35results about How to "Identification achieved" patented technology

The invention discloses a molecular identification method for a DNA bar code of lumbricus and a CO I sequence thereof. The method comprises the following steps: amplifying a sample CO I gene through polymerase chain reaction (PCR); verifying the PCR product through agarose gel and then sending to a biological sequencing company for sequencing; manually correcting and splicing sequence for the sequencing result; comparing with a public sequence; and if the homology of the gene sequence SEQ ID NO.1-NO.4 is above 99%, confirming a to-be-detected tissue as a source of pheretima aspergillum or Shanghai lumbricus. According to the invention, a reliable DNA molecular identification technique is adopted; the morphological identification for lumbricus varieties is not required; the lumbricus varieties and non-drug lumbricus varieties specified in Chinese Pharmacopoeia can be quickly and accurately identified; besides, the pheretima aspergillum and the Shanghai lumbricus can be further distinguished; the accuracy and the reliability can be enhanced; the safety of the lumbricus used as a medicinal material can be guaranteed.

The invention relates to a DNA (deoxyribonucleic acid) sequence tag for identifying the sex difference of fenneropenaeus chinensis and an application thereof. High-throughput sequencing is carried out on mixing pools of DNA of female individuals and male individuals respectively by a high-throughput sequencing means, bioinformatics analysis is carried out on the sequencing results to screen DNA sequence fragments with significant difference in the female and male mixing pools, the obtained differential fragments are verified in the female and male individuals from different sources, finally a DNA sequence tag which can be used for identifying the sex of fenneropenaeus chinensis is obtained, and accurate identification of the genetic sex of fenneropenaeus chinensis can be achieved by utilizing the DNA sequence tag. The method has the characteristics of high efficiency, accuracy and reliability and has an extensive application prospect in fenneropenaeus chinensis sex identification, sex determination and differentiation mechanisms and sex control studies.

The invention discloses a method for extracting a common traditional Chinese medicine from traditional Chinese medicinal materials and authenticating the common traditional Chinese medicine through MALDI-TOF-MS, and belongs to the technical field of biology. According to the method, the traditional Chinese medicinal materials are smashed at high speed, total protein and polypeptide are extracted from the traditional Chinese medicinal materials, dialysis desalination is conducted, then the MALDI-TOF-MS is adopted for detection, and a traditional Chinese medicinal material protein map is obtained. The simple protein extracting technology and Malditof are combined for authenticating the protein maps of the common traditional Chinese medicinal materials such as astragalus membranaceus, ginseng and liquorice. The method has the advantages of being easy and reliable to implement, and provides selections and references for authenticating the common traditional Chinese medicinal materials.

The invention discloses a method for qualitatively detecting adulteration grease in vegetable oil by utilizing stoichiometry. The method comprises the following steps: acquiring gas chromatographic data, and distinguishing the type of adulterated grease in the vegetable oil by utilizing judgment analysis and clustering analysis. According to the method, thirteen judgment analysis models are established, the steps for comparing with the standard vegetable oil map and comparing the content of fatty acid are omitted when a to-be-detected sample is detected, and the ratio of fatty acid is directly substituted to distinguish the type of the adulterated grease, so that the palm oil, colza oil, cotton seed oil, soybean oil, tea seed oil and peanut oil adulterated in rice bran oil can be distinguished, and the detection accuracy is more than 96 percent. More than 9 percent of adulterated palm oil, more than 2 percent of adulterated colza oil, more than 5 percent of adulterated cotton seed oil and more than 16 percent of soybean oil in the rice bran oil can be distinguished through the clustering analysis of the palm oil, colza oil, cotton seed oil and soybean oil adulterated in rice bran oil.

