Sequence of standard gene of DNA (deoxyribonucleic acid) barcode of aedes and application thereof
A standard gene and barcode technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problem that there is no related gene sequence of Aedes Iriomote, and achieve the effect of shortening identification time, reducing errors, and rapid identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] [Example 1 Determination of Aedes Iriomote DNA Barcode Standard Detection Gene]
[0020] 1. Collection and preservation of Aedes Iriomote specimens
[0021] Aedes Iriomote was collected, and the collected specimens were killed by freezing and stored in 75% alcohol directly.
[0022] 2. Pretreatment of test samples
[0023] Take out the Aedes Iriomote specimens preserved in 75% alcohol, and cut off the head, genitals and wings with a dissecting needle, which is convenient for making slices for species identification. The remaining part was transferred into PCR tubes, stored in 75% alcohol, one for each tube, and uniquely numbered for DNA extraction. If long-term storage is required, the PCR tube containing the remaining tissue parts of Aedes Iriomote should be stored in a -20°C refrigerator.
[0024] 3. DNA template preparation
[0025] Mosquito DNA was extracted using a commercially available genomic DNA extraction kit.
[0026] 4. Primer synthesis
[0027] The pr...
Embodiment 2
[0040] [Example 2 Identification of Unknown Mosquitoes Using Barcode Standards to Detect Gene Sequences]
[0041] 1. Collection and preservation of unknown mosquito specimens
[0042] Unknown mosquitoes were collected, and the collected specimens were directly preserved in 75% alcohol after being killed by freezing.
[0043] 2. Pretreatment of test samples
[0044] Take out the unknown mosquito specimen preserved in 75% alcohol, and cut off the head, genital part and wings with a dissecting needle, which is convenient for making slices for species identification. The remaining part was transferred into PCR tubes, stored in 75% alcohol, one for each tube, and uniquely numbered for DNA extraction.
[0045] 3. DNA template preparation
[0046] Mosquito DNA was extracted using a commercially available genomic DNA extraction kit.
[0047] 4. Primer synthesis
[0048] The primers used in this example are as follows:
[0049] Forward primer: TAAACTTCAGGGTGACCAAAAAAATCA
[0050...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
