Method using CRISPR-Cas9 to specifically knock off pig PDX1 gene and sgRNA of PDX1 gene for specific targeting
A specific and gene technology, applied in the field of genetic engineering and gene knockout, to achieve the effect of high solution cost and long solution cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Example 1, Selection and design of Susscrofa (pig) PDX1 gene sgRNA target sequence
[0067] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.
[0068] 1. Selection of sgRNA target sequence for PDX1 gene
[0069] For the PDX1 gene, the following principles should be followed in the selection of target sequences:
[0070] (1) Find the target sequence conforming to the 5'-N(20)NGG-3' rule in the exon coding region of the PDX1 gene, where N(20) represents 20 consecutive bases, and each N represents A or T Or C or G, the target sequence that meets the above rules is located on the sense strand or the antisense strand;
[0071] (2) Select the first exon coding region sequence near the N-terminus, the target sequence can be located in the first exon coding re...
Embodiment 2
[0086] Example 2: Construction of sgRNA expression vector for PDX1 gene
[0087] 1. Synthesis of DNA Inserts
[0088] (1) Synthesize the forward and reverse oligonucleotide sequences designed above
[0089] The oligonucleotide sequence can be specifically synthesized by a commercial company (such as Invitrogen) according to the provided sequence. In this example and the following examples, the effect of the target sequences listed in the No. 3 and No. 10 sequences listed in Table 1 on the knockout effect of the PDX1 gene was studied.
[0090] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 3 target sequence are as follows:
[0091] CACCGCCCCCTGCGTGCCTGTACAT (SEQ ID NO: 22);
[0092] AAACATGTACAGGCACGCAGGGGGC (SEQ ID NO: 23).
[0093] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 10 target sequence are as follows:
[0094] CACCGGCCCATGTACAGGCACGCAG (SEQ ID NO: 24);
[0095] AAACC...
Embodiment 3
[0131] Example 3. Obtaining a pseudotyped lentivirus expressing PDX1sgRNA
[0132] 1. Material preparation
[0133] Amplify and extract packaging plasmids pLP1, pLP2, and pLP / VSVG (purchased from Invitrogen, whose maps are shown in figure 2 , image 3 and Figure 4 shown); amplify and extract vector plasmid lentiCRISPRv2-PDX1; culture packaging cell line HEK293T cells (purchased from ATCC); DMEM medium, Opti-MEM medium and fetal bovine serum FBS (purchased from Gibco); Lipofectamine2000 (purchased from from Invitrogen); HEK293T cells were cultured in 5% CO 2 In the culture environment of 37°C, the culture medium is DMEM medium containing 10% FBS.
[0134] 2. Transfection and Viral Packaging
[0135] Day 1: Passage the packaging cell line HEK293T to 10cmdish, about 30% confluence;
[0136] The next day: when HEK293T reaches 80% confluence, transfect according to the following recipe:
[0137] Prepare Mixture 1, containing:
[0138] lentiCRISPRv2-PDX1: 6 μg
[0139] pL...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 