The invention relates to molecular biological techniques, specifically to a method for identifying new generations breeding prawn varieties. The method comprises the following steps: amplifying and sequencing a mitochondria control zone of colonies to be identified by using primers in the mitochondria control zone; amplifying the haplotype colonies to be identified and according with generations breeding colonies in the sequenced mitochondria control zone by using five pairs of microsatellite sites and performing microsatellite parting to the amplified products; after that, distinguishing and analyzing according to microsatellite parting data to further obtain new generations breeding prawn varieties. The method identifies through molecular markers so as to overcome the difficulty that phenotypic characteristics identify new generations breeding varieties difficultly, finishes detection when prawn individual is small and is not influenced by development stage and size of the prawn individual so as to improve accuracy for identification; the identifying method can identify the new generations breeding prawn varieties.

The invention provides a method and system for identifying a Chinese population epithelial cell body fluid spot tissue source from the gene level. The method comprises the steps of utilizing a first PCR amplification primer set for performing first amplification on body fluid spot DNA, and obtaining a first amplification PCR product, wherein the first PCR amplification primer set is composed of nine pairs of amplification primers corresponding to nine genes of CYP2B7P1, MUC4, L.cri, HTN3, STATH, MUC7, LCE2B, DCD and CCL27 one to one; according to the gene expression condition in the first amplification PCR product, whether or not at least one of vaginal secretion, saliva and skin is contained in body fluid spots is judged. According to the scheme, the Chinese population body fluid tissue source can be effectively determined from the gene level, the step for identifying the body fluid or spot tissue source thereof at a criminal investigation site is greatly simplified, and the accuratescientific basis can be supplied to case character clearing, conviction and sentencing.

The invention discloses a primer pair and a kit for identification or assisted identification of stored bean weevils. The primer pair disclosed by the invention is composed of the following five primer pairs: a primer pair 1 (a sequence 1 and a sequence 2), a primer pair 2 (a sequence 3 and a sequence 4), a primer pair 3 (a sequence 5 and a sequence 6), a primer pair 4 (a sequence 7 and a sequence 8) and a primer pair 5 (a sequence 9 and a sequence 10). Used for identification of species of the stored bean, the kit is not affected by the individual development status of a sample and the integrity of the sample, and has the advantages of being time-saving, high-efficient and accurate; and the primer pair and the kit can be widely applied to the food storage departments and quarantine departments.

The invention discloses a method for identifying plant lactobacillus, which relates to an identifying method. The method solves the problems that the existing method for identifying the plant lactobacillus has long period and high cost. The method comprises the following steps: 1, performing PCR amplification by using a primer containing 22 basic groups; and 2, performing electrophoresis detection so as to realize identification of the plant lactobacillus. The identifying method of the invention has short period, and finishes the identification by only about 2 hours; and compared with the existing identifying method, the identifying method of the invention can identify the plant lactobacillus without special complex instruments and data processing, and has low identifying cost.

The invention provides a method for identifying reality and purity of pepper male sterile three-line mating hybrids based on InDel (insertion-deletion) molecular markers. The method includes the steps: culturing the pepper hybrids and parents to a bud and seedling stage; extracting DNA (deoxyribonucleic acid); screening the hybrids and the parents by core primers. Primers of co-dominant markers can serve as molecular markers for identifying the reality of the hybrids, and co-dominant markers of the pepper hybrids and the parents continues to be screened by combining a secondary core primer library until the co-dominant markers are screened out if the co-dominant markers of the pepper hybrids and the parents cannot be screened out in a core primer library. According to the method, a systemcapable of rapidly and simultaneously identifying the reality and the purity of the pepper male sterile three-line mating hybrids is built and cannot be limited by time and seasons, indoor rapid identification of the reality and the purity of the hybrids is achieved, and molecular biology bases are provided for protection and market supervision of the pepper male sterile three-line mating hybrids.

The invention discloses a testing device for identifying sealing performance of a nonmetal sealing member and a method thereof. The testing device comprises a device body which is internally providedwith a chamber with an opening in bottom of the device body. The bottom of the device body is provided with a bottom cover which is closely connected with the device body. The chamber is internally provided with a filling member with a gap to the inner wall of the device body. The gap between the inner wall of the device body and the sidewall of the filling member is provided with a to-be-tested nonmetal sealing member. The top of the device body is provided with a liquid injection inlet which is communicated with the chamber. The bottom cover is provided with a detecting hole for detecting whether leakage occurs. The testing device further comprises the components of a plurality of pressurizing pipes for introducing gas, a depressurizing pipe, a heating device, a temperature measuring device and a pressure measuring device. The testing device and the method thereof satisfy a requirement for a device test according to an ISO 10423:2009 appendix F.1.13.5.3 standard and furthermore can be applied to device tests of a petroleum equipment well head and a production tree.

