127 results about "Clubroot" patented technology

The invention provides a Chinese cabbage clubroot susceptibility related gene BrSWEET14a, a construction method and application, belongs to the technical field of plant genetic engineering, and particularly relates to a Chinese cabbage clubroot susceptibility related gene BrSWEET14a. The CDS sequence of the Chinese cabbage BrSWEET14a is as shown in SEQ ID No. 1 (sequence identifier number 1). The gene is transformed into Col-type arabidopsis thaliana through an agrobacterium flower immersion transformation method, a BrSWEET14a heterologous expression arabidopsis thaliana strain is obtained, and the result shows that T-DNA insertion mutant of the BrSWEET14a homologous gene Atsweet14 is more resistant to clubroot than that of the Col-type arabidopsis thaliana, and heterologous expression of Chinese cabbage BrSWEET14a leads to reduction of disease resistance of arabidopsis thaliana to plasmodiophora brassicae. Therefore, the Chinese cabbage BrSWEET14a is closely related to the clubroot disease, and the gene and the homologous gene of the gene in other cruciferous plants can be applied to breeding of the cruciferous plants and other horticultural plants and have a good application prospect.

The invention provides a plasmodiophora brassicae effector Pb78, and the nucleotide sequence of the plasmodiophora brassicae effector Pb78 is shown The invention also provides an application of host-induced silencing of the plasmodiophora brassicae effector Pb78 in prevention and treatment of plasmodiophora brassicae infection, and also provides a plasmodiophora brassicae prevention and treatment liquid and a preparation method of the plasmodiophora brassicae prevention and treatment liquid. The invention verifies that host-induced plasmodiophora brassicae effector Pb78 silencing can effectively inhibit plasmodiophora brassicae infection and symptom formation of cruciferae plants. The preparation and the treatment method disclosed by the invention are suitable for various cruciferae crops and vegetables which can be infected by plasmodiophora brassicae, and are wider in applicability; the inhibition efficiency on clubroot is higher than that of medicament treatment, and the compound has the advantage of no pesticide residue and is high in safety; due to the adoption of a seed treatment mode, the method is particularly suitable for preventing and treating clubroot susceptible seedlings.

The invention relates to the field of microorganisms, and discloses a complex microbial inoculant for preventing and treating clubroot of rape. Comprising the following raw materials in parts by weight: 10 to 12 parts of acid-resistant bacillus, 12 to 15 parts of pseudomonas fluorescens PF-5, 8 to 10 parts of bacillus mucilaginosus, 5 to 7 parts of halophilic bacillus, 8 to 10 parts of bacillus amyloliquefaciens, 12 to 15 parts of trichoderma atroviride ReTv2, 6 to 8 parts of azotobacter chroococcum, 10 to 12 parts of chitosan-gamma-polyglutamic acid microspheres, 12 to 15 parts of diatomite and 8 to 12 parts of humic acid. And 2-4 parts of algal polysaccharides. The living space of plasmodiophora brassicae is preempted by the acid-resistant bacillus; the pseudomonas fluorescens PF-5 directly strikes pathogenic bacteria and stimulates the defense system of the oilseed rape; the bacillus amyloliquefaciens releases a plurality of antibacterial substances; the trichoderma atroviride ReTv2 rapidly destroys the structure of the plasmodiophora brassicae in a manner of hyperparasitism and exoenzyme secretion.

The invention provides application of plasmodiophora brassicae infected early-stage chitin in prevention and control of cruciferae clubroot, and relates to a technology and application for preventing and controlling the cruciferae clubroot based on blocking synthesis of zoosporangium chitin in plasmodiophora brassicae infected early-stage chitin. Experiments prove that chitin components exist in zoosporangia in the early stage of plasmodiophora brassicae infection and are synthesized by plasmodiophora brassicae chitin synthetase genes PbCHS3 and PbCHS7, and a new target is provided for prevention and control of clubroot of cruciferae crops. The clubroot can be efficiently prevented and controlled by expressing PbCHS3 and PbCHS7 silencing vectors in arabidopsis thaliana and oilseed rape and treating or applying pesticide polyoxin capable of blocking chitin synthesis through exogenous small RNA, and a key technology and a key method are provided for preventing and controlling the clubroot of cruciferae.

