Product
Patsnap Eureka
For R&D, Patsnap Eureka makes reading and utilizing patents & technical documents easy.
Patsnap Eureka AIR
Designed for self-driven R&D workflows. Generate viable solutions, solve complex R&D challenges, empower your innovation with AI.
Patsnap Eureka Materials
Designed for material experts only. Revolutionize your material R&D, from search, analyze, to developing new materials.
Feature
TechResearch
Generate reliable direction feasibility study reports for your R&D in just a few steps.
TechSeek
Discover and master advanced knowledge NOW. Basics, ideas, possibilities, all at once.
TechMind
As an expert in R&D Theories, TechMind can generates customized viable solutions instantly.
TechRisk
Analyze your overall solution with one click, know your potential R&D risks in advance.
TechMonitor
Get weekly tech updates, stay abreast of the latest tech innovations and key insights.
Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
68 results about "Aedes albopictus" patented technology
Efficacy Topic
Property
Owner
Technical Advancement
Application Domain
Technology Topic
Technology Field Word
Patent Country/Region
Patent Type
Patent Status
Application Year
Inventor
Aedes albopictus (Stegomyia albopicta), from the mosquito (Culicidae) family, also known as (Asian) tiger mosquito or forest mosquito, is a mosquito native to the tropical and subtropical areas of Southeast Asia; however, in the past few decades, this species has spread to many countries through the transport of goods and international travel. It is characterized by the white bands on its legs and body.
Anti-mosquito finishing process of textile fabric
InactiveCN102154841AReduce absorptionReduced release rateFibre treatmentMicroballoon preparationPolyesterEmulsion
The invention discloses an anti-mosquito finishing process of a textile fabric. The textile fabric is cotton, tencel, modal, blended cotton (viscose cotton, polyester cotton, polyamide cotton), silk, a wool cotton dyed fabric, a thin chemical fiber fabric, a pair of socks, a mosquito net and the like. The process comprises the steps of: selecting a mosquito repellent and a low-temperature fixative, carrying out nano microencapsulation on the mosquito repellent by utilizing a microencapsulation technology, carrying out anti-mosquito finishing on a textile fabric to form an anti-mosquito emulsion through the low-temperature fixative, dehydrating and curing to finally obtain the anti-mosquito finished fabric. The anti-mosquito fabric fabricated by the anti-mosquito finishing process has a fast mosquito killing function, a repelling rate of the anti-mosquito finishing process on aedes albopicus, culex pipiens pallens and the like is higher than 90 percent and an anti-biting rate of the anti-mosquito finishing process is 100 percent; the anti-mosquito fabric does not have bad influence on physical indices such as appearance, strength, moisture absorbing property and the like of the fabric; the anti-mosquito fabric has a good anti-mosquito effect after being washed 15 times; and the anti-mosquito finished fabric does not stimulate or cause allergy to skin, is safe and non-toxic to a human body, and is comfortable to wear.
Owner:FUJIAN ZHONGHE
Integral type mosquito raising device
The invention discloses an integral type mosquito raising device, comprising a mosquito cage (1) and a water container (9), wherein a sleeve (2) is arranged at the front side of the mosquito cage (1). The mosquito cage (1) is integrally connected with the water container (9) through a bottom box; an opening is arranged on a bottom plate (7) of the bottom box, and a standby metal net (3) which is slightly larger than the opening (8) and a cover plate (4) are placed in the bottom box; a bottom framework of the mosquito cage (1) is connected with the upper edge of a top part (6) of the bottom box (6), so as to form the bottom part of the mosquito cage (1) by the bottom box; the lower part of the bottom box is connected with the water container (9), the upper edge of the top part (6) of the bottom box (6) is horizontally placed on the upper edge of the water container (9), and the four sides of the bottom plate (7) of the bottom box are tightly adhered to the water container (9). The integral type mosquito raising device provided by the invention has the advantages of simple structure, convenience for operation and capability of increasing biological safety of a laboratory. The integral type mosquito raising device is suitable for raising common mosquitoes and is particularly is suitable for raising Aedes albopictus.