The invention belongs to the technical field of traditional Chinese medicine detection, and particularly provides a method for simultaneously identifying components of rhizoma coptidis and cortex phellodendri, which comprises the following steps: (1) preparing a test solution, a reference solution and a reference medicinal material solution; (2) thin layer chromatography detection: carrying out two-time expansion and respective inspection, wherein butyl acetate-methanol-isopropanol-water is adopted as a developing solvent for first-time developing, n-butanol-water-acetic acid is adopted as a developing solvent for second-time developing, a'secondary thin-layer developing method ' is utilized for the first time, the developing solvent with specific composition is adopted, the same thin-layer plate is adopted, and second-time sample application is not needed; the method can be used for simultaneously and qualitatively identifying the components of rhizoma coptidis and cortex phellodendri, avoids the increase of resources and cost caused by independently and qualitatively identifying the components of rhizoma coptidis and cortex phellodendri, ensures the uniformity, stability and reliability of quality, and has the advantages of high accuracy, time and cost saving and easiness in popularization and application.

A detection kit of group B streptococcus rapid serological typing and a preparation method thereof relate to microbiological detection. The detection kit of group B streptococcus rapid serological typing is provided with a kit body and test paper arranged in the kit body. The test paper is provided with a bottom lining, a sample pad, a marking pad, a coating film, and filter paper, wherein the sample pad, the marking pad, the coating film, and the filter paper are successively connected from the left to the right and are arranged on the bottom lining. The method comprises 1) preprocessing fluorescent particles; 2) activating fluorescent microspheres; 3) combining group B streptococcal antibodies; 4) preparing the marking pad; 5) preparing coating antibodies; and 6) assembling strips. The kit and the method are convenient and fast. When the kit and the method are applied to sample detection, people only needs to wait 10 to 15 minutes after the sample is added and then a detection resultcan be acquired. Operation is simple. The kit and the method can be used for group B streptococcus pure bacteria colonies of clinical culture identification, an enriched culture solution and detection and typing of secretion specimens for clinical routine sampling.

The process of identifying the co-epiphytic dominant bacteria composition and the specific host bacteria of sponge includes the following steps: preparing co-epiphytic microbe macro genome total DNA sample via grinding sponge, treating with lysozyme and proteinase K to release DNA, and phenol-chloroform treatment; PCR amplification with the sample as template and general bacterial primer to obtain 16S rDNA segment smaller than 500 bp; denaturing gradient gel electrophoresis to separate mixed segment and obtain 16S rDNA-DGGE gene fingerprint; recovering DNA bands, secondary PCR amplification, denaturing gradient gel electrophoresis, purification, cloning and sequencing to complete homology and system development analysis; analyzing bands in the DGGE fingerprint to complete the molecular identification of the co-epiphytic dominant bacteria composition; and finding out the differential bands in the DGGE fingerprint to complete the molecular identification of specific host bacteria.

The invention belongs to the field of insect biology, and particularly relates to a method for rapidly identifying enpyrene spermatozoon and spermatogenia in a silkworm testis. The method comprises the following steps of: putting the silkworm testis obtained by dissecting into a TC-100 complete culture medium to remove tissues adhered to the surface of the testis, tearing off the silkworm testis,smearing, fixing and dyeing a sample containing the enpyrene spermatozoon and spermatogenia, and observing the sample under a fluorescence microscope. According to the method, the complete contours ofthe enpyrene spermatozoon and spermatogenia can be effectively maintained in the operation process, and identification of the enpyrene spermatozoon and spermatogenia can be achieved through photographing observation under fluorescence microscopy.

