Method for rapidly discriminating species of cotton
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A cotton and cotton seed technology, applied in the field of molecular biology, to achieve the effect of simplifying the identification process
Inactive Publication Date: 2013-12-25
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF1 Cites 10 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0005] The limitations of barcodes in universality
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1 20
[0024] The acquisition of the DNA bar code of twenty known cotton species of embodiment 1
[0025] 1 Materials and methods
[0026] 1.1 Experimental materials
[0027] The experimental materials are the leaves of 20 known cotton species, numbered 1-20 respectively, from the Cotton Research Institute of the Chinese Academy of Agricultural Sciences, as shown in the table below:
[0028]
[0029] 1.2 Extraction of total DNA
[0030] The total DNA of 20 cotton species was extracted by CTAB method. Purified DNA was tested for its purity and concentration by UV spectrophotometer, and its quality was tested by 1% agarose gel electrophoresis. The DNA concentration was diluted to about 60ng / μl, and stored in a 4°C refrigerator for use as a working solution.
[0031] 1.3PCR amplification
[0032] Design landing PCR and use universal primers for amplification: the universal primer pair includes TL and HA. For trnT-trnL, the nucleotide sequence of the upstream primer TLF is: CGATG...
Embodiment 2
[0044] Example 2 DNA barcode identification technology of unknown cotton species
[0045] 1 Materials and methods
[0046] 1.1 Experimental materials
[0047] The experimental materials are the leaves of nine different cotton species, numbered 1-9 respectively, from the Cotton Research Institute of the Chinese Academy of Agricultural Sciences.
[0048] 1.2 Extraction of total DNA
[0049] The total DNA of nine cotton species was extracted by CTAB method. Purified DNA was tested for its purity and concentration by UV spectrophotometer, and its quality was tested by 1% agarose gel electrophoresis. The DNA concentration was diluted to about 60ng / μl, and stored in a 4°C refrigerator for use as a working solution.
[0050] 1.3PCR amplification
[0051] Design landing PCR and use universal primers for amplification: the universal primer pair includes TL and HA. For trnT-trnL, the nucleotide sequence of the upstream primer TLF is: CGATGACCATCGCATTACAAAT, and the nucleotide seque...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention relates to the molecular biology field, and concretely relates to a cotton species DNA barcode and a method for rapidly and accurately identifying the species of cotton. The method comprises the following steps: sampling, carrying out total DNA extraction, carrying out PCR amplification, cloning, sequencing, and carrying out sequence alignment. In the invention, cotton chloroplast genome specific primer pair total DNA is adopted to carry out specific amplification of trnT-trnL and trnH-psbA sequences, so convenience, fastness, no individual extraction of chloroplast DNA are realized; a combination of the trnT-trnL and trnH-psbA sequences adopted as the cotton species DNA barcode has a moderate length, has a high cotton species identification capacity, and can rapidly identifies the cotton species. The method does not rely on traditional identification classification experiences, and has the advantages of simple operation and high accuracy.
Description
technical field [0001] The invention relates to the field of molecular biology, in particular to a cotton genus DNA bar code and a method for rapidly identifying cotton genus species. Background technique [0002] With the prominence of global environment, climate and energy issues, understanding biodiversity is an urgent need for sustainable development strategies, and the basis for biodiversity conservation and utilization is the rapid and accurate identification of species. DNA barcoding technology (DNA barcoding) also emerged at the historic moment. Paul Hebert (2003) first proposed DNA barcode, pointing out that DNA barcoding technology uses standard, sufficiently variable, easy-to-amplify and relatively short DNA fragments based on their physical properties. A new species classification and identification system was created based on the diversity among species and specificity within species, which can quickly identify species. Due to the strong conservation of chlorop...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more