Owner:武汉市疾病预防控制中心
Probe identifying three aedes simultaneously on the basis of gene chip and kit
InactiveCN105039563AStrong specificityHigh sensitivityMicrobiological testing/measurementDNA/RNA fragmentationAedes albopictusAedes taeniorhynchus
The invention belongs to the field of biological detection and identification, and relates to a probe identifying three aedes of an aedes albopictus, an aedes aegypti and an aedes togoi on the basis of a gene chip, and a kit. The invention discloses the probe identifying the three aedes simultaneously on the basis of the gene chip, and the probe comprises the following three probes: the aedes albopictus: CTTTAACACTGCTGCTTTCTAGTTC; the aedes aegypti: GTGCTGAACTTAGCCACCCTGGT; the aedes togoi: AACTCTCCTGCTTTCAAGTAGT. According to gene sequences of the different aedes, conservative positions of the gene sequences are selected and a specific oligonucleotide detection probe is designed; mosquito species identification is carried out by utilizing a biological method; the problems that the number of identification experts is limited, the identification period is long, and the identification efficiency is low and the like in a traditional media mosquito species identification method are overcome; the quick and accurate identification on the three aedes of the aedes albopictus, the aedes aegypti and the aedes togo is realized. According to an experimental detection, the gene chip and the kit provided by the invention are high in specificity, high in sensitivity, and can be well used for media biological identification work of a port.
Owner:珠海国际旅行卫生保健中心
Mosquito repellent gel and preparation method thereof
InactiveCN102949297AEasy to spreadGood mosquito repellent activityCosmetic preparationsToilet preparationsAedes albopictusCulex pipiens pipiens
The invention discloses the preparation of a mosquito repellent gel. The mosquito repellent gel is characterized by consisting of a mosquito repellent effective ingredient and a gel carrier; the gel ingredient consists of the following components in percentage by mass: 5-20% of mosquito repellent agent (R2), 0.5-1.5% of base material, 0.8-2% of neutralization alkali, 5-16% of moisturizing agent, 0.2-0.4% of preservative, an appropriate amount of essence and the balance of de-ionized water; and the total percentage by mass is 100%. The mosquito repellent gel is easy to coat, has no irritation for the skin and has good mosquito repellent activity. The repellent time of the R2 gel with a concentration of 10% for three mosquito varieties comprising Aedesalbopictus, Culex pipiens quinquefasciatus and Culex pipiens can respectively reach the international grade B. The R2 gel further enriches the dosage form varieties of the terpene mosquito repellents and promotes the development of the plant repellents.
Owner:JIANGXI AGRICULTURAL UNIVERSITY
Preparation method of aedes albopictus stably carrying culex quinquefasciatus wolbachia and application of aedes albopictus stably carrying culex quinquefasciatus wolbachia to prevention and control of aedes albopictus
The invention discloses a preparation method of aedes albopictus stably carrying culex quinquefasciatus wolbachia and the application of the aedes albopictus stably carrying the culex quinquefasciatus wolbachia to prevention and control of the aedes albopictus. The preparation method comprises the following steps that Guangzhou wild aedes albopictus treated with tetracycline are screened, so that aedes albopictus without wolbachia is obtained, and the aedes albopictus stably carrying the culex quinquefasciatus wolbachia is prepared. The application of the aedes albopictus stably carrying the culex quinquefasciatus wolbachia to prevention and control of the aedes albopictus has the advantages that the cost is low, and sustainability and environment friendliness are achieved. The aedes albopictus stably carrying the culex quinquefasciatus wolbachia is one of the most potential biological measures for prevention and control of mosquito-borne diseases, the problem that insects can easily establish drug resistance under the condition of using chemical insecticides is solved, and the problem that harm to the environment and the public health is caused is also solved.
Owner:GUANGZHOU WOLBAKI BIOTECH CO LTD
Method for enabling female aedes albopictus affected by Wolbach bacteria to be infertile
InactiveCN106259211AEliminate the threat of substitutionIncrease productivityAnimal husbandryAedes krombeiniAedes albopictus
The invention discloses a method for enabling female aedes albopictus affected by Wolbach bacteria to be infertile. The method comprises the steps that female aedes albopictus or male aedes albopictus containing female aedes albopictus is placed under X-ray for irradiation, the irradiation dose is larger than or equal to 28 Gy, the female aedes albopictus is made to be infertile, and the age of the female aedes albopictus is 4-40 h. X ray is adopted for performing irradiation in an aedes albopictus pupal period, so that the female aedes albopictus cannot generate offspring, and group replacement risk caused by accident release of the female aedes albopictus affected by the novel Wolbach bacteria is eliminated. Compared with a traditional artificial female removal method, the method can rapidly and effectively enable the female aedes albopictus to be infertile, the production efficiency is greatly improved, and the method is suitable for large-scale production and application.