The invention discloses application of oilseed rape chitinase EP3 and a coding gene thereof in improving clubroot resistance of cruciferous plants, and belongs to the technical field of molecular biology. The invention discloses the application of the rape chitinase EP3 in improving the clubroot resistance of plants for the first time. The amino acid sequence of the rape chitinase EP3 is as shown in SEQ ID NO.2; the nucleotide sequence of the coding gene EP3 is shown as SEQ ID NO. 1. Experimental results show that by preparing agrobacterium containing an EP3 gene overexpression vector and using a treating fluid containing the agrobacterium to perform seed soaking and root irrigation treatment, the EP3 gene is overexpressed in a rape plant, and the clubroot resistance of the rape can be remarkably improved. The invention provides a new gene resource and a safe, efficient, simple, convenient and universal prevention and treatment method for preventing and treating clubroot of cruciferous plants, and has remarkable agricultural application value and wide application prospect.

The present disclosure provides the use of β-1,3-glucan synthase like 5 (GSL5) for the improvement of the clubroot resistance in cruciferous crops as well as related products development, belonging to the area of molecular engineering for plant breeding. GSL5 gene is highly conserved in cruciferous plants and mutation of GSL5 can confer a broad-spectrum and high clubroot resistance to the cruciferous crops, demonstrating that molecular engineering of GSL5 can achieve the improvement of the clubroot resistance in cruciferous crops. The present disclosure provides a key gene and techniques for the improvement of the clubroot disease resistance and durable prevention and control of the clubroot disease in cruciferous crops.

The invention relates to the technical field of agricultural production, in particular to stable fertilizer for preventing and treating clubroot of rape and a preparation method. The stable fertilizer for preventing and treating clubroot of rape comprises the following components in parts by weight: 3-4 parts of a mixed microbial fermentation preparation, 2-4 parts of a biological enzyme condensate, 7-8 parts of borax, 110-180 parts of calcium phosphate, 500-550 parts of urea, 60-80 parts of corn flour, 1-3 parts of montmorillonite and 2-3 parts of polymaleic acid. According to the method, the mixed microbial fermentation preparation and the bio-enzyme solidified substance are combined, and the prevention and treatment effect on the clubroot of the rape is improved on the premise that the physicochemical properties of soil are not damaged.

The invention discloses application of a pathogenic bacterium RXLR effector gene RXLR motif or coding nucleic acid thereof in transporting disease-resistant protein genes. The amino acid sequence of the pathogenic bacterium RXLR effector gene RXLR motif is RFLRAHEEDDAGER, and the pathogenic bacterium RXLR effector gene RXLR motif belongs to the technical field of biology and the field of crop cultivation and disease control. The disease-resistant protein gene is a disease-resistant gene for resisting clubroot in Chinese cabbage, and particularly is a Chinese cabbage disease-resistant gene CRa1. According to the RXLR motif, the disease-resistant protein can be transferred into root system cells of root systems of brassicaceous plants such as tuber mustard and the like through the RXLR motif, a better control effect on the clubroot is achieved, in addition, the protein can be degraded in the root systems of the tuber mustard after 14 days, so that the clubroot is prevented and treated, hidden dangers do not exist in the aspect of safety, and the application prospect is wide. Meanwhile, on the basis of the RXLR motif, antibodies of other plant disease and insect pest resistant proteins or pathogenic bacteria pathogenic proteins can be subsequently developed to achieve a disease resistant effect.

The invention discloses an InDel molecular marker for detecting radish clubroot resistance as well as an acquisition method and application thereof, and belongs to the technical field of molecular breeding. The invention discloses an anti-clubroot QTL (quantitative trait locus) RsCr5g. 1 located in a radish chromosome 5, the maximum LOD (limit of death) value of the anti-clubroot QTL reaches 66.94, and the credibility is high; the disease-resistant QTL locus has high contribution rate to clubroot resistance, can explain 64.3% of phenotypic variation, and has high utilization value in radish clubroot-resistant breeding. The genetic distance between the molecular marker GZ012 disclosed by the invention and the clubroot-resistant QTL site RsCr5g. 1 is only 0.36 cM, the molecular marker GZ012 and the clubroot-resistant QTL site RsCr5g. 1 are closely linked, and the marker GZ012 is used for carrying out clubroot-resistant molecular marker-assisted selection, so that the accuracy of disease resistance prediction is high, the efficient and accurate development of disease-resistant molecular breeding is facilitated, and the molecular marker GZ012 has important significance in the prevention and control research of radish clubroot.