The invention relates to an edible sea cucumber species identification method based on a DNA mini-barcode technology. According to the method, PCR amplification is performed through sea cucumber genome DNA extraction by use of a DNA mini-barcode primer, a PCR product with the length of 257 bp is obtained, wherein the DNA mini-barcode primer is MiniCOI-F:CATGGCTTTCCCTCGAATGAA; MiniCOI-R:TAACTCCTGGGGTTCGCATCT. Finally, DNA mini-barcode fragment sequences obtained through sequencing are compared in the NCBI (National Center for Biotechnology Information), and strain identification is performed according to matching similarity of the sequences. The method is simple and convenient to operate and high in accuracy and can identify processed commercial sea cucumbers with disappeared morphologicalfeatures, and a technical support is provided for maintaining benefits of enterprises and consumers and normal market orders.

The invention provides a block chain-based data processing and authentication report issuing method and system. The method comprises the steps: obtaining electronic data sent by a user based on an electronic data storage platform; verifying the integrity, compliance and consistency of the electronic data; if the integrity, compliance and consistency of the electronic data pass verification, obtaining corresponding key data from the electronic data according to retrieval keyword information input by judicial expertise personnel, and / or performing skin color processing on skin color inspection materials contained in the electronic data through a skin color percentage algorithm to obtain media information, wherein the media information comprises picture information and video information; storing an authentication record uploaded by the judicial expertise personnel in real time, wherein the authentication record is obtained by the judicial expertise personnel by utilizing the key data and / or the video information to perform judicial expertise; and generating an authentication report based on the authentication record so as to enable a judicial expertise center manager to check the authentication report. According to the invention, judicial expertise can be carried out on electronic data on line.

The invention discloses a DNA (deoxyribonucleic acid) bar code. The nucleotide sequence of the DNA bar code is as shown in SEQ ID NO.1. According to the DNA bar code, an ITS sequence of a muscadine isfirstly disclosed, available molecular markers are provided for species identification of the muscadine, and the DNA bar code further comprises parts of conserved sequences and has universality whenbeing used for species identification of grapes. The invention discloses a method and a primer for preparing the nucleotide sequence of the DNA bar code and can acquire sequences of an ITS area of themuscadine. The invention further discloses a molecular identification method of the muscadine and a detection primer and a kit for identifying the muscadine. PCR (polymerase chain reaction) amplification is performed by the aid of the detection primer or the kit to obtain sequences of ITS areas of the grapes, an amplification sequence and the sequence of the DNA bar code of the muscadine are compared or applied to construction of phylogenetic trees of the grapes, so that grape varieties are accurately identified, and identifying processes are simple to operate, high in efficiency and good inrepeatability.

The process of identifying the co-epiphytic dominant bacteria composition and the specific host bacteria of sponge includes the following steps: preparing co-epiphytic microbe macro genome total DNA sample via grinding sponge, treating with lysozyme and proteinase K to release DNA, and phenol-chloroform treatment; PCR amplification with the sample as template and general bacterial primer to obtain 16S rDNA segment smaller than 500 bp; denaturing gradient gel electrophoresis to separate mixed segment and obtain 16S rDNA-DGGE gene fingerprint; recovering DNA bands, secondary PCR amplification, denaturing gradient gel electrophoresis, purification, cloning and sequencing to complete homology and system development analysis; analyzing bands in the DGGE fingerprint to complete the molecular identification of the co-epiphytic dominant bacteria composition; and finding out the differential bands in the DGGE fingerprint to complete the molecular identification of specific host bacteria.

The invention relates to a method for identifying species of edible sea cucumbers based on DNA micro-barcodes. The method extracts sea cucumber genomic DNA, and then uses DNA micro-barcode primers for PCR amplification to obtain a PCR product with a length of 257 bp. The DNA micro-barcode primers are MiniCOI‑F: CATGGCTTTCCCTCGAATGAA; MiniCOI‑R: TAACTCCTGGGGTTCGCATCT. Finally, the sequences of the DNA microbarcode fragments obtained by sequencing were compared at the National Center for Biotechnology Information (NCBI), and species identification was carried out according to the matching similarity of the sequences. The method is easy to operate and has high accuracy. It can identify commercially available sea cucumbers that have been processed and whose morphological characteristics have disappeared, and provides technical support for maintaining the interests of enterprises and consumers as well as normal market order.

