Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

34 results about "Aedes" patented technology

Aedes is a genus of mosquitoes originally found in tropical and subtropical zones, but now found on all continents except Antarctica. Some species have been spread by human activity others Aedes albopictus, a most invasive species, was recently spread to the New World, including the United States, by the used-tire trade. First described and named by German entomologist Johann Wilhelm Meigen in 1818, the generic name comes from the Ancient Greek ἀηδής, aēdēs, meaning "unpleasant" or "odious". The type species for Aedes is Aedes cinereus. Some species of this genus transmit serious diseases, including dengue fever, yellow fever, the Zika virus, and chikungunya. In Polynesia, the species Aedes polynesiensis is responsible for the transmission of human lymphatic filariasis.

Anti-mosquito finishing process of textile fabric

The invention discloses an anti-mosquito finishing process of a textile fabric. The textile fabric is cotton, tencel, modal, blended cotton (viscose cotton, polyester cotton, polyamide cotton), silk, a wool cotton dyed fabric, a thin chemical fiber fabric, a pair of socks, a mosquito net and the like. The process comprises the steps of: selecting a mosquito repellent and a low-temperature fixative, carrying out nano microencapsulation on the mosquito repellent by utilizing a microencapsulation technology, carrying out anti-mosquito finishing on a textile fabric to form an anti-mosquito emulsion through the low-temperature fixative, dehydrating and curing to finally obtain the anti-mosquito finished fabric. The anti-mosquito fabric fabricated by the anti-mosquito finishing process has a fast mosquito killing function, a repelling rate of the anti-mosquito finishing process on aedes albopicus, culex pipiens pallens and the like is higher than 90 percent and an anti-biting rate of the anti-mosquito finishing process is 100 percent; the anti-mosquito fabric does not have bad influence on physical indices such as appearance, strength, moisture absorbing property and the like of the fabric; the anti-mosquito fabric has a good anti-mosquito effect after being washed 15 times; and the anti-mosquito finished fabric does not stimulate or cause allergy to skin, is safe and non-toxic to a human body, and is comfortable to wear.
Owner:FUJIAN ZHONGHE

Preparation method of aedes albopictus stably carrying culex quinquefasciatus wolbachia and application of aedes albopictus stably carrying culex quinquefasciatus wolbachia to prevention and control of aedes albopictus

The invention discloses a preparation method of aedes albopictus stably carrying culex quinquefasciatus wolbachia and the application of the aedes albopictus stably carrying the culex quinquefasciatus wolbachia to prevention and control of the aedes albopictus. The preparation method comprises the following steps that Guangzhou wild aedes albopictus treated with tetracycline are screened, so that aedes albopictus without wolbachia is obtained, and the aedes albopictus stably carrying the culex quinquefasciatus wolbachia is prepared. The application of the aedes albopictus stably carrying the culex quinquefasciatus wolbachia to prevention and control of the aedes albopictus has the advantages that the cost is low, and sustainability and environment friendliness are achieved. The aedes albopictus stably carrying the culex quinquefasciatus wolbachia is one of the most potential biological measures for prevention and control of mosquito-borne diseases, the problem that insects can easily establish drug resistance under the condition of using chemical insecticides is solved, and the problem that harm to the environment and the public health is caused is also solved.
Owner:GUANGZHOU WOLBAKI BIOTECH CO LTD

Mosquito repellent containing plant essential oil

ActiveCN107996622AExtend effective protection timeBiocidePest repellentsChemical synthesisAdditive ingredient
The invention discloses a plant source mosquito repellent which is characterized by the following main components: catmint oil and eucalyptus globulus oil. The mosquito repellent takes plant essentialoil as the main ingredient, the synergetic effect of the two kinds of essential oil is achieved, and the available protective time is prolonged. In addition, the mosquito repellent does not contain diethyltoluamide (DEET), dimethyl phthalate and other synthetic repellents, and is green, safe and environment-friendly. The plant source mosquito repellent disclosed by the invention can be made intoan oil base type, an alcohol-based type, emulsion and micro-emulsion, has an excellent effect of repelling aedes albopictus, and has extremely high application value in daily life and outdoor activities.
Owner:LOOBI GUANGZHOU HEALTH IND CO LTD