The invention belongs to the technical field of agricultural biology, and particularly relates to application of a calmodulin binding protein CBP60g or a coding gene CBP60g thereof in prevention and treatment of clubroot, and the amino acid sequence of the calmodulin binding protein CBP60g is shown as SEQ ID NO.1. The invention also relates to a preparation method of the calmodulin binding protein CBP60g. By overexpressing the CBP60g in the arabidopsis thaliana, the resistance of the CBP60g to the plasmodiophora brassicae can be recovered at high temperature, the CBP60g is also verified in the crop oilseed rape, and the normal growth, yield and quality of the oilseed rape are not influenced, so that the CBP60g gene can resist the plasmodiophora brassicae at high temperature; the restoring force of the crops to immune response of high-temperature composite stress is increased, and a strategy is provided for molecular breeding for coping with climate change.

The invention belongs to the technical field of agricultural plant pathology and plant protection, and relates to a plasmodiophora brassicae Pb035 gene and application thereof in prevention and control of clubroot of cruciferae crops. The core of the invention lies in that the plasmodiophora brassicae Pb035 gene expression is silenced by using a host induced gene silencing (HIGS) technology or an exogenous RNA interference fragment delivery technology, so that the resistance of cruciferae crops to clubroot is enhanced. The discovery provides a key technology and method for prevention and control of clubroot of cruciferae crops, and has wide agricultural application prospect and market value.

The present invention discloses a microbial inoculant for preventing both root-knot nematode disease and clubroot disease and a preparation method thereof, relating to the technical field of fertilizers, and solving the technical problems in the prior art that the field symptoms of root-knot nematode disease and clubroot disease are similar and difficult to quickly distinguish and accurately select agents, and that root-knot nematode disease and clubroot disease are likely to occur simultaneously and difficult to control in a timely manner. The preparation method of the microbial inoculant for preventing both root-knot nematode disease and clubroot disease of the present invention comprises the following steps: preparing methylotrophic bacillus powder and bacillus subtilis powder; preparing paecilomyces lilacinus powder; and compounding the prepared methylotrophic bacillus powder, paecilomyces lilacinus powder and bacillus subtilis powder in proportion and mixing them evenly to obtain the microbial inoculant for preventing both root-knot nematode disease and clubroot disease. The microbial inoculant for preventing both root-knot nematode disease and clubroot disease prepared by the present invention can conduct unified prevention and control of the two diseases, avoiding the golden period of early prevention and control being delayed due to incorrect agent selection in agricultural production.

The invention relates to the technical field of biological prevention and treatment, and discloses application of metarhizium anisopliae and beauveria bassiana in preparation of a microbial agent for preventing and treating clubroot of cruciferae, the microbial agent is a complex microbial agent, and the complex microbial agent comprises metarhizium anisopliae and beauveria bassiana. According to the invention, the clubroot of cruciferae is prevented and controlled by utilizing the bacteriostatic activity and composite synergistic effect of metarhizium anisopliae and beauveria bassiana. The fermentation liquor of the metarhizium anisopliae and the beauveria bassiana can directly act on the plasmodiophora brassicae spores, the inactivation rate of the plasmodiophora brassicae spores is remarkably increased, and disease infection is blocked from the source. The problems that disease-resistant varieties lose efficacy due to diversity of physiological races of germs, agricultural management measures have a limited effect on long-term survival spores, and chemical pesticides pollute the environment and induce drug resistance are solved; and the preparation in the technical scheme is environment-friendly, has no residue and is not easy to induce drug resistance of germs.

The present disclosure provides the use of β-1,3-glucan synthase like 5 (GSL5) for the improvement of the clubroot resistance in cruciferous crops as well as related products development, belonging to the area of molecular engineering for plant breeding. GSL5 gene is highly conserved in cruciferous plants and mutation of GSL5 can confer a broad-spectrum and high clubroot resistance to the cruciferous crops, demonstrating that molecular engineering of GSL5 can achieve the improvement of the clubroot resistance in cruciferous crops. The present disclosure provides a key gene and techniques for the improvement of the clubroot disease resistance and durable prevention and control of the clubroot disease in cruciferous crops.