Owner:GUANGZHOU WOLBAKI BIOTECH CO LTD
Mosquito repellent containing plant essential oil
ActiveCN107996622AExtend effective protection timeBiocidePest repellentsChemical synthesisAdditive ingredient
The invention discloses a plant source mosquito repellent which is characterized by the following main components: catmint oil and eucalyptus globulus oil. The mosquito repellent takes plant essentialoil as the main ingredient, the synergetic effect of the two kinds of essential oil is achieved, and the available protective time is prolonged. In addition, the mosquito repellent does not contain diethyltoluamide (DEET), dimethyl phthalate and other synthetic repellents, and is green, safe and environment-friendly. The plant source mosquito repellent disclosed by the invention can be made intoan oil base type, an alcohol-based type, emulsion and micro-emulsion, has an excellent effect of repelling aedes albopictus, and has extremely high application value in daily life and outdoor activities.
Owner:LOOBI GUANGZHOU HEALTH IND CO LTD
Mosquito trapping liquid
The invention relates to mosquito trapping liquid, in particular to a bait for trapping mosquitos, belonging to a pest attractant containing organic compounds. The mosquito trapping liquid for trapping aedes albopictus comprises the following components in percentage by volume: 1% of lactic acid, 1% of acetone, 1% of linalool, 1% of octanal, 1% of skatole, 1% of indole, 1% of nonanal, 1% of nonylacetate, 1% of heptylacetate and 1% of octylacetate; the components are mixed and then diluted into 100% of mixed liquid with 90% of distilled water. The mosquito trapping liquid has the characteristics of good safety, strong trapping ability and the like and has no drug resistance and no environmental pollution. If working together with a combined type trap monitoring device, the mosquito trapping liquid can effectively gather mosquitos in a trapper for centralized treatment or killing. The mosquito trapping liquid has wide application prospect.
Owner:马晓光 +1
Plant essential oil-containing mosquito repellent
Owner:SHENZHEN FJ BIOTECH +1
Standard breeding method of aedes albopictus larvae
ActiveCN107018956ASolve technical problems such as developmental dyssynchronyGuaranteed normal growthAnimal husbandryAedes albopictusFishery
The invention discloses a standard breeding method of aedes albopictus larvae. The method comprises the steps as follows: 3,000-8,000 hatched aedes albopictus larvae are put in each breeding plate for breeding at the temperature of 24-28 DEG C and at the relative humidity of 60%-90%, during breeding, suspension feed is added quantitatively every day according to the breeding density, and the amount of the suspension feed is progressively decreased from the middle time period of the fourth and / or fifth day to time periods at two ends in the feeding time period of one week. The method creates conditions for male and female separation of aedes albopictus pupae, powerfully guarantees mass production in laboratories and factories and solves the problem of non-synchronous development in the aedes albopictus larva breeding process.
Owner:GUANGZHOU WOLBAKI BIOTECH CO LTD
Artificial feed for aedes albopictus larvae and preparation method thereof
InactiveCN106212855AGuaranteed normal growthGuaranteed activityAnimal feeding stuffAedes taeniorhynchusNormal growth
The invention discloses artificial feed for aedes albopictus larvae and a preparation method thereof. The artificial feed comprises the following components in parts by mass: 60-84 parts of beef liver powder, 24-36 parts of shrimp meal and 12-36 parts of yeast powder. The artificial feed for aedes albopictus larvae disclosed by the invention can be used for feeding aedes albopictus larvae and is capable of meeting requirements of normal growth of aedes albopictus larvae and achieving the most ideal effect, so that conditions are created for artificial feeding of the aedes albopictus larvae. According to the invention, the technical problems such as asynchronous development in the process of feeding the aedes albopictus larvae and the like are solved, normal growth and survival rate of the larvae are guaranteed, and a strong guarantee is provided for large-scale production in laboratories and factories. Moreover, the cost is low, the formula materials are convenient to purchase, the operation is simple and convenient, and the feed has a reasonable and excellent formula for feeding the aedes albopictus larvae.
