Cecropin obtained from Aedes aegypti and its coding gene and application
An amino acid and protein technology, which is applied in application, genetic engineering, plant genetic improvement, etc., can solve the problem of limiting the growth of viruses or other pathogenic microorganisms, and achieve the effects of reducing infection, proliferation, and inhibition
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1, DENV-2 induces the expression of AaCECN gene in Aedes aegypti
[0038] 1. Group processing
[0039] Experimental group (24 Aedes aegypti): inoculate dengue type 2 virus to Aedes aegypti (each Aedes aegypti injects 10 MID through the chest cavity) 50 DENV-2, the injection volume is 300nL);
[0040] Control group (22 Aedes aegypti): Each Aedes aegypti was injected with 300 nL of PBS buffer through the chest cavity.
[0041] 2. After 6 hours of inoculation in step 1, the total RNA of Aedes aegypti was extracted and reverse-transcribed into cDNA, and the expression of AaCECN gene in Aedes aegypti was detected by fluorescent quantitative PCR (SYBR Green) (Actin gene was used as an internal reference).
[0042] The primers used to identify the AaCECN gene are as follows:
[0043] Upstream primer: 5'-CGGCAAGAAATTGGAAAAAGTC-3';
[0044] Downstream primer: 5'-GAATCGATCATCCTAGGGCC-3'.
[0045] The primers used to identify the Actin gene are as follows:
[0046] U...
Embodiment 2
[0049] Embodiment 2, the application of the substance that suppresses AaCECN gene expression in promoting dengue virus replication
[0050] 1. Preparation of dsRNA
[0051] 1. The primers designed to prepare the coding DNA of the dsRNA that inhibits AaCECN gene expression are as follows:
[0052] AaCECN-F: 5'- GCGCTCCGTCGATCAAGTTC-3';
[0053] AaCECN-R: 5'- CAGTGTCTTTTCACAATTTAAATCAG-3'.
[0054] In the above primers, the framed region is the T7 promoter sequence.
[0055] 2. Extracting the total RNA of Aedes aegypti and reverse-transcribing it into cDNA, using the cDNA as a template, performing PCR amplification with a primer pair composed of AaCECN-F and AaCECN-R to obtain a PCR amplification product.
[0056] 3. Get the PCR amplification product obtained in step 2, use the Ambion MEGAscriptT7High YieldTranscription Kit (catalogue number AM1334) and carry out in vitro transcription according to the kit instructions, since both AaCECN-F and AaCECN-R have a T7 promoter,...
Embodiment 3
[0081] Embodiment 3, the application of AaCECN protein in inhibiting virus replication
[0082] 1. Construction of recombinant plasmid pMT-AaCECN-V5-HisA
[0083] 1. Synthesize single-stranded DNA molecule A and single-stranded DNA molecule B respectively, and obtain double-stranded DNA molecules after annealing (in single-stranded DNA molecule A and single-stranded DNA molecule B, underline the part in the recognition sequence of the restriction endonuclease , in the resulting double-stranded DNA molecule, the upstream has the sticky end of the restriction endonuclease BglII, and the downstream has the sticky end of the restriction endonuclease XhoI).
[0084] Single-stranded DNA molecule A:
[0085] 5'- GATCT CAGCAACAGTGCGGCGTGGAAGCGGCGCCCAGGTGGAAATTCGGCAAGAAATTGGAAAAAGTCGG GAAAAATGTGTTTAACGCTGCTAAGAAGGCACTGCCAGTCGTTGCCGGGTACAAGGCCCTAGGA C -3'
[0086] Single-stranded DNA molecule B:
[0087] 5'- TCGAG TCCTAGGGCCTTGTACCCGGCAACGACTGGCAGTGCCTTCTTAGCAGCGTTAAACACATTTTTCC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