The invention discloses a Chinese cabbage clubroot-resistant gene BrRLP31 and application of the Chinese cabbage clubroot-resistant gene BrRLP31. The nucleotide sequence of the Chinese cabbage clubroot-resistant gene BrRLP31 is as shown in SEQ ID No. 1. Functional verification results show that after the expression of the endogenous BrRLP31 of the Chinese cabbage is inhibited by utilizing a VIGS technology, the resistance of the plant to clubroot is obviously reduced, and the disease index and the root swelling severity of the plant are obviously higher than those of a control material. On the other hand, the transgenic flowering cabbage plant over-expressed by the BrRLP31 is constructed by an agrobacterium-mediated method, and disease resistance identification proves that the heterologous over-expression of the BrRLP31 obviously improves the resistance of the plant to plasmodiophora brassicae. The results show that the BrRLP31 gene plays a key positive regulation role in the clubroot resistance process of the Chinese cabbage, the disease resistance of cruciferae crops and other horticultural plants is improved by utilizing the gene and the homologous sequence thereof, and the gene and the homologous sequence thereof have important application value.

The application discloses a kind of for preventing and treating cruciferous crops root rot complex microbial inoculant, comprising: the rose chain-forming Streptomyces agent numbered B98035, the Trichoderma citrinoviride agent numbered BMZ102895 and the Bacillus sonorensis agent numbered BMZ065932;The volume ratio of the rose chain-forming Streptomyces agent, Trichoderma citrinoviride agent and Bacillus sonorensis agent is 1:2-4:2, wherein the effective viable count in the rose chain-forming Streptomyces agent, Trichoderma citrinoviride agent is not less than 1×10 8 CFU / ml, and the effective viable count in Bacillus sonorensis agent is not less than 1×10 9 CFU / ml.The complex microbial inoculant of the application can effectively prevent and treat cruciferous crops root rot caused by Plamodiophora brassicae.

This invention belongs to the field of agricultural biotechnology, specifically relating to a strain of Pseudomonas sp. R10 and its applications. The Pseudomonas sp. R10 provided by this invention is deposited at the China Center for Type Culture Collection (CCTCC), accession number CCTCC M 2024850. This strain exhibits significant control effects against clubroot disease, particularly in rapeseed. Verification through examples shows that Pseudomonas sp. R10 inhibits the germination rate of dormant spores of Pseudomonas by 35.14%. In pot experiments, it reduced the clubroot disease severity index by 53.06%. In field trials, treatment of rapeseed with R10 solution reduced the clubroot disease severity index by 39.45%, and significantly increased plant height, rootstock diameter, fresh weight, number of effective branches, and number of effective siliques in the main inflorescence compared to the control plot. R10 solution treatment also increased rapeseed yield by 59.86% and thousand-grain weight by 7.25%.

The invention provides an endophytic pseudomonas kirscheri and an application of the endophytic pseudomonas kirscheri. The pseudomonas is endophytic pseudomonas kilonensis Pk-5, and the preservation number of the pseudomonas kilonensis Pk-5 is CGMCC (China General Microbiological Culture Collection Center) No. 32570. The strain can improve the biomass of plants under normal and sick conditions by inhibiting the pathogenic effect of plasmodiophora brassicae; after plants are inoculated with plasmodiophora brassicae, the pseudomonas Pk-5 can obviously promote the growth of the plants.

The application belongs to the technical field of genetic engineering, and particularly relates to application of AtPEN2 protein and / or its coding gene AtPEN2 in preventing cruciferous plant diseases. The application provides application of AtPEN2 protein and / or its coding gene AtPEN2 in preventing cruciferous plant diseases, and the amino acid sequence of the AtPEN2 protein is shown as SEQ ID NO. 1. The application takes Arabidopsis thaliana as a model plant to verify the prevention and treatment effect of overexpression of AtPEN2 protein on clubroot, and the results show that the AtPEN2 protein overexpression plant can improve the resistance to clubroot, indicating that the coding gene AtPEN2 of the AtPEN2 protein can be applied to molecular breeding of clubroot, and provides a new gene resource for molecular breeding of cruciferous crops.