Owner:GUANGZHOU WOLBAKI BIOTECH CO LTD
An apyrase encoding gene of Aedes albopictus, and preparation method and application of protein thereof
The invention falls into the field of biotechnology, and relates to an apyrase encoding gene of Aedes albopictus, and preparation method and application of protein thereof. In the invention, RNA is extracted from the salivary gland of Aedes albopictus; the apyrase encoding gene of Aedes albopictus is obtained by PCR; and an apyrase expression vector pET19b-apyrase is constructed. After abundant expression, purification and further identification, it has been proved that, the recombinant apyrase of Aedes albopictus has equal immune activity as natural apyrase of Aedes albopictus, can cause immune response of human, and has inhibitory activity against platelet aggregation. The inventive apyrase of Aedes albopictus can be used in the diagnosis of anaphylactic diseases induced by Aedes albopictus, and also be used as antithrombotic for treating thrombus caused by platelet aggregation.
Owner:FUDAN UNIV
Aedes albopictus attractant and preparation method thereof
The invention discloses an aedes albopictus attractant and a preparation method thereof. The invention provides an attractant, and the active ingredients include lactic acid and ammonia at a weight ratio of (15-20):(5-15). The weight ratio of lactic acid to ammonia is 20:15 or 15:15 or 15:10 or 10:15 or 20:15 or 20:10. The attractant consists of powder containing the lactic acid and gel containing the ammonia water. Experiment indicates that: the attractant characterized in the inducing activity against aedes albopictus provided by the invention can be applied to the population monitoring and trap-kill prevention and treatment of aedes albopictus.
Owner:MICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI
Application of soy sauce residue glyceride in preparation of preparation for controlling minisize insects or foliar fungal and bacterial diseases
The invention discloses application of a soy sauce residue glyceride in preparation of a preparation for controlling minisize insects or foliar fungal and bacterial diseases. The soy sauce residue glyceride is a glyceride containing C16-C22 fatty acids. According to the invention, the soy sauce residue glyceride is taken as a main component, and effective auxiliary agents are added for preparationof a pesticide preparation. Through tests, the pesticide preparation has a same controlling effect on tetranychus urticae, diaphorina citri, panonychus citri, aedes albopictus and other minisize insects and sooty mould and other diseases compared with a current mineral oil emulsion, and does not show phytotoxicity after repeated application to crops for a short period of time. The pesticide preparation has the advantages of simple and stable ingredients, high safety, good anti-insect and disease-preventing effects, and no phytotoxicity to crops. The main components and additives of the pesticide preparation are food grade, and easy to degrade in environment, and the pesticide preparation is easy for industrialized standardized production, and has strong market competitiveness compared with mineral oil emulsions.
Owner:INST OF ZOOLOGY GUANGDONG ACAD OF SCI +3
Plant essential oil-containing mosquito repellent
The invention discloses a plant essential oil-containing mosquito repellent. The main components are nepeta oil, citronella oil and the like. The repellent has the characteristics that: DEET and other chemical repellents are not contained, plant essential oil is taken as the main components, the repellent can be made into oil-based type, alcohol-based type, and water-based repellents, has a low cost and no toxicity, and has good repellent effects on Aedes albopictus.
Owner:SHENZHEN FJ BIOTECH +1
Aedes albopictus and aedes aegypti CYTB gene identification kit based on high-resolution melting curve and identification method thereof
ActiveCN108165642AHigh sensitivityStrong specificityMicrobiological testing/measurementDNA/RNA fragmentationAedes taeniorhynchusLarva currens
The invention relates to the field of species identification, and provides an aedes albopictus and aedes aegypti CYTB gene identification kit based on a high-resolution melting curve and an identification method thereof. The aedes albopictus and aedes aegypti CYTB gene identification kit based on the high-resolution melting curve is characterized in that universal primers are designed according toaedes albopictus and aedes aegypti CYTB gene sequences, and an optimized high-resolution melting curve reaction system is adopted to identify aedes albopictus and aedes aegypti of various forms suchas imagoes, ova, larvae and pupae. By the adoption of the aedes albopictus and aedes aegypti CYTB gene identification kit based on the high-resolution melting curve and the identification method thereof, aedes albopictus and aedes aegypti can be identified; operation is easy, the speed is high, no PCR products need post-treatment, the difference of a single base can be detected, and closed-tube operation is indeed achieved.