Standard breeding method of aedes albopictus larvae

ActiveCN107018956ASolve technical problems such as developmental dyssynchronyGuaranteed normal growthAnimal husbandryAedes albopictusFishery
The invention discloses a standard breeding method of aedes albopictus larvae. The method comprises the steps as follows: 3,000-8,000 hatched aedes albopictus larvae are put in each breeding plate for breeding at the temperature of 24-28 DEG C and at the relative humidity of 60%-90%, during breeding, suspension feed is added quantitatively every day according to the breeding density, and the amount of the suspension feed is progressively decreased from the middle time period of the fourth and / or fifth day to time periods at two ends in the feeding time period of one week. The method creates conditions for male and female separation of aedes albopictus pupae, powerfully guarantees mass production in laboratories and factories and solves the problem of non-synchronous development in the aedes albopictus larva breeding process.
Owner:GUANGZHOU WOLBAKI BIOTECH CO LTD

Method for detecting Zika virus, Chikungunya virus and Mayaro virus by triple real-time fluorescent quantitative RT-PCR

The invention relates to the technical field of virus detection, and concretely relates to a method for detecting Zika virus, Chikungunya virus and Mayaro virus by triple real-time fluorescent quantitative RT-PCR. The method combines the probability of occurrence of related mosquito-borne pathogens, the risk of prevalence, and the operability of a laboratory testing procedure, the Mayaro virus isused to replace the dengue virus in an existing common combination detection scheme, and a new detection scheme using Zika virus, Chikungunya virus and Mayaro virus as detection targets is formed. Theinvention provides a specific primer, a probe and a triple real-time quantitative RT-PCR detection method for simultaneously identifying the viral pathogens Zika virus, Chikungunya virus and Mayaro virus which are transmitted by Aedes mosquito and cause similar clinical symptoms of diseases. The method has high specificity and sensitivity, good repeatability, simple and rapid detection, and costsaving, and can complement a traditional detection scheme and has high application value.
Owner:STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT

Bacillus thuringiensis for killing mosquito larvae and application of bacillus thuringiensis

InactiveCN107254426AReduce the risk of resistance developmentBiocideBacteriaBacillus thuringiensisAureobasidium sp.
The invention belongs to the technical field of biological prevention and control of sanitary insect pests, and mainly discloses a material and a method for preventing and controlling larvae of mosquitoes which are the leader of 'four pests'. The invention discloses a novel strain Bt S2160-1 of Bacillus thuringiensis, Bt for killing mosquito larvae, wherein the preservation number of the novel strain is CGMCC No.13274. The strain Bt S2160-1 has very high insecticidal activity upon larvae of culex fatigans and aedes albopictus, and compared with a Bt mosquito strain Bti recommended by WHO (World Health Organization), the Bt S2160-1 has relatively high activity upon larvae of aedes albopictus. The Bacillus thuringiensis Bt S2160-1 disclosed by the invention can be made into an insecticide for large-scale prevention and control on larva populations of culex fatigans and aedes albopictus. Therefore, the strain can be powerful supplement as a mosquito control microbial agent in addition to Bti, or even can be used as a substitution of Bti for controlling populations of aedes albopictus, and the risk that mosquitoes have resistance to a Bti crystal protein which is used for a long time to control mosquito populations can be reduced.
Owner:浙江翠溪农业开发有限公司

Hatching solution used for hatching mosquito eggs of Aedes albopictus and hatching method of mosquito eggs of Aedes albopictus