This invention discloses a combined microbial agent and its application in combating clubroot disease, belonging to the field of microbial pesticide technology. By weight percentage, the combined microbial agent comprises 20%-30% Bacillus subtilis, 15%-25% Bacillus amyloliquefaciens, 10%-25% Lactobacillus fermentum, 10%-20% Isaac's yeast of Orientia, and 10%-20% Actinobacillus sieboldii. There is a synergistic effect among the strains, resulting in a significant effect on the control of clubroot disease, superior to conventional pesticides such as chlorothalonil. Using the combined microbial agent provided by this invention to control clubroot disease can reduce the amount of chemical pesticides used, exhibiting environmental friendliness and high efficiency. Furthermore, field trials have shown that treatment with the combined microbial agent of this invention reduces the incidence of clubroot disease in cruciferous crops while significantly increasing crop yield, resulting in economic benefits. The combined microbial agent of this invention is suitable for practical production and easy to promote and apply.

The invention discloses an anti-clubroot gene BolC6. MYB122 and application thereof, and relates to the technical field of plant biology. The NDA sequence of the BolC6. MYB122 provided by the invention is as shown in SEQ ID NO. 1, and the CDS sequence of the BolC6. MYB122 provided by the invention is as shown in SEQ ID NO. 2. A constructed 35S: BolC6. MYB122-eGFP overexpression vector is transformed into wild type arabidopsis thaliana, an arabidopsis thaliana myb122 mutant is obtained, namely an overexpression transgenic line is obtained, the resistance of overexpression positive regulation of the BolC6. MYB122 gene to plasmodiophora brassicae is clarified through disease resistance identification, and the transgenic line is a transgenic line. And a theoretical basis and gene resources are provided for clubroot-resistant molecular breeding of plants such as brassica napus.

The invention discloses a colza sclerotinia and clubroot resistance evaluation method which comprises the following steps: inoculating two pathogenic bacteria of sclerotinia and clubroot at the same time by adopting a bacterial suspension soil injection mode at the seedling stage of colza, observing the symptoms of roots, stem bases or petioles after inoculating for a period of time, carrying out disease grade division on clubroot and sclerotinia, and determining the resistance of clubroot and sclerotinia. Calculating disease indexes, and evaluating sclerotiniose and clubroot resistance grades according to the disease indexes. Based on the characteristic that sclerotiniose and clubroot are both soil-borne diseases, the sclerotiniose and clubroot resistance evaluation method for colza is established in combination with disease occurrence and epidemic, disease occurrence conditions can be established under indoor conditions, sclerotinia sclerotiorum and plasmodiophora brassicae infect hosts at the same time, evaluation time can be shortened, and the evaluation accuracy is improved. Meanwhile, the defect that the host resistance level cannot be really reflected when different disease resistance evaluations are carried out in different growth periods of the rape is avoided.

The present invention relates to clubroot resistance in Brassica. More specifically, the invention relates to the CRT clubroot resistance gene, as well as to methods to create clubroot resistant Brassica plants.

GAAGGTGACCAAGTTCATGCTGAAGGTCGGAGTCAACGGATTThe invention discloses a KASP molecular marker of a radish clubroot resistance gene RsCr7 and application of the KASP molecular marker, the KASP molecular marker comprises a KASP primer, the KASP primer comprises an upstream primer KASP-F1 and a downstream primer KASP-F2 and a downstream primer KASP-R, the upstream primer KASP-F1 is expressed as 5 '-GAAGGTGACCAAGTTCATGCTATCAACCATGTTTACCATGTTG ATTT-3', the downstream primer KASP-F2 is expressed as 5 '- The upstream primer KASP-F2 is expressed as GAAGGTCGGAGTCAACGGATTATCAACCATGTTTACCATGTTGA TTA-3 ', and the downstream primer KASP-F2 is expressed as And the downstream primer KASP-R is expressed as 5 '-AGGATTTCAAGAGCTTTCAGACCA-3', and the downstream primer KASP-R is expressed as 5 '-

The present application relates to the field of agricultural biotechnology and plant disease control technology, and specifically discloses a composition for preventing and controlling rape root rot, a preparation method and application thereof. The composition is prepared by fermentation of the following components in parts by weight: tea seed cake 10-30 parts, oyster shell powder 20-30 parts, waste molasses 10-20 parts, brewer's yeast powder 1-5 parts, xylo-oligosaccharide industrial residue 1-3 parts, and a composite fermentation agent containing lactobacillus plantarum, bacillus coagulans and propionic acid-producing propionibacterium 1-3 parts. The fermentation process adopts a two-stage pH control timing inoculation process: in the first stage, brewer's yeast is inoculated; in the second stage, the composite fermentation agent is inoculated under acidic conditions, and through synergistic metabolism, the sugar source is efficiently converted into a short-chain fatty acid composite system mainly composed of lactic acid and propionic acid. The prevention and control effect on rape root rot is significantly improved, and the composition also has the functions of improving soil and promoting crop growth, and has the advantages of high efficiency, environmental protection and multi-effect combination.