Owner:山东国际旅行卫生保健中心
Bacillus thuringiensis for killing mosquito larvae and application of bacillus thuringiensis
InactiveCN107254426AReduce the risk of resistance developmentBiocideBacteriaBacillus thuringiensisAureobasidium sp.
The invention belongs to the technical field of biological prevention and control of sanitary insect pests, and mainly discloses a material and a method for preventing and controlling larvae of mosquitoes which are the leader of 'four pests'. The invention discloses a novel strain Bt S2160-1 of Bacillus thuringiensis, Bt for killing mosquito larvae, wherein the preservation number of the novel strain is CGMCC No.13274. The strain Bt S2160-1 has very high insecticidal activity upon larvae of culex fatigans and aedes albopictus, and compared with a Bt mosquito strain Bti recommended by WHO (World Health Organization), the Bt S2160-1 has relatively high activity upon larvae of aedes albopictus. The Bacillus thuringiensis Bt S2160-1 disclosed by the invention can be made into an insecticide for large-scale prevention and control on larva populations of culex fatigans and aedes albopictus. Therefore, the strain can be powerful supplement as a mosquito control microbial agent in addition to Bti, or even can be used as a substitution of Bti for controlling populations of aedes albopictus, and the risk that mosquitoes have resistance to a Bti crystal protein which is used for a long time to control mosquito populations can be reduced.
Owner:浙江翠溪农业开发有限公司
Culex and aedes attractant and application method
InactiveCN101843245AStatistics are accurateProposed concentrationBiocidePest attractantsPaleontologyAedes albopictus
The invention relates to culex and aedes attractant and an application method, belonging to the mosquito attractants containing organic compounds; the attractant in the invention is formed by mixing caprylic acid and benzpyrole, wherein the concentration of the caprylic acid is 10mug / ml, and the concentration of the benzpyrole is 0.1-1mug / ml, and the caprylic acid and the benzpyrole are prepared by 1:1 of volume ratio; the application method is that: the attractant is arranged in the room or at the field and is released slowly and naturally; in the field, the attractant is arranged in a glass long-neck volumetric flask or is released by being arranged in glass long-neck bottles with corks or is used with an insect trap. In the invention, the attractant can effectively attract culex pipiens pallens, aedes albopictus and other mosquitos, and the drug diffusion is little, and the attraction efficiency is high.
Owner:成都军区疾病预防控制中心军事医学研究所
Hatching solution used for hatching mosquito eggs of Aedes albopictus and hatching method of mosquito eggs of Aedes albopictus
ActiveCN107372370AAccelerate the hatching rateWell synchronized growthAnimal husbandryYeastAedes albopictus
The invention relates to a hatching solution used for hatching mosquito eggs of Aedes albopictus and a hatching method of the mosquito eggs of the Aedes albopictus. The hatching solution is an aqueous solution prepared from yeast peptone and water, wherein the concentration of the yeast peptone in the aqueous solution is 0.7-1.5 g / L. The hatching method comprises the following steps that fermentation is conducted on the hatching solution used for hatching the mosquito eggs of the Aedes albopictus; the mosquito eggs of the Aedes albopictus are weighed and put into a hatching pipe, the fermented hatching solution is added into the hatching pipe, a pipe cover of the hatching pipe is sealed, the hatching pipe is evenly shook, standing is conducted on the hatching pipe for hatching, the pipe cover of the hatching pipe is opened, and hatched larvae is transferred into a breeding plate. By means of the hatching solution, the mosquito eggs of the Aedes albopictus are hatched under certain conditions, the hatching speed of the mosquito eggs of the Aedes albopictus is greatly increased, the hatching rate of the active mosquito eggs in one hour is high, and the synchronism of growth of the larvae is good; the hatching method has the advantages that the survival rate of the larvae is high, operation is simple, and the hatching cost is low.