ActiveCN107372370AAccelerate the hatching rateWell synchronized growthAnimal husbandryYeastAedes albopictus
The invention relates to a hatching solution used for hatching mosquito eggs of Aedes albopictus and a hatching method of the mosquito eggs of the Aedes albopictus. The hatching solution is an aqueous solution prepared from yeast peptone and water, wherein the concentration of the yeast peptone in the aqueous solution is 0.7-1.5 g / L. The hatching method comprises the following steps that fermentation is conducted on the hatching solution used for hatching the mosquito eggs of the Aedes albopictus; the mosquito eggs of the Aedes albopictus are weighed and put into a hatching pipe, the fermented hatching solution is added into the hatching pipe, a pipe cover of the hatching pipe is sealed, the hatching pipe is evenly shook, standing is conducted on the hatching pipe for hatching, the pipe cover of the hatching pipe is opened, and hatched larvae is transferred into a breeding plate. By means of the hatching solution, the mosquito eggs of the Aedes albopictus are hatched under certain conditions, the hatching speed of the mosquito eggs of the Aedes albopictus is greatly increased, the hatching rate of the active mosquito eggs in one hour is high, and the synchronism of growth of the larvae is good; the hatching method has the advantages that the survival rate of the larvae is high, operation is simple, and the hatching cost is low.
Owner:GUANGZHOU WOLBAKI BIOTECH CO LTD

Double-stranded RNA capable of preventing and controlling mosquitoes, expression vector and applications of double-stranded RNA and expression vector

The invention provides a double-stranded RNA capable of preventing and controlling mosquitoes, an expression vector and applications of the double-stranded RNA and the expression vector. The double-stranded RNA consists of a sense strand and an antisense strand: the nucleotide sequence of the sense strand is as shown in SEQ ID NO.2 in a sequence table; and the nucleotide sequence of the antisensestrand is as shown in SEQ ID NO.3 in the sequence table. The invention also provides the expression vector containing the double-stranded RNA and an application thereof. The double-stranded RNA and the expression vector containing the double-stranded RNA provided by the invention can effectively silence the HR3 gene, can be used for biological control of the aedes, and has environment-friendly characteristics and higher commercial application value. For example, in a specific embodiment, the expression vector containing the RNA transforms chlamydomonas and chlorella to obtain an engineering algae strain, the aedes larvae are fed with the engineering algae strain, and the aedes larvae can be effectively killed.
Owner:INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI

Fluorescence detection primer of culex wolbachia, detection method thereof and detection kit

The invention discloses a fluorescence detection primer of culex wolbachia, a detection method thereof and a detection kit. The fluorescence detection primer is characterized by comprising wPipF: 5minute-GTTTGTGCAGCTAATAG-3minute; wPipR: 5minute-GTCTGCAAGGCCT ATTTCTACTG-3minute and a probe: 5minute-CTTTCAATTGAAAAGATTCGATCAAC-3minute, wherein the two ends of the probe are respectively combined with a fluorescence generation group and a fluorescence quenching group. The culex wolbachia can be detected out in a fast-efficient-single manner by utilizing the fluorescence detection primer and the probe according to the detection method, and the fluorescence detection primer has the characteristics that the singleness is strong, the specificity is high (the culex wolbachia can be detected out, but no amplification of the aedes wolbachia occurs), the sensitivity is high and the lowest detection limit is 100copies per ml. Therefore, the fluorescence detection primer disclosed by the invention has the advantages of fastness, high efficiency, simple operation, high specificity, high sensitivity and simple identification and the like.
Owner:奚志勇

Fluorescence detection primer of A type and B type wolbachia as well as detection method and detection kit thereof

The invention discloses a fluorescence detection primer of A type and B type wolbachia, as well as a detection method and a detection kit thereof. By adopting the fluorescence detection primer provided by the invention, the A-type and the B-type wolbachia can be rapidly, effectively and specifically detected according to the detection method, the fluorescence detection primer is strong in selectivity, high in specificity (the aedes wolbachia is detected, the A type, B type or A and B mixed type wolbachia can be distinguished, and the aedes wolbachia is not amplified), high in sensitivity, and the lowest detection limit is 100 copies / ml.
Owner:奚志勇