The invention provides a method and a system for identifying a histologic origin of body fluids of Chinese population from gene level. The method comprises the following step: detecting the expression status of seven genes: GYPA, SPTB, MMP-7, STATH, MUC4, PRM2 and TGM4 in body fluids, wherein the body fluids comprise one or more of peripheral blood, menstrual blood, saliva, vaginal secretion and seminal fluid. The invention further provides the system for identifying the histologic origin of body fluids of Chinese population from gene level. According to the scheme provided by the invention, the histologic origin of body fluids of Chinese population can be effectively determined from the gene level, so that steps of identifying the histologic origin of body fluids in criminal investigation fields or spots thereof are greatly simplified, and an accurate scientific basis is provided for defining case property, determining criminal suspects, convicting and sentencing and the like.

The invention discloses a DNA barcode, the nucleotide sequence of which is shown in SEQ ID NO.1. The DNA barcode disclosed the ITS sequence of Muscadine grape for the first time, which provided an effective molecular marker for the species identification of Muscadine grape. In addition, the DNA barcode also included some conserved sequences, which is universal when applied to the species identification of grapevine. The invention discloses a method for preparing the nucleotide sequence of the DNA barcode and primers, which can be used to obtain the sequence of the ITS region of muscadine grapes. The invention also discloses a molecular identification method of muscadine grapes, detection primers and a kit for identifying muscadine grapes, using the detection primers or kits to carry out PCR amplification to obtain the sequence of the grape ITS2 region, and then combining the amplified sequence with the muscadine The DNA barcode sequences of grapes are compared or applied to construct a phylogenetic tree of grapes to achieve accurate identification of grape varieties, and the identification process is simple, efficient and repeatable.

The invention relates to a DNA (deoxyribonucleic acid) sequence tag for identifying the sex difference of fenneropenaeus chinensis and an application thereof. High-throughput sequencing is carried out on mixing pools of DNA of female individuals and male individuals respectively by a high-throughput sequencing means, bioinformatics analysis is carried out on the sequencing results to screen DNA sequence fragments with significant difference in the female and male mixing pools, the obtained differential fragments are verified in the female and male individuals from different sources, finally a DNA sequence tag which can be used for identifying the sex of fenneropenaeus chinensis is obtained, and accurate identification of the genetic sex of fenneropenaeus chinensis can be achieved by utilizing the DNA sequence tag. The method has the characteristics of high efficiency, accuracy and reliability and has an extensive application prospect in fenneropenaeus chinensis sex identification, sex determination and differentiation mechanisms and sex control studies.

The invention discloses a method for identifying drought tolerance of a tea tree. The method comprises the following steps of picking young sprouts with leaves; clipping the young sprouts according to a principle that one tree bud is provided with two leaves, spreading and airing the tree buds on a glass dish, putting in a withering room for naturally withering indoors, weighing once every one hour, and taking out when the weight-loss ratio of the tree buds reach to 20 to 50 percent; sticking the withered tree buds on a floating plate, putting the floating plate in water, enabling the lower end of the floating plate to immerse in water and the leaves above water, and rewatering; when the weight gain rate of the tree buds reach to 23 percent to 60 percent, wiping water, putting the rewatered tree buds into a drying oven for drying, and recording the weight after drying; identifying the drought tolerance of the tea tree; utilizing a plant relative water content formula for calculating the relative water content of each tree bud, if the relative water content result is larger than or equal to 57 percent, identifying the tree bud as the tree bud of the tea tree with drought tolerance, and otherwise, identifying the tree bud as the tree bud of the tea tree with drought sensitivity.

