Inherited metabolic disease screening method and reagent kit

Abstract

The invention provides an inherited metabolic disease screening method and a reagent kit. The method includes the steps that following libraries are built, according to each encoding sequence of inherited metabolic disease associated disease-causing genes and the principle of sequence reverse complement, from 5' to 3', a probe sequence with the length being 120 bp starts to be designed from the first basic group, and besides, 60 bp superposition exists between every two adjacent probe sequences; a TAGGTGTGTAGGCGC sequence and a GTCAGCTAGTACGCA sequence are added to the 5' end and the 3' end of each probe sequence respectively; by the adoption of the oligonucleotide in-situ synthesis technology, large-scale synthesis of oligonucleotides is carried out on a chip; the oligonucleotides on the chip are eluted through ammonia water and dissolved in water to form an oligonucleotide mixture; through the PCR method, forward primers (TTAGATAGGTGTGTAGGCGC) and reverse primers (TAAGGTGCGTACTAGCTGAC) provided with biotin labels at the 5' ends are adopted, the oligonucleotide mixture is amplified, and an inherited metabolic disease associated disease-causing gene DNA probe library with the biotin labels is formed.

Description

technical field [0001] The invention belongs to genetic detection, in particular to the detection of gene mutation. Background technique [0002] Inherited metabolic diseases are genetic defects in the biosynthesis of certain enzymes, receptors, carriers and membrane pumps composed of polypeptides and (or) proteins that are necessary to maintain the normal metabolism of the body, that is, mutations in the genes encoding such polypeptides (proteins) resulting in diseases. Most of them are single-gene genetic diseases. Some of the causes of genetic metabolic diseases are caused by genetic inheritance, and some are caused by acquired gene mutations. The onset period is not only newborns, but also covers all ages. [0003] Inherited metabolic diseases are extremely harmful to the human body. Common symptoms include nervous system abnormalities, metabolic acidosis and ketosis, severe vomiting, hepatomegaly or hepatic insufficiency, special odor, strange appearance, skin and hair...

AI Technical Summary

Problems solved by technology

The high cost of sequencing caused by the huge data volume requirements has limited the application of whole genome sequencing in the genetic diagnosis of inherited metabolic diseases

[0006] Whole genome sequencing needs to generate a large amount of sequencing data, and the cost of sequencing is high, so the sequencing depth cannot be too deep

Images