ABS composite material having long-acting mosquito repellent effect and preparation method thereof

InactiveCN107641284AGood mosquito repellent and anti-mosquito effectEasy to processEmulsionAntioxidant
The invention provides an ABS composite material having long-acting mosquito repellent effect and a preparation method thereof. The ABS (acrylonitrile-butadiene-styrene) copolymer resin composition material is composed of 70-80 parts of emulsion polymerized ABS, 5-10 parts of ABS high-rubber powder, 5-10 parts of mineral powder, 5-10 parts of repellent or natural plant essential oil, 3-5 parts ofcoupling agent, 2-3 parts of lubricant and 0.2-0.3 part of antioxidant. The ABS composite material prepared by the method is odorless or having slight aroma, thereby meeting accepting requirements ofthe public, has good repellent effect on common mosquito species like aedes and culex and has good long-acting performance. Functional application ability of the material in use is promoted, and comprehensive using performance of the material is improved. Good mechanical performance meets using conditions of daily materials, and damage resistance of the material during impact, falling and collision is improved.
Owner:ORINKO NEW MATERIAL CO LTD

Dried attractive lure and kill stations for the control of aedes aegypti

An effective dried attractive toxic bait station that acts as a lure and kill device for Ae. aegypti and other mosquitoes. The bait station is a simulated refuge at least part of which is coated with a dried mixture of poison and sugar forming a dried toxic sugar-containing bait. The simulated refuge attracts Ae. aegypti and other mosquitoes to bait station and encourages them to land on the coated portion. Once a mosquito has landed, it detects the sugar in the dried mixture of sugar and poison and ingests some of it. Once ingested, the dried mixture of poison and sugar will eventually kill the mosquito.
Owner:SYRACUSE UNIVERSITY

Light aedes trap device

The invention relates to a light aedes trap device for trapping larval aedes in gardens, which comprises a cylinder body shielded by a hedge and a spawning chamber arranged in the cylinder body, wherein the upper part of the cylinder body is provided with a water seepage hole, a wall lizard inlet and a wall lizard outlet, the lower part of the cylinder body is buried underground, the upper part of the spawning chamber is provided with a top cover and an aedes trap hole, and the lower part thereof is provided with a hopper and a delivery tube, water outside the spawning chamber is used as an insectary, and space separated by an upper screen on the upper part of the insectary is used as an eclosion chamber; rainwater on the land surface flows into the cylinder body through the water seepage hole and accumulates in the insectary and the spawning chamber, female aedeses fly in the spawning chamber through the aedes trap hole after passing through a hole of a protective cover on the upper part of the cylinder body to spawn on wet floating balls, then aedes eggs can grow into wigglers after falling into water, the wigglers can be lured with lights to swim into the bright insectary to find food and grow into pupas from the outlet of the hopper, and are got trapped in the eclosion chamber and captured by wall lizards after growing into adult aedeses. The light aedes trap device has the advantages of low cost, durability, labor-saving management and non pollution, and can be widely used in residential areas, scenic spots, garrison camping grounds at jungles, grasslands and islands and scientific inspection camping regions to control the breeding of aedeses.
Owner:黄竹

Fluorescence detection primer for three kinds of Wolbachia as well as detection method and detection kit thereof

The invention discloses a fluorescence detection primer for three kinds of Wolbachia as well as a detection method and a detection kit thereof. By utilizing the fluorescence detection primer disclosed by the invention, the aedes type A, the aedes type B and culex Wolbachia can be rapidly, efficiently and specifically detected according to the detection method disclosed by the invention, the primer has the advantages of high singleness and high specificity, only the aedes Wolbachia is detected in aedes, only the culex Wolbachia is detected in the culex, the sensitivity is high, and the lowest detection limit is 100copies / ml.
Owner:奚志勇

Specific primers for amplifying aedes albopictus Cytb gene and method for conducting sequencing by means of same

