Patents
Literature
Patsnap Copilot is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Patsnap Copilot

67 results about "Aedes albopictus" patented technology

Aedes albopictus (Stegomyia albopicta), from the mosquito (Culicidae) family, also known as (Asian) tiger mosquito or forest mosquito, is a mosquito native to the tropical and subtropical areas of Southeast Asia; however, in the past few decades, this species has spread to many countries through the transport of goods and international travel. It is characterized by the white bands on its legs and body.

Anti-mosquito finishing process of textile fabric

The invention discloses an anti-mosquito finishing process of a textile fabric. The textile fabric is cotton, tencel, modal, blended cotton (viscose cotton, polyester cotton, polyamide cotton), silk, a wool cotton dyed fabric, a thin chemical fiber fabric, a pair of socks, a mosquito net and the like. The process comprises the steps of: selecting a mosquito repellent and a low-temperature fixative, carrying out nano microencapsulation on the mosquito repellent by utilizing a microencapsulation technology, carrying out anti-mosquito finishing on a textile fabric to form an anti-mosquito emulsion through the low-temperature fixative, dehydrating and curing to finally obtain the anti-mosquito finished fabric. The anti-mosquito fabric fabricated by the anti-mosquito finishing process has a fast mosquito killing function, a repelling rate of the anti-mosquito finishing process on aedes albopicus, culex pipiens pallens and the like is higher than 90 percent and an anti-biting rate of the anti-mosquito finishing process is 100 percent; the anti-mosquito fabric does not have bad influence on physical indices such as appearance, strength, moisture absorbing property and the like of the fabric; the anti-mosquito fabric has a good anti-mosquito effect after being washed 15 times; and the anti-mosquito finished fabric does not stimulate or cause allergy to skin, is safe and non-toxic to a human body, and is comfortable to wear.
Owner:FUJIAN ZHONGHE

Integral type mosquito raising device

The invention discloses an integral type mosquito raising device, comprising a mosquito cage (1) and a water container (9), wherein a sleeve (2) is arranged at the front side of the mosquito cage (1). The mosquito cage (1) is integrally connected with the water container (9) through a bottom box; an opening is arranged on a bottom plate (7) of the bottom box, and a standby metal net (3) which is slightly larger than the opening (8) and a cover plate (4) are placed in the bottom box; a bottom framework of the mosquito cage (1) is connected with the upper edge of a top part (6) of the bottom box (6), so as to form the bottom part of the mosquito cage (1) by the bottom box; the lower part of the bottom box is connected with the water container (9), the upper edge of the top part (6) of the bottom box (6) is horizontally placed on the upper edge of the water container (9), and the four sides of the bottom plate (7) of the bottom box are tightly adhered to the water container (9). The integral type mosquito raising device provided by the invention has the advantages of simple structure, convenience for operation and capability of increasing biological safety of a laboratory. The integral type mosquito raising device is suitable for raising common mosquitoes and is particularly is suitable for raising Aedes albopictus.
Owner:武汉市疾病预防控制中心

Probe identifying three aedes simultaneously on the basis of gene chip and kit

The invention belongs to the field of biological detection and identification, and relates to a probe identifying three aedes of an aedes albopictus, an aedes aegypti and an aedes togoi on the basis of a gene chip, and a kit. The invention discloses the probe identifying the three aedes simultaneously on the basis of the gene chip, and the probe comprises the following three probes: the aedes albopictus: CTTTAACACTGCTGCTTTCTAGTTC; the aedes aegypti: GTGCTGAACTTAGCCACCCTGGT; the aedes togoi: AACTCTCCTGCTTTCAAGTAGT. According to gene sequences of the different aedes, conservative positions of the gene sequences are selected and a specific oligonucleotide detection probe is designed; mosquito species identification is carried out by utilizing a biological method; the problems that the number of identification experts is limited, the identification period is long, and the identification efficiency is low and the like in a traditional media mosquito species identification method are overcome; the quick and accurate identification on the three aedes of the aedes albopictus, the aedes aegypti and the aedes togo is realized. According to an experimental detection, the gene chip and the kit provided by the invention are high in specificity, high in sensitivity, and can be well used for media biological identification work of a port.
Owner:珠海国际旅行卫生保健中心