The invention provides a method for identifying reality and purity of pepper male sterile three-line mating hybrids based on InDel (insertion-deletion) molecular markers. The method includes the steps: culturing the pepper hybrids and parents to a bud and seedling stage; extracting DNA (deoxyribonucleic acid); screening the hybrids and the parents by core primers. Primers of co-dominant markers can serve as molecular markers for identifying the reality of the hybrids, and co-dominant markers of the pepper hybrids and the parents continues to be screened by combining a secondary core primer library until the co-dominant markers are screened out if the co-dominant markers of the pepper hybrids and the parents cannot be screened out in a core primer library. According to the method, a systemcapable of rapidly and simultaneously identifying the reality and the purity of the pepper male sterile three-line mating hybrids is built and cannot be limited by time and seasons, indoor rapid identification of the reality and the purity of the hybrids is achieved, and molecular biology bases are provided for protection and market supervision of the pepper male sterile three-line mating hybrids.

The invention provides a preparation method and application of a silicon carbide@BSA-antimicrobial peptide nanoprobe, which belongs to the technical field of forensic detection methods. The preparation method based on silicon carbide@BSA-antimicrobial peptide nanoprobe comprises the following steps: (1) preparation of silicon carbide@BSA nanometer; (2) silicon carbide@BSA-antimicrobial peptide nanoprobe-antimicrobial peptide preparation. The silicon carbide@BSA-antimicrobial peptide nanoprobe in the detection of oral bacteria and its application method in forensic saliva identification includes: S1: detection of oral bacteria in standard solution; S2: detection of oral bacteria in saliva samples; S3: Identification of forensic saliva samples. The fluorescence sensor based on the silicon carbide@BSA-antimicrobial peptide nanoprobe of the present invention has excellent analytical performance such as high sensitivity, wide linear range, and low cost, and has good practical prospects in the fields of forensic microbial detection and forensic saliva identification and detection.

The invention discloses a method for qualitatively detecting adulteration grease in vegetable oil by utilizing stoichiometry. The method comprises the following steps: acquiring gas chromatographic data, and distinguishing the type of adulterated grease in the vegetable oil by utilizing judgment analysis and clustering analysis. According to the method, thirteen judgment analysis models are established, the steps for comparing with the standard vegetable oil map and comparing the content of fatty acid are omitted when a to-be-detected sample is detected, and the ratio of fatty acid is directly substituted to distinguish the type of the adulterated grease, so that the palm oil, colza oil, cotton seed oil, soybean oil, tea seed oil and peanut oil adulterated in rice bran oil can be distinguished, and the detection accuracy is more than 96 percent. More than 9 percent of adulterated palm oil, more than 2 percent of adulterated colza oil, more than 5 percent of adulterated cotton seed oil and more than 16 percent of soybean oil in the rice bran oil can be distinguished through the clustering analysis of the palm oil, colza oil, cotton seed oil and soybean oil adulterated in rice bran oil.

The invention relates to an identification method of poultry breeds, and particularly relates to an identification method of the Minqing Maojiao Chicken breed. On the basis of obtaining a group of specific genetic loci of the Minqing Maojiao Chicken through screening, the obtained genetic loci are further subjected to optimizing and screening, the specific loci with high identification rate of Minqing Maojiao Chicken are obtained through screening, and the specific loci obtained through screening can be used for combined identification, so that the accuracy is higher, and the obtained result is more reliable.

The invention relates to the technical field of poultry genetic resources and biology, in particular to a method and primer combination for effectively identifying Luyuan chicken breeds. According to the invention, a group of Luyuan chicken specific genetic loci are obtained by screening and include SNPs loci and INDELs loci. The specific genetic loci are distributed on different chromosomes and are used as identification loci, so that the accuracy and flexibility of a detection test are improved. Secondly, the INDELs loci capable of being effectively used for identifying the Luyuan chicken breeds are obtained by screening for the first time. The identification rate of the genetic specific loci obtained by screening on Luyuan chickens is 80% or above. The identification method provided by the invention can more effectively realize the identification of the Luyuan chickens and is high in practicability; and the method, the primer combination and a kit can be widely popularized and applied, and have important significance for identification and protection of the Luyuan chickens.