The invention relates to specific primers for amplifying an aedes albopictus Cytb gene and a method for conducting sequencing by means of the same. For primer sequences, the sequence of a forward primer CytbAEDF is 5'-ATTTTACCTTTTATTGTATTA-3', the sequence of a backward primer CytbAEDR is 5'-CCAATTCATGTTAGAAGA-3', and the method comprises the steps that 1, to-be-determined sample template DNA is extracted; 2, PCR amplification is conducted on the to-be-determined sample template DNA extracted in the step 1; 3, electrophoresis determination is conducted on a PCR amplification product in the step 2; 4, DNA sequence determination is conducted on the PCR product determined in the step 3. By using the specific primers of the aedes albopictus Cytb gene and adopting the corresponding sequencing method, a target gene sequence is amplified fast and accurately, and a reference is provided for fast detecting and authenticating harmful organisms.
Owner:烟台国际旅行卫生保健中心 +1

Nucleic acid sequences found in Drosophilia melanogaster that encode proteins essential for viability and method of use

ActiveUS20050202401A1BiocideSugar derivativesNonsynonymous substitutionGambierdiscus
Within the unique Triplo-lethal region (Tpl) of the Drosophila melanogaster genome we have found a cluster of 20 genes encoding a novel family of proteins. This family is also present in the Anopheles gambiae genome and displays remarkable synteny and sequence conservation with the Drosophila cluster. The family is also present in the sequenced genome of Drosophila pseudoobscura, and homologs have been found in Aedes aegyptii mosquitoes and the honeybee (Apis mellifera), but it is not present in the sequenced genome of any non-insect species. Phylogenetic analysis suggests that the cluster evolved prior to the divergence of Drosophila and Anopheles (250MYA) and has been highly conserved since. The ratio of synonymous to nonsynonymous substitutions and the high codon bias suggest that there has been selection on this family both for expression level and function. We suggest that this gene family is Tpl, name it the Osiris family, and suggest possible functions. We also suggest that this family of proteins, due to the unique dosage sensitivity, and the lack of homologs in non-insect species, would be a good target for genetic engineering or novel insecticides. The proteins also present an excellent means to test compounds for use as possible insecticides.
Owner:MEHARRY MEDICAL COLLEGE +1

Primer and probe for detecting Zika virus

The invention provides a primer and a probe for detecting Zika virus. The primer and the probe are designed in a relatively conservative region, and the primer and the Taqman probe with high specificity are selected, so that the concentrations of the primer and the probe in a reaction system are optimized, the Zika virus in aedes can be accurately detected, and the Zika virus in the aedes can be rapidly, effectively and accurately detected; The primer and the probe can also be used for detecting clinical specimens.
Owner:SUN YAT SEN UNIV

Dengue vector aedes monitoring method and system

The invention provides a dengue vector aedes monitoring method and system. The method comprises the following steps of receiving mosquito data input by each user in a member list through a terminal, wherein the mosquito data comprises the total number of mosquitos and aedes captured by a mosquito catcher arranged at home of each user, the mosquito catchers arranged at home of various users are thesame, and each mosquito catcher is placed at a position meeting a preset environment condition; and sending all the mosquito data received on the same day to the terminal of an administrator. According to the method and the system, the standardized aedes monitoring data can be automatically and continuously obtained, and a common user can be added to the aedes monitoring work, so that a large amount of manpower is saved, and the management is facilitated.
Owner:ICDC CHINA CDC

Bacillus thuringiensis israelensis medium and application thereof

The invention belongs to the technical field of a microbial medium, and specifically discloses a Bacillus thuringiensis israelensis medium. The weight percentage of each component is: 0.5-1% of sucrose, 0.6-1.2% of corn flour, 1-5% of bean cake powder, 0.1-0.5% of peptone, 0.4-1.2% of corn syrup, 0.1-0.5% of calcium carbonate, 0.05-0.1% of potassium dihydrogen phosphate, 0.05-0.1% of magnesium sulfate, 0.05-0.1% of zinc sulfate, 0.1-0.3% of sodium chloride, 0.01-0.05% of potassium nitrate, and 89.95 to 97.04% of deionized water. The invention also discloses an application of the above medium in the Bacillus thuringiensis israelensis. The medium can promote the rapid entry of Bacillus thuringiensis israelensis into a logarithmic growth phase, the proportion of viable spores of a fermentation broth is more than 90%, and the virulence to the Aedes aegypti and Culex pipiens pallens larvae is high, the medium greatly improves the product quality and reduces production costs, and is suitablefor large-scale cultivation and production.
Owner:扬州绿源生物化工有限公司

