinations which are early in bolting, synchronous in main stem and lateral branch development, obvious in subgenome heterosis and resistant to clubroot; (3) performing a multi-point planting test on the excellent triploid hybrid F1 to verify the yield and disease resistance of the flowering Chinese cabbage; and (4) breeding a special triploid flowering Chinese cabbage variety for seed production. The triploid flowering Chinese cabbage cultivated by the method has the following outstanding advantages of high yield, high economic value, strong disease resistance, multi-round picking and long market supply period. The method provided by the invention solves the problems of lack of special varieties of traditional brassica campestris and low yield of brassica campestris of a dual-purpose variety of brassica campestris, provides a new technical route for germplasm innovation of brassicaceous vegetables, and has important popularization and application values.

The invention relates to the technical field of microbiological detection, in particular to a primer pair, a kit and a method for detecting brassica rapa brassicae. On the basis of an EmDEA technology, a primer pair and a primer probe combination which have the best comprehensive detection effect on the brassica rapa brassicae are obtained through analysis and optimization of a strain Pb3PbPT3Sc00006 genome segment of the brassica rapa brassicae, and the detection method for the brassica rapa brassicae is established and has the advantages of high specificity, low detection limit and high detection sensitivity. And the method is simple and convenient to operate, relatively low in experimental condition requirement and relatively short in time consumption, is suitable for port daily import and export detection and outdoor on-site monitoring requirements, and has a relatively good application prospect.

The application provides a Chinese cabbage root knot disease related gene BrSWEET14a, a construction method and application, belongs to the technical field of plant genetic engineering, and particularly relates to the following technical scheme. The CDS sequence of the Chinese cabbage BrSWEET14a is shown as SEQ ID No. 1. The gene is transformed into Col-type Arabidopsis thaliana through an Agrobacterium flower dipping transformation method, and a BrSWEET14a heterologous expression Arabidopsis thaliana strain is obtained. It is found that the T-DNA insertion mutant of the BrSWEET14a homologous gene Atsweet14 is more resistant to root knot disease than the Col-type, and the heterologous expression of the Chinese cabbage BrSWEET14a leads to the decrease of the disease resistance of Arabidopsis thaliana to the root knot fungus. It can be seen that the Chinese cabbage BrSWEET14a is closely related to the root knot disease, and the gene and the homologous genes of the gene in other cruciferous plants can be applied to the breeding of cruciferous plants and other horticultural plants, and have a good application prospect.

The invention relates to the technical field of plant disease control, and particularly discloses a screening method of a cruciferous crop clubroot control agent, which comprises the following steps: after accelerating germination of cruciferous crop seeds, transplanting the cruciferous crop seeds into a 1 / 2 MS solution, and culturing the cruciferous crop seeds to a two-leaf one-core stage to obtain seedlings; soaking the roots of the seedlings in a mixed system containing plasmodiophora brassicae spores and a medicament to be detected, and inoculating; and transplanting the inoculated plants into a newly prepared 1 / 2 MS solution for continuous culture, and regularly investigating morbidity and prevention and control effects to screen out the medicament with prevention and control effects on the clubroot of the cruciferae crops. According to the method provided by the invention, continuous and non-destructive dynamic observation on the same plant can be allowed, the disease progress is accurately monitored, and the medicament screening cost is greatly reduced.

This invention relates to a KASP molecular marker associated with clubroot resistance in radishes and its application. A major QTL locus associated with clubroot resistance was discovered on chromosome 2 of radishes using QTL-seq technology and genetic mapping. Furthermore, molecular markers closely linked to this locus were developed. DNA was extracted from seeds or seedling leaves of radish materials with unknown resistance, and KASP molecular marker genotyping experiments were conducted using the KASP primers of this invention. The genotyping results can predict radish resistance to clubroot without the need for manual identification, significantly improving breeding efficiency and saving breeding costs.

The invention discloses an application of an autophagy related protein PbATG8 coding gene in prevention and control of clubroot. The application of the coding gene of the plasmodiophora negundo autophagy related protein PbATG8 in improving the clubroot resistance of plants and / or cultivating clubroot-resistant plants is characterized in that the CDS sequence of the coding gene of the plasmodiophora negundo autophagy related protein PbATG8 is as shown in SEQ ID NO.1. The invention also discloses a preparation method of the coding gene of the plasmodiophora negundo autophagy related protein PbATG8. An RNAi vector is constructed by using an HIGS technology, and the RNAi vector is transformed into the rape Zhongshuan No.11. The PbATG8-RNAi transgenic rape is subjected to plasmodiophora brassicae disease resistance experiment, and the result shows that the PbATG8-RNAi transgenic rape has remarkable resistance to plasmodiophora brassicae, so that the protein and the coding gene thereof can provide new gene resources for green prevention and resistance of rape clubroot.