Preparation method of aedes albopictus stably carrying culex quinquefasciatus wolbachia and application of aedes albopictus stably carrying culex quinquefasciatus wolbachia to prevention and control of aedes albopictus

The invention discloses a preparation method of aedes albopictus stably carrying culex quinquefasciatus wolbachia and the application of the aedes albopictus stably carrying the culex quinquefasciatus wolbachia to prevention and control of the aedes albopictus. The preparation method comprises the following steps that Guangzhou wild aedes albopictus treated with tetracycline are screened, so that aedes albopictus without wolbachia is obtained, and the aedes albopictus stably carrying the culex quinquefasciatus wolbachia is prepared. The application of the aedes albopictus stably carrying the culex quinquefasciatus wolbachia to prevention and control of the aedes albopictus has the advantages that the cost is low, and sustainability and environment friendliness are achieved. The aedes albopictus stably carrying the culex quinquefasciatus wolbachia is one of the most potential biological measures for prevention and control of mosquito-borne diseases, the problem that insects can easily establish drug resistance under the condition of using chemical insecticides is solved, and the problem that harm to the environment and the public health is caused is also solved.
Owner:GUANGZHOU WOLBAKI BIOTECH CO LTD

Application of soy sauce residue glyceride in preparation of preparation for controlling minisize insects or foliar fungal and bacterial diseases

The invention discloses application of a soy sauce residue glyceride in preparation of a preparation for controlling minisize insects or foliar fungal and bacterial diseases. The soy sauce residue glyceride is a glyceride containing C16-C22 fatty acids. According to the invention, the soy sauce residue glyceride is taken as a main component, and effective auxiliary agents are added for preparationof a pesticide preparation. Through tests, the pesticide preparation has a same controlling effect on tetranychus urticae, diaphorina citri, panonychus citri, aedes albopictus and other minisize insects and sooty mould and other diseases compared with a current mineral oil emulsion, and does not show phytotoxicity after repeated application to crops for a short period of time. The pesticide preparation has the advantages of simple and stable ingredients, high safety, good anti-insect and disease-preventing effects, and no phytotoxicity to crops. The main components and additives of the pesticide preparation are food grade, and easy to degrade in environment, and the pesticide preparation is easy for industrialized standardized production, and has strong market competitiveness compared with mineral oil emulsions.
Owner:INST OF ZOOLOGY GUANGDONG ACAD OF SCI +3

Bacillus thuringiensis for killing mosquito larvae and application of bacillus thuringiensis

InactiveCN107254426AReduce the risk of resistance developmentBiocideBacteriaBacillus thuringiensisAureobasidium sp.
The invention belongs to the technical field of biological prevention and control of sanitary insect pests, and mainly discloses a material and a method for preventing and controlling larvae of mosquitoes which are the leader of 'four pests'. The invention discloses a novel strain Bt S2160-1 of Bacillus thuringiensis, Bt for killing mosquito larvae, wherein the preservation number of the novel strain is CGMCC No.13274. The strain Bt S2160-1 has very high insecticidal activity upon larvae of culex fatigans and aedes albopictus, and compared with a Bt mosquito strain Bti recommended by WHO (World Health Organization), the Bt S2160-1 has relatively high activity upon larvae of aedes albopictus. The Bacillus thuringiensis Bt S2160-1 disclosed by the invention can be made into an insecticide for large-scale prevention and control on larva populations of culex fatigans and aedes albopictus. Therefore, the strain can be powerful supplement as a mosquito control microbial agent in addition to Bti, or even can be used as a substitution of Bti for controlling populations of aedes albopictus, and the risk that mosquitoes have resistance to a Bti crystal protein which is used for a long time to control mosquito populations can be reduced.
Owner:浙江翠溪农业开发有限公司

Hatching solution used for hatching mosquito eggs of Aedes albopictus and hatching method of mosquito eggs of Aedes albopictus