Mosquito-driving joss stick for preventing infectious disease medium mosquito

The present invention provides a composing of driving mosquitoes joss stick for controlling infectious disease medium mosquito which is excellent for driving aedes aegypti, Cx. pipiens quinquefasciatus, malaria mosquito etc. and has good safety to human and livestock, and is manufactured at any easy rate. The present invention solves the above mentioned problem. The driving mosquitoes joss stick is characterized in that taking 0.01 to 0.5 by quality of 2,2,3,3-tetramethyl cyclopropane formic acid 4-methoxy methyl-2,3,5,6-four fluorine benzyl ester as available composition; taking N-(2-ethyl hexyl)-bicyclo [2,2,1]-hept-5-ene-2,3-dicarboximide which is 0.1 times or 0.2 times more optimally of the available composition by quality as synergist.
Owner:DAINIHON JOCHUGIKU CO LTD

Mosquito repelling joss stick for preventing tropical infectious disease vector-mosquitoes

The invention provides a mosquito repellent for preventing infectious disease medium mosquito, with excellent effect for infectious disease medium mosquito such as Aedes aegypti, Culex fatigans, anopheles and so on, and excellent safety to the human ans domestic animal and low cost. The mosquito repellent comprises 0.1-0.5 weight% of (S)-2-methyl-4-oxy-3-(2-allylene)-2-cyclopentenyl(1R)-antiform-chrysanthemum monocarboxylate, preferably used as heat and evapotranspiration accelerant, ralative to the active ingredient, comprising 1.0-5.0 times of N-(2-ethylhexyl)-double ring-[2,2,1]-age-5-olefin-2,3-dicarboximide.
Owner:DAINIHON JOCHUGIKU CO LTD

Mosquito-driving joss stick for preventing infectous disease medium mosquito

The present invention provides a composing of driving mosquitoes joss stick for controlling infectious disease medium mosquito which is excellent for driving aedes aegypti, Cx. pipiens quinquefasciatus, malaria mosquito etc. and has good safety to human and livestock, and is manufactured at any easy rate. The present invention solves the above mentioned problem. The driving mosquitoes joss stick is characterized in that taking 0.01 to 0.5 by quality of 2,2,3,3-tetramethyl cyclopropane formic acid 4-methoxy methyl-2,3,5,6-four fluorine benzyl ester as available composition; taking N-(2-ethyl hexyl)-bicyclo [2,2,1]-hept-5-ene-2,3-dicarboximide which is 0.1 times or 0.2 times more optimally of the available composition by quality as synergist.
Owner:DAINIHON JOCHUGIKU CO LTD

Mosquito repelling joss stick for preventing tropical infectious disease vector-mosquitoes

The invention provides a mosquito repellent for preventing infectious disease medium mosquito, with excellent effect for infectious disease medium mosquito such as Aedes aegypti, Culex fatigans, anopheles and so on, and excellent safety to the human ans domestic animal and low cost. The mosquito repellent comprises 0.1-0.5 weight% of (S)-2-methyl-4-oxy-3-(2-allylene)-2-cyclopentenyl(1R)-antiform-chrysanthemum monocarboxylate, preferably used as heat and evapotranspiration accelerant, ralative to the active ingredient, comprising 1.0-5.0 times of N-(2-ethylhexyl)-double ring-[2,2,1]-age-5-olefin-2,3-dicarboximide.
Owner:DAINIHON JOCHUGIKU CO LTD