The application belongs to the field of agricultural biotechnology, and particularly relates to application of a calmodulin-binding protein CBP60g or a coding gene CBP60g thereof in control of clubroot, wherein an amino acid sequence of the calmodulin-binding protein CBP60g is shown as SEQ ID NO. 1. The application can restore the resistance of Arabidopsis thaliana to Plasmodiophora brassicae at high temperature by overexpressing CBP60g, and the same is verified in Brassica napus, and the normal growth, yield and quality of the Brassica napus are not affected, which indicates that the CBP60g gene can resist Plasmodiophora brassicae at high temperature, and increase the recovery of the immune response of crops to high-temperature combined stress, and provides a strategy for molecular breeding in response to climate change.

The invention relates to the technical field of plasmodiophora brassicae inoculation, in particular to an artificial inoculation method for plasmodiophora brassicae immediate infection and application, and the method specifically comprises the following steps: S1, accelerating germination: accelerating germination of seeds to obtain seedlings; s2, grinding bacteria and preparing a bacteria solution; s3, inoculation: performing field planting on the seedlings obtained in the step S1, and then performing injection inoculation on the overground parts of the seedlings by using the bacterial liquid prepared in the step S2; s4, seedling stage management; s5, disease investigation. According to the method, the cognitive limitation of traditional two-step infection of root hair infection and cortex diffusion is broken through, a brand-new inoculation technical path is constructed, and a new idea and method for inoculating plasmodiophora brassicae of cruciferae are developed; the defects that a traditional underground inoculation method is fuzzy in infection time sequence, uncontrollable in inoculation metering, low in inoculation efficiency and poor in pathogenesis stability due to large bacterial quantity fluctuation are fundamentally overcome.

The application discloses application of NPR1 protein and related biological materials thereof in regulating resistance of plants to clubroot disease, and belongs to the technical field of genetic engineering. The technical problem to be solved by the application is how to regulate resistance of plants to Plasmodiophora brassicae. Specifically, the technical problem to be solved by the application is how to regulate resistance of cruciferous plants to Plasmodiophora brassicae. To solve the above technical problem, the application provides application of NPR1 protein or biological materials related to the NPR1 protein in regulating resistance of plants to clubroot disease. The application discloses, for the first time, application of NPR1 protein and a coding gene thereof in regulating resistance of cruciferous plants to clubroot disease and / or Plasmodiophora brassicae. Research on the function of NPR1 and application of the function in cruciferous plant breeding are of great significance to the mechanism of resistance of cruciferous plants to clubroot disease and / or Plasmodiophora brassicae and to resistance breeding.

The application belongs to the technical field of molecular marker assisted breeding, and relates to application of a SNP molecular marker A08-12266524 in identifying resistance to Chinese cabbage clubroot and / or breeding Chinese cabbage resistant to clubroot. The application provides application of a SNP molecular marker A08-12266524 in identifying resistance to Chinese cabbage clubroot and / or breeding Chinese cabbage resistant to clubroot, wherein the sequence of the SNP molecular marker A08-12266524 is shown as SEQ ID NO. 1, and the 70th base from the 5' end of the sequence shown as SEQ ID NO. 1 is a SNP site, and the base is A or G. The SNP molecular marker A08-12266524 can identify Chinese cabbage resistant to clubroot, and is used for screening and breeding Chinese cabbage resistant to clubroot.

The invention relates to a microbial organic fertilizer and application thereof, and belongs to the technical field of biology, the microbial organic fertilizer comprises the following components: a component A comprising the following components in parts by mass: 4-6 parts of soybean peptide powder, 18-22 parts of soybean enzymatic hydrolysate, 18-24 parts of corncob furfural residue powder, 14-16 parts of mineral source humic acid, 12-18 parts of mushroom residue powder, 6-15 parts of rice hull powder, 6-9 parts of oyster shell powder, and 5-7 parts of cattle bone powder; the component B comprises a Japanese bradyrhizobium inoculant, a micrococcus luteus inoculant and a bacillus subtilis inoculant in a mass ratio of 1: (1-2): (3-6); and the mass of the component B is 1-3% of that of the component A. The bio-organic fertilizer provided by the invention can effectively prevent and treat clubroot caused by plasmodiophora brassicae and improve the yield of Chinese cabbages; the biological organic fertilizer provided by the invention can be used for effectively preventing and treating tomato bacterial wilt caused by pseudomonas solanacearum and increasing the yield of tomatoes; the bio-organic fertilizer provided by the invention can be used for effectively preventing and treating tea tree root rot caused by hard aschersonia, and the yield and the quality of tea leaves are improved.