The invention discloses a method, system, electronic device and computer storage medium for detecting rapeseed clubroot disease, and relates to the technical field of clubroot disease detection. The method comprises: obtaining a target magnetic resonance sequence image; the rapeseed root system to be detected is the rapeseed root system in the soil; segmenting, aligning and multiplying the target magnetic resonance sequence image in sequence, and three-dimensionally reconstructing the target root system three-dimensional model; based on the three-dimensional interactive measurement technology, obtaining the root system parameters of the rapeseed root system to be detected from the target root system three-dimensional model; the root system parameters include: total root system length, main root length, maximum root system depth, maximum root system width, maximum root system diameter, root system volume and number of root branches; the root system parameters are input into the rapeseed clubroot disease detection model to obtain the detection result of the rapeseed root system to be detected. The invention directly detects the rapeseed root system still in the soil through the rapeseed clubroot disease detection model, and realizes the in-situ non-destructive detection of rapeseed clubroot disease.

The present disclosure provides the use of β-1,3-glucan synthase like 5 (GSL5) for the improvement of the clubroot resistance in cruciferous crops as well as related products development, belonging to the area of molecular engineering for plant breeding. GSL5 gene is highly conserved in cruciferous plants and mutation of GSL5 can confer a broad-spectrum and high clubroot resistance to the cruciferous crops, demonstrating that molecular engineering of GSL5 can achieve the improvement of the clubroot resistance in cruciferous crops. The present disclosure provides a key gene and techniques for the improvement of the clubroot disease resistance and durable prevention and control of the clubroot disease in cruciferous crops.

The present invention discloses a strain of Streptomyces BRS-24 capable of preventing and treating clubroot of Chinese cabbage and cabbage, as well as a fermentation liquid and a bacterial suspension. The Streptomyces BRS-24 capable of preventing and treating clubroot of cruciferous crops and promoting growth of the present invention has a preservation number of CCTCC NO.M 20221182. The fermentation liquid or bacterial suspension made by the strain has an inhibitory effect on clubroot. In addition, the Streptomyces can be well colonized in the root system of plants and promote the growth of plants. Compared with traditional chemical pesticides, the use of the Streptomyces biocontrol agent is environmentally friendly, and the prevention and control is green and efficient, and has good prospects in the future application of biological control and green fertilizers.

The invention discloses an application of PbGAB2 in prevention and control of rape clubroot, a G protein coupled receptor PbGAB2 with high expression level in each stage is screened out from a plasmodiophora brassicae ZJ-1 transcriptome, an RNAi vector of the gene is constructed, a corresponding transgenic plant is obtained, and the application of PbGAB2 in prevention and control of rape clubroot is realized. A disease resistance test of plasmodiophora brassicae shows that the PbGAB2-RNAi transgenic line disclosed by the invention shows excellent disease resistance phenotype, and the G protein coupled receptor PbGAB2 of the plasmodiophora brassicae can be used as a gene resource for resisting clubroot.

The invention provides a breeding method of a triploid flowering Chinese cabbage variety, which comprises the following steps of: (1) hybridizing cabbage type rape serving as a female parent and flowering Chinese cabbage serving as a male parent to obtain a triploid hybrid F1 generation; (2) performing phenotype identification on the triploid hybrid F1 generation, and screening combinations which are early in bolting, synchronous in main stem and lateral branch development, obvious in subgenome heterosis and resistant to clubroot; (3) performing a multi-point planting test on the excellent triploid hybrid F1 to verify the yield and disease resistance of the flowering Chinese cabbage; and (4) breeding a special triploid flowering Chinese cabbage variety for seed production. The triploid flowering Chinese cabbage cultivated by the method has the following outstanding advantages of high yield, high economic value, strong disease resistance, multi-round picking and long market supply period. The method provided by the invention solves the problems of lack of special varieties of traditional brassica campestris and low yield of brassica campestris of a dual-purpose variety of brassica campestris, provides a new technical route for germplasm innovation of brassicaceous vegetables, and has important popularization and application values.