ActiveCN107372370AAccelerate the hatching rateWell synchronized growthAnimal husbandryYeastAedes albopictus
The invention relates to a hatching solution used for hatching mosquito eggs of Aedes albopictus and a hatching method of the mosquito eggs of the Aedes albopictus. The hatching solution is an aqueous solution prepared from yeast peptone and water, wherein the concentration of the yeast peptone in the aqueous solution is 0.7-1.5 g/L. The hatching method comprises the following steps that fermentation is conducted on the hatching solution used for hatching the mosquito eggs of the Aedes albopictus; the mosquito eggs of the Aedes albopictus are weighed and put into a hatching pipe, the fermented hatching solution is added into the hatching pipe, a pipe cover of the hatching pipe is sealed, the hatching pipe is evenly shook, standing is conducted on the hatching pipe for hatching, the pipe cover of the hatching pipe is opened, and hatched larvae is transferred into a breeding plate. By means of the hatching solution, the mosquito eggs of the Aedes albopictus are hatched under certain conditions, the hatching speed of the mosquito eggs of the Aedes albopictus is greatly increased, the hatching rate of the active mosquito eggs in one hour is high, and the synchronism of growth of the larvae is good; the hatching method has the advantages that the survival rate of the larvae is high, operation is simple, and the hatching cost is low.
Owner:GUANGZHOU WOLBAKI BIOTECH CO LTD

Anti-HIV aedes albopictus protein with platelet aggregation inhibiting function and preparation method of anti-HIV aedes albopictus protein

The invention relates to an anti-HIV aedes albopictus protein with a platelet aggregation inhibiting function. An amino acid sequence of the anti-HIV aedes albopictus protein is shown as SEQ ID NO:1. A preparation method of the anti-HIV aedes albopictus protein comprises the following steps: purifying total RNA of aedes albopictus salivary glands and amplifying so as to obtain total cDNA, then amplifying genes of the total cDNA taken as a template and cloning the genes into a prokaryotic expression vector, carrying out inducible expression via IPTG, carrying out denaturation and renaturation folding on an expressed inclusion body, then filtering the inclusion body via a gel, and carrying out separation and purification on the inclusion body by ion exchange chromatography so as to obtain the anti-HIV aedes albopictus protein. The anti-HIV aedes albopictus protein has the activities of inhibiting the proliferation of the HIV in cells and the platelet aggregation induced by multiple agonists, and has the advantages of no cytotoxicity and strong anti-HIV specificity. Thus, the anti-HIV aedes albopictus protein can be used for preparing medicines for resisting AIDS (Acquired Immune Deficiency Syndrome) and related diseases.
Owner:SOUTHERN MEDICAL UNIVERSITY

Anti-mosquito finishing process of textile fabric

The invention discloses an anti-mosquito finishing process of a textile fabric. The textile fabric is cotton, tencel, modal, blended cotton (viscose cotton, polyester cotton, polyamide cotton), silk, a wool cotton dyed fabric, a thin chemical fiber fabric, a pair of socks, a mosquito net and the like. The process comprises the steps of: selecting a mosquito repellent and a low-temperature fixative, carrying out nano microencapsulation on the mosquito repellent by utilizing a microencapsulation technology, carrying out anti-mosquito finishing on a textile fabric to form an anti-mosquito emulsion through the low-temperature fixative, dehydrating and curing to finally obtain the anti-mosquito finished fabric. The anti-mosquito fabric fabricated by the anti-mosquito finishing process has a fast mosquito killing function, a repelling rate of the anti-mosquito finishing process on aedes albopicus, culex pipiens pallens and the like is higher than 90 percent and an anti-biting rate of the anti-mosquito finishing process is 100 percent; the anti-mosquito fabric does not have bad influence on physical indices such as appearance, strength, moisture absorbing property and the like of the fabric; the anti-mosquito fabric has a good anti-mosquito effect after being washed 15 times; and the anti-mosquito finished fabric does not stimulate or cause allergy to skin, is safe and non-toxic to ahuman body, and is comfortable to wear.
Owner:FUJIAN ZHONGHE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products