The present invention provides a novel nucleic acid molecule encoding a polypeptide that can confer resistance to pathogens, especially the "Beet Necrosis Yellow Vein Virus" (BNYVV), in plants, especially in plants of the genus Beta expressing the polypeptide, and also provides preferred nucleic acid molecules encoding the RZ-3 gene of Beta maritima, as well as derivatives and homologues thereof. Further aspects of the invention include vectors, transgenic plant cells, transgenic plants, transgenic plants and methods of making them, and methods of identifying nucleic acid molecules that confer resistance.

This application discloses the application of the EDS1 protein and its encoding gene in regulating plant disease resistance, belonging to the field of genetic engineering technology. The technical problem this application aims to solve is: how to regulate clubroot resistance in plants. To this end, this application provides the application of the EDS1 protein, or substances regulating the expression of the EDS1 protein encoding gene, or substances regulating the content of the EDS1 protein, in regulating plant clubroot resistance; the EDS1 protein can be a protein with the amino acid sequence being sequence 2. This application is the first confirmation of EDS1's participation in the *Cladophora brassicae* infection cycle, and the obtained susceptible materials can be utilized as a potential breeding resource. The discovery and enrichment of breeding resources will greatly accelerate the breeding process of clubroot-resistant cruciferous plants and strengthen disease control. Furthermore, clubroot resistance can be achieved by overexpressing EDS1 in cruciferous plants through transgenic or other means.

The present application belongs to the field of agricultural plant pathology and plant protection technology, and relates to a Plasmodiophora brassicae Pb035 gene and application thereof in prevention and control of Plasmodiophora brassicae. The core of the present application is to use host-induced gene silencing (HIGS) technology or exogenous RNA interference fragment delivery technology to silence Plasmodiophora brassicae Pb035 gene expression, thereby enhancing the resistance of Brassicaceae crops to Plasmodiophora brassicae. The present application provides a key technology and method for prevention and control of Plasmodiophora brassicae, and has broad agricultural application prospect and market value.

The present application relates to a seed coating agent for controlling rape root rot disease in the mode of straw returning and mulching planting, and belongs to the field of rape root rot disease control. The seed coating agent for controlling rape root rot disease in the mode of mulching planting comprises, by weight, 1-5 parts of cyazofamid, 1-3 parts of prochloraz, 6-10 parts of humic acid, 80-100 parts of an auxiliary agent, 0.2-1 parts of a soluble calcium salt, 0.1-0.5 parts of a water-soluble boron compound, and 1-3 parts of imidacloprid. The present application is suitable for controlling rape root rot disease in a shady and humid environment in the mode of straw returning and mulching planting, and can also inhibit weed growth, promote seedling growth, enable the seedlings to grow rapidly and break through the mulch, and increase yield.

The invention belongs to the field of biological agriculture, and relates to application of helicase PbDDX15-like in prevention and control of clubroot. According to the invention, a core gene of plasmodiophora brassicae ZJ-1 is compared with a brewer's yeast protein sequence, a gene DEAD-box RNA helicase (DEAD-box RNA helicase 15-like, PbDDX15-like) which may have a lethal effect on plasmodiophora brassicae is screened out, an RNAi vector of the gene is constructed by using an HIGS technology, and the RNAi vector is transformed into wild type arabidopsis thaliana. The PbDDX15-like-RNAi transgenic arabidopsis thaliana is subjected to a plasmodiophora brassicae disease resistance experiment, and the result shows that the PbDDX15-like-RNAi transgenic arabidopsis thaliana has remarkable resistance to plasmodiophora brassicae, so that the protein can provide a new gene resource for green prevention and resistance of the rape clubroot.

The invention discloses a hermetia illucens sand organic fertilizer based on kitchen garbage as well as a preparation method and application thereof, and relates to the technical field of biology. The hermetia illucens insect sand organic fertilizer is prepared from the following components in parts by weight: 90 to 110 parts of hermetia illucens insect sand, 11 to 15 parts of corn straw powder, 8 to 12 parts of sawdust and 2 to 2.5 parts of bioactive substances, the bioactive substances comprise arctiin and magnolol; the mass ratio of arctiin to magnolol is (1-9): 9. According to the organic fertilizer and the preparation method thereof, the double breakthrough of efficient recycling of the kitchen garbage and high-value utilization of the organic fertilizer is achieved, the organic fertilizer provided by the invention can remarkably promote plant growth and prevent and treat clubroot of plants, the problems of chemical pesticide residues and drug resistance of pathogenic bacteria can be avoided, and an effective solution is provided for recycling of the kitchen garbage and development of green agriculture.