Use of rose Bengal in killing Aedes albopictus adults

The invention relates to tetrachlorotetraiodofluorescei, in particular to use of Aedes albopictus (namely tetrachlorotetraiodofluorescei) in killing Aedes albopictus adults. In the invention, a photosensitive pesticide can be prepared by mixing Aedes albopictus with 10-percent glucose water according to a mass / volume ratio of 50 to 100mg / ml, the photosensitive pesticide is used for soaking or to be sprayed on carriers such as cotton fabrics or plants as bait to be eaten by Aedes albopictus adults, and the Aedes albopictus adults induced to eat the bait die when exposed to light with illuminance of 3*10<4> luxes for 4 to 6 hours. The photosensitive pesticide is very convenient to use, and the production process is simple and the cost is low.
Owner:SOUTHERN MEDICAL UNIVERSITY

System and a method for quickly evaluating the density monitoring of aedes larvae based on a mobile internet technology

The invention discloses a system and a method for quickly evaluating the density monitoring of aedes larvae based on a mobile internet technology. Terminal equipment applying tablet personal computerand the like, the system software is used for carrying out the aedes aegypti larva density monitoring work; The method overcomes the defects that manual paper record statistics of existing aedes density survey data is not timely, operation is tedious, and data analysis and application timeliness is poor, aedes medium on-site survey data, positioning information and meteorological information are input through a surveyor and sent to a server, and an acquisition database is established in a system; And inputting item by item according to the content and carrying out logic inspection and analysis. Statistical operation can be automatically carried out according to an operation formula; According to the method, the statistics result is obtained through the analysis and statistics of the Brinell index (BI), the container index (CI), the house index (HI) and the professional analysis and statistics report, and the medium pathogenic risk and the prevention and control effect index are evaluated by the health professional department, so that the information investigation speed and quality are improved, and dengue fever outbreak epidemic situation disposal and daily prevention and control risk pre-judgment are effectively assisted.
Owner:云南省寄生虫病防治所

Cecropin obtained from Aedes aegypti and its coding gene and application

The present invention discloses Cecropins obtained from Aedes aegypti, a coding gene and applications thereof. According to the present invention, the protein of the present invention is the following (a) or (b) or (c): (a) the protein comprises amino acid residues at sites 20-62 from the N terminal in the sequence 1 in the sequence table, (b) the protein comprises an amino acid sequence represented by the sequence 1 in the sequence table, and (c) the protein is formed by carrying out substitution, and / or deletion and / or addition of one or a plurality of amino acids on the (a) or (b), has the antibacterial peptide function, and is derived from the (a) or (b); results of the present invention further prove that the dengue virus infection capability can be effectively reduced with the AaCECN protein; and the broad application prospects are provided.
Owner:TSINGHUA UNIV

A probe and kit for simultaneously identifying three species of Aedes mosquitoes based on a gene chip

The invention belongs to the field of biological detection and identification, and relates to a probe identifying three aedes of an aedes albopictus, an aedes aegypti and an aedes togoi on the basis of a gene chip, and a kit. The invention discloses the probe identifying the three aedes simultaneously on the basis of the gene chip, and the probe comprises the following three probes: the aedes albopictus: CTTTAACACTGCTGCTTTCTAGTTC; the aedes aegypti: GTGCTGAACTTAGCCACCCTGGT; the aedes togoi: AACTCTCCTGCTTTCAAGTAGT. According to gene sequences of the different aedes, conservative positions of the gene sequences are selected and a specific oligonucleotide detection probe is designed; mosquito species identification is carried out by utilizing a biological method; the problems that the number of identification experts is limited, the identification period is long, and the identification efficiency is low and the like in a traditional media mosquito species identification method are overcome; the quick and accurate identification on the three aedes of the aedes albopictus, the aedes aegypti and the aedes togo is realized. According to an experimental detection, the gene chip and the kit provided by the invention are high in specificity, high in sensitivity, and can be well used for media biological identification work of a port.
Owner:珠海国际旅行卫生保健中心