Owner:GUANGZHOU WOLBAKI BIOTECH CO LTD
Traditional Chinese medicine for treating tinea cruris
InactiveCN105521380ADefinite curative effectNo side effectsAntimycoticsDermatological disorderAcronychia pedunculataMelothria indica
The invention discloses a traditional Chinese medicine for treating tinea cruris. The traditional Chinese medicine is prepared from the following traditional Chinese medicinal materials: Zehneria indica(Lour.)Keraudren [Melothria indica Lour.], calomel, spina gleditsiae, polygonum plebeium, Juglans regia bark, leaves of Hibiscus syriacus L, Breynia retusa Dennst.Alston, oiltea camellia seed dregs, leaves of Acronychia pedunculata (L.)Miq., lime, lily-flowered magnolia bark, wilson's passion flowers, Hirundo daurica japonica Temminek et Schlegel, areca-nuts, the tuber of stemona, sterculia nobilis, longan leaves, aedes albopictus, Pterocarya stenoptera C. D C.[P.ste-roptera C.DC.var.sinensis Graebn], and orpiment. The traditional Chinese medicine is prepared by taking the pure natural traditional Chinese medicinal materials as raw materials, treats both symptoms and root causes, is definite in curative effects, and is free of toxic and side effects, and relapse of tinea cruris seldom occurs.
Owner:李冉
Method for preparing mosquito slow-release attractant
InactiveCN102696604AStrong attractionReduce the number of speciesBiocidePest attractantsOrganic solventAlcohol
The invention discloses a method for preparing a mosquito slow-release attractant. The method comprises the following steps: dissolving the following components by weight: 7-10 parts of 1-octen-3-ol, 2-5 parts of heptyl acetate and 6-9 parts of nonylacetate in an organic solvent with 100 parts in volume for later use; stirring 1000-7500 parts of polyatomic alcohol of which the molecular weight is less than 5000 for 60 minutes under the conditions that the temperature is 40-75 DEG C and the vacuum degree is -0.1Mpa; adding the solution for later use into the polyatomic alcohol; continuously stirring to be uniform under the conditions that the temperature is 40-75 DEG C and the vacuum degree is -0.1Mpa; adding 2500-10000 parts of isocyanate by weight; continuously stirring for 120 minutes; stopping stirring and vacuumizing to obtain the pasty mosquito slow-release attractant. With the adoption of the prepared mosquito slow-release attractant, culex pipiens pallens, aedes albopictus and other mosquitoes can be continuously effectively attracted with high attraction efficiency; the method is simple; the environment cannot be polluted by the raw materials; and the release speed is stable.
Owner:陕西广仁生物科技有限公司
Anti-HIV aedes albopictus protein with platelet aggregation inhibiting function and preparation method of anti-HIV aedes albopictus protein
InactiveCN104356220AInhibit aggregationHas a specific inhibitory effectAntiviralsPeptide preparation methodsInclusion bodiesTotal rna
The invention relates to an anti-HIV aedes albopictus protein with a platelet aggregation inhibiting function. An amino acid sequence of the anti-HIV aedes albopictus protein is shown as SEQ ID NO:1. A preparation method of the anti-HIV aedes albopictus protein comprises the following steps: purifying total RNA of aedes albopictus salivary glands and amplifying so as to obtain total cDNA, then amplifying genes of the total cDNA taken as a template and cloning the genes into a prokaryotic expression vector, carrying out inducible expression via IPTG, carrying out denaturation and renaturation folding on an expressed inclusion body, then filtering the inclusion body via a gel, and carrying out separation and purification on the inclusion body by ion exchange chromatography so as to obtain the anti-HIV aedes albopictus protein. The anti-HIV aedes albopictus protein has the activities of inhibiting the proliferation of the HIV in cells and the platelet aggregation induced by multiple agonists, and has the advantages of no cytotoxicity and strong anti-HIV specificity. Thus, the anti-HIV aedes albopictus protein can be used for preparing medicines for resisting AIDS (Acquired Immune Deficiency Syndrome) and related diseases.