The invention discloses an application of a targeted ABC transporter PbABCB25 in prevention and control of clubroot of rape. ABC transporter protein ABCB25 (abc transporter b family meber 25, ABCB25) with high-level expression in each stage is screened out from a plasmodiophora brassicae ZJ-1 transcriptome, then an RNAi carrier of the ABC transporter protein ABCB25 is constructed through an HIGS technology, the RNAi carrier is transformed into wild type arabidopsis thaliana, then the resistance of transgenic arabidopsis thaliana to clubroot is tested, the result shows that PbABCB25 has remarkable resistance to plasmodiophora brassicae, and the PbABCB25 can be used for preparing the plasmodiophora brassicae. The result shows that the ABCB25 in the plasmodiophora brassicae can be used as a gene resource for resisting the clubroot of the cruciferae.

The invention provides a method for improving clubroot resistance of cruciferous plants. It is found for the first time that probenazole treatment can improve the resistance of Chinese cabbages to clubroot and inhibit the vitality of plasmodiophora brassicae spores. The morbidity and the disease index of the Chinese cabbage clubroot can be reduced through pretreatment with probenazole of different concentrations and different dosage forms, the disease development is delayed, and adverse effects on the growth of Chinese cabbages cannot be caused. The probenazole suspending agent and the nanocapsule suspending agent prepared by the invention have outstanding prevention and control effects on clubroot of cruciferous plants.

The invention relates to the technical field related to plant genetic engineering, in particular to application of brassica juncea BjuWRKY75 in clubroot resistance of brassica napus L. The BjuWRKY75 gene (the CDS sequence of the BjuWRKY75 gene is as shown in SEQ ID NO.1) is successfully cloned from a clubroot-resistant brassica juncea L. material R13, a 2 * 35S overexpression vector is constructed, and the brassica juncea L. clubroot-resistant brassica juncea L. clubroot-resistant brassica juncea L. clubroot-resistant BjuWRKY75 gene is obtained. The gene is introduced into brassica napus by using an agrobacterium-mediated genetic transformation technology, and experiments prove that the over-expression of the gene can significantly improve the resistance of the brassica napus to the clubroot No.4 physiological race, which shows that the number of tumors at the root of a transgenic plant is significantly reduced; therefore, a brand new gene resource and an effective breeding way are provided for overcoming the technical bottlenecks that the existing brassica napus anti-clubroot resources are rare and the resistance source is single.

The invention discloses a microorganism for preventing and treating clubroot of cruciferae and a preparation method and application of a fungicide of the microorganism, and relates to the technical field of biological prevention and treatment of plant diseases, the microorganism is screened out through a microbial metabolome and verified, the microorganism is matched with a microorganism resource library to form nocardia-like actinomycetes (1A6), and the use concentration of the microorganism is OD600 = 1. According to the microorganism for preventing and treating the clubroot of the cruciferae and the preparation method of the microbial inoculum of the microorganism, the strain is screened out from contrastive analysis of root swelling tissues of green vegetables and soil metabolome, and the microorganism is applied to preventing and treating the clubroot of the cruciferae, so that the clubroot prevention and control effect is effectively achieved; and the method has the advantages of low pollution and low residue.

The invention belongs to the technical field of agricultural biology and seed engineering, and relates to a growth-promoting stress-resistant rape seed pelleting agent and application. The pelleting agent has the functions of growth promotion, disease resistance (clubroot), pest killing and stress resistance (stain resistance and cold resistance), and is formed by scientifically compounding an inert filler, a composite growth promotion component (including melatonin, naphthylacetic acid and abscisic acid), a bactericide (fluazinam or trichoderma), a broad-spectrum insecticide (70% thiamethoxam), a plant growth regulator (brassinolide or selenium medicament), an adhesive and an auxiliary agent. When an optimal formula of the composite preparation of fluazinam (the ratio of pesticide to seeds is 1: 100) and brassinolide is used, the cost is only about 0.67 yuan per mu, the yield can be increased by about 14 kilograms, the stable net income increase of 85-219 yuan per mu can be realized, and the input-output ratio is as high as 1: 126-1: 337. The invention provides an efficient, safe and comprehensive seed treatment scheme, and has important application value for guaranteeing stable and high yield of rape.