Method for rapidly discriminating species of cotton

A cotton and cotton seed technology, applied in the field of molecular biology, to achieve the effect of simplifying the identification process

Inactive Publication Date: 2013-12-25
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The limitations of barcodes in universality led us to search for suitable DNA barcodes in cotton

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly discriminating species of cotton
  • Method for rapidly discriminating species of cotton
  • Method for rapidly discriminating species of cotton

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 20

[0024] The acquisition of the DNA bar code of twenty known cotton species of embodiment 1

[0025] 1 Materials and methods

[0026] 1.1 Experimental materials

[0027] The experimental materials are the leaves of 20 known cotton species, numbered 1-20 respectively, from the Cotton Research Institute of the Chinese Academy of Agricultural Sciences, as shown in the table below:

[0028]

[0029] 1.2 Extraction of total DNA

[0030] The total DNA of 20 cotton species was extracted by CTAB method. Purified DNA was tested for its purity and concentration by UV spectrophotometer, and its quality was tested by 1% agarose gel electrophoresis. The DNA concentration was diluted to about 60ng / μl, and stored in a 4°C refrigerator for use as a working solution.

[0031] 1.3PCR amplification

[0032] Design landing PCR and use universal primers for amplification: the universal primer pair includes TL and HA. For trnT-trnL, the nucleotide sequence of the upstream primer TLF is: CGATG...

Embodiment 2

[0044] Example 2 DNA barcode identification technology of unknown cotton species

[0045] 1 Materials and methods

[0046] 1.1 Experimental materials

[0047] The experimental materials are the leaves of nine different cotton species, numbered 1-9 respectively, from the Cotton Research Institute of the Chinese Academy of Agricultural Sciences.

[0048] 1.2 Extraction of total DNA

[0049] The total DNA of nine cotton species was extracted by CTAB method. Purified DNA was tested for its purity and concentration by UV spectrophotometer, and its quality was tested by 1% agarose gel electrophoresis. The DNA concentration was diluted to about 60ng / μl, and stored in a 4°C refrigerator for use as a working solution.

[0050] 1.3PCR amplification

[0051] Design landing PCR and use universal primers for amplification: the universal primer pair includes TL and HA. For trnT-trnL, the nucleotide sequence of the upstream primer TLF is: CGATGACCATCGCATTACAAAT, and the nucleotide seque...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the molecular biology field, and concretely relates to a cotton species DNA barcode and a method for rapidly and accurately identifying the species of cotton. The method comprises the following steps: sampling, carrying out total DNA extraction, carrying out PCR amplification, cloning, sequencing, and carrying out sequence alignment. In the invention, cotton chloroplast genome specific primer pair total DNA is adopted to carry out specific amplification of trnT-trnL and trnH-psbA sequences, so convenience, fastness, no individual extraction of chloroplast DNA are realized; a combination of the trnT-trnL and trnH-psbA sequences adopted as the cotton species DNA barcode has a moderate length, has a high cotton species identification capacity, and can rapidly identifies the cotton species. The method does not rely on traditional identification classification experiences, and has the advantages of simple operation and high accuracy.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a cotton genus DNA bar code and a method for rapidly identifying cotton genus species. Background technique [0002] With the prominence of global environment, climate and energy issues, understanding biodiversity is an urgent need for sustainable development strategies, and the basis for biodiversity conservation and utilization is the rapid and accurate identification of species. DNA barcoding technology (DNA barcoding) also emerged at the historic moment. Paul Hebert (2003) first proposed DNA barcode, pointing out that DNA barcoding technology uses standard, sufficiently variable, easy-to-amplify and relatively short DNA fragments based on their physical properties. A new species classification and identification system was created based on the diversity among species and specificity within species, which can quickly identify species. Due to the strong conservation of chlorop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68
Inventor冯坤王坤波刘方华金平周忠丽王春英王玉红蔡小彦王星星尚明照
OwnerINST OF COTTON RES CHINESE ACAD OF AGRI SCI