Owner:SOUTHERN MEDICAL UNIVERSITY
Culex and aedes attractant and application method
InactiveCN101843245BStatistics are accurateEffective lureBiocidePest attractantsCulexAedes krombeini
Owner:成都军区疾病预防控制中心军事医学研究所
Materials and methods for pest control
Owner:UNIV OF FLORIDA RES FOUNDATION INC
Preparation methods of botanical drug mosquito-repellent textile, and pharmaceutical composition of botanical drug
InactiveCN111109307ATo achieve the effect of repelling mosquitoesGive full play to medicinal valueBiocidePest repellentsLavandulaAedes albopictus
The invention discloses a mosquito-repellent botanical pharmaceutical composition. The composition comprises mint, clove, perilla leaf, rhizoma acori graminei, folium artemisiae argyi, dried orange peel, evodia lepta, root or rattan of Cyclea hypoglauca (Schauer) Diels, houttuynia cordata and lavender, and further discloses three preparation methods of a mosquito-repellent textile containing the botanical drug. Mosquito-repellent effective components in the preparation methods of the botanical drug mosquito-repellent textile are pure traditional Chinese medicine components, have no adverse effects on the health of a user and do not pollute the environment, and a combination mode of the mosquito-repellent drug and the textile is simple, convenient and easy to implement, high in operabilityand low in cost. The textile treated by the traditional Chinese medicines and the method has good aedes albopictus repellency, and the repellency rate is about 60%.
Owner:COTTON RES INST HEBEI ACAD OF AGRI & FOREST SCI
Anti-mosquito finishing process of textile fabric
InactiveCN102154841BIncreased repellencyQuick knock downFibre treatmentMicroballoon preparationPolyesterPolyamide
Owner:FUJIAN ZHONGHE
Destruxin and pyriproxyfen-containing insecticidal composition and application thereof
ActiveCN106818888ASynergistic effect is obviousReduce usageBiocideDead animal preservationAedes albopictusActive component
The invention relates to an insecticidal composition with a synergistic action. The insecticidal composition is prepared by taking destruxin and pyriproxyfen as basic active components and mixing the destruxin and the pyriproxyfen according to the following ratio of 1g to (1-99)g. After the two effective components are mixed, the insecticidal composition can be applied to preventing and controlling health pests including aedes albopictus, flies and termites and preferably preventing and controlling diptera health pests including mosquitos, flies and the like.
Owner:广州禾立田生物科技有限公司
Mosquito repellant compound containing plant essential oil, preparation and application thereof
Owner:谭贤舜
Method for delaying eclosion of aedes albopictus pupas and method for transporting aedes albopictus pupas
ActiveCN107568202AGuarantee smooth implementationExtension of timeLiving organism packagingDead animal preservationAedes krombeiniAedes albopictus
The invention relates to a method for delaying eclosion of aedes albopictus pupas and a method for transporting aedes albopictus pupas. The method for delaying eclosion of aedes albopictus pupas comprises the following step: preserving aedes albopictus pupas in an environment of 16-21 DEG C. Tests show that if the aedes albopictus pupas are preserved at 16-21 DEG C, the time from nymphosis to eclosion is prolonged, normal eclosion can be still achieved for the preserved aedes albopictus pupas, and the aedes albopictus pupas and the number of dead mature misquotes after eclosion are not greatlydifferent from those of room-temperature eclosion. In the transportation process of the aedes albopictus pupas, the temperature of the transportation environment is kept within 16-21 DEG C, then theaedes albopictus pupas can be prevented from eclosion in the transportation process, remote-distance transportation of the aedes albopictus pupas can be achieved, the transportation space can be greatly saved, the transportation cost can be reduced, and large-scale transportation of factories is powerfully ensured.
Owner:GUANGZHOU WOLBAKI BIOTECH CO LTD
Application of erythroseine B for killing adult mosquitoes of aedes albopictus
ActiveCN102246757ADestruction will notEasy to useBiocideAnimal repellantsFluorescenceAedes albopictus
The invention relates to tetraiodofluorescein, in particular to application of erythroseine B (namely tetraiodofluorescein) for killing adult mosquitoes of aedes albopictus. A photosensitive insecticide can be prepared by mixing the erythroseine B and 10 percent glucose water in a mass / volume ratio of 50 to 100 mg / ml. The photosensitive insecticide is impregnated or sprayed on carriers such as cotton fabrics or plants and is used as bait to be eaten by the adult mosquitoes of the aedes albopictus, and the adult mosquitoes, which are induced to eat the photosensitive insecticide, of the aedes albopictus are killed by lux illumination with the illuminance of 3*10<4> for 4 to 6 hours. The photosensitive insecticide is convenient to use, and a production process is simple and low in cost.
Owner:SOUTHERN MEDICAL UNIVERSITY
Popular searches
Who we serve
- R&D Engineer
- R&D Manager
- IP Professional
Why Patsnap Eureka
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com