SNP (Single Nucleotide Polymorphism) marker for influencing content of IMP or GMP (Good Manufacturing Practice) of

By identifying SNP markers of pig IMP or GMP content through GWAS and conducting molecular marker-assisted breeding, and using CRISPR/Cas9 gene editing, the problem of low IMP or GMP content in pork was solved, achieving improved meat quality and accelerated breeding progress.

CN120796514AActive Publication Date: 2025-10-17JIANGXI AGRICULTURAL UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511333409.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-18
Publication Date
2025-10-17
Estimated Expiration
2045-09-18

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively increase the content of inosinic acid (IMP) and guanylic acid (GMP) in pork, which affects the flavor quality of meat and breeding progress.

Method used

Through genome-wide association analysis (GWAS), 15 SNP markers affecting the IMP or GMP content of pigs were identified. Combined with primer combinations and kits, molecular marker-assisted breeding was carried out to increase the frequency of dominant alleles generation by generation, and CRISPR/Cas9 was used for gene editing to optimize the IMP or GMP content of pigs.

Benefits of technology

It can quickly and accurately increase the IMP or GMP content of pigs, improve meat quality and breeding efficiency, and increase the economic benefits of pig genetic improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796514A_ABST
    Figure CN120796514A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular markers and animal genetic breeding, in particular to an SNP (Single Nucleotide Polymorphism) marker capable of influencing the content of IMP or GMP (Good Manufacturing Practice) of pigs and application of the SNP marker. According to the invention, based on three test swinery of American-series purebred landrace, American-series purebred large white pig and American-series purebred Duroc, pig whole genome re-sequencing and GWAS analysis are adopted, 15 SNP markers related to the content of IMP or GMP are researched and determined, and by optimizing the dominant alleles of the SNP, the frequency of the dominant alleles can be increased generation by generation, the content of IMP or GMP can be increased, and the number of SNP markers related to the content of IMP or GMP can be increased. The pig genetic improvement progress is accelerated, so that the economic benefit of breeding pig breeding is effectively improved.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular markers and animal genetic breeding, and particularly relates to a SNP marker affecting IMP or GMP content of pigs and application thereof. BACKGROUND

[0002] In the modern pig industry, pork flavor quality is one of the core elements determining its market competitiveness. Inosinic acid (IMP) and guanylic acid (GMP) are the core components of meat flavor, and their content directly affects the flavor quality of meat. IMP is one of the strongest known flavor nucleotides, which has a significant umami taste and can produce a strong synergistic effect with amino acids (such as glutamic acid), greatly enhancing the perception of umami taste, and is a key flavor indicator of high-quality pork. Although GMP has a low content in pork, it has a strong flavor ability, especially when combined with IMP and glutamic acid, it has a significant effect on enhancing umami taste. Breeding a breed with high IMP or GMP content can not only enhance the natural flavor of meat without the need for additional additives, but also improve consumer satisfaction and product market competitiveness. At the same time, the generation of IMP is related to energy metabolism, and its stability reflects the muscle maturity and meat quality retention ability to some extent. In summary, high levels of IMP or GMP are the flavor guarantee of high-quality pork, and have significant breeding application value.

[0003] As a genetic analysis method, genome-wide association study (GWAS) detects the statistical association between tens of thousands of single nucleotide polymorphism (SNP) markers and target traits by scanning the whole genome. At present, GWAS technology has made breakthroughs in the analysis of multiple economic traits of pigs, including meat quality traits, growth traits, and reproductive traits.

[0004] As the core indicators of pork flavor quality, IMP and GMP genetic improvement has become an important direction of pig molecular breeding. By identifying marker sites affecting IMP or GMP content through GWAS technology, direct conversion to breeding markers can be used for the breeding of high-quality pig breeds, including direct selection of major genes, precise application of causal mutations, and multi-gene breeding, which has important significance for the production and economic benefits of pig breeding industry. SUMMARY

[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present application is to provide a SNP marker affecting IMP or GMP content of pigs.

[0006] Another purpose of the present application is to provide the application of the above-mentioned SNP marker.

[0007] The purpose of the present application is achieved by the following technical solutions:

[0008] A SNP marker affecting the content of IMP or GMP of pig, comprising at least one of the following SNP markers:

[0009] (I) the SNP site corresponds to the G>A mutation at position 23634644 on chromosome 14 in the international pig genome 11.1 version;

[0010] (II) the SNP site corresponds to the G>A mutation at position 61539869 on chromosome 5 in the international pig genome 11.1 version;

[0011] (III) the SNP site corresponds to the C>T mutation at position 73318431 on chromosome 6 in the international pig genome 11.1 version;

[0012] (IV) the SNP site corresponds to the AT>A mutation at position 9931110 on chromosome 15 in the international pig genome 11.1 version;

[0013] (V) the SNP site corresponds to the A>G mutation at position 7924927 on chromosome 15 in the international pig genome 11.1 version;

[0014] (VI) the SNP site corresponds to the G>A mutation at position 73963573 on chromosome 7 in the international pig genome 11.1 version;

[0015] (VII) the SNP site corresponds to the T>C mutation at position 49824761 on chromosome 15 in the international pig genome 11.1 version;

[0016] (VIII) the SNP site corresponds to the T>C mutation at position 195476736 on chromosome 13 in the international pig genome 11.1 version;

[0017] (IX) the SNP site corresponds to the A>C mutation at position 122321344 on chromosome 8 in the international pig genome 11.1 version;

[0018] (X) the SNP site corresponds to the A>G mutation at position 122335895 on chromosome 8 in the international pig genome 11.1 version;

[0019] (XI) the SNP site corresponds to the C>T mutation at position 30422074 on chromosome 12 in the international pig genome 11.1 version;

[0020] (XII) the SNP site corresponds to the A>G mutation at position 30398438 on chromosome 12 in the international pig genome 11.1 version;

[0021] (XIII) The SNP site corresponds to the GTCACACACAC>G mutation at position 7723118 on chromosome 2 of the International Pig Genome 11.1 version;

[0022] (XIV) The SNP site corresponds to the A>T mutation at position 34106157 on chromosome 6 of the International Pig Genome 11.1 version;

[0023] (XV) The SNP site corresponds to the C>T mutation at position 79119746 on chromosome 7 of the International Pig Genome 11.1 version.

[0024] For (I), the nucleic acid sequence of the SNP marker is preferably as shown in SEQ ID NO: 1, wherein M in the sequence is G or A, and the SNP site is a nucleic acid single base mutation of G255-A255 at position 255 of SEQ ID NO: 1.

[0025] For (VIII), the nucleic acid sequence of the SNP marker is preferably as shown in SEQ ID NO: 2, wherein M in the sequence is T or C, and the SNP site is a nucleic acid single base mutation of T25-C25 at position 25 of SEQ ID NO: 2.

[0026] For (XI), the nucleic acid sequence of the SNP marker is preferably as shown in SEQ ID NO: 3, wherein M in the sequence is C or T, and the SNP site is a nucleic acid single base mutation of T262-C262 at position 262 of SEQ ID NO: 3.

[0027] In specific embodiments:

[0028] For (I)-(III), the pig is of American Landrace origin or a synthetic line thereof, and the corresponding trait is IMP content.

[0029] For (IV)-(V), the pig is of American Large White origin or a synthetic line thereof, and the corresponding trait is IMP content.

[0030] For (VI)-(VII), the pig is of American Duroc origin or a synthetic line thereof, and the corresponding trait is GMP content.

[0031] For (VIII)-(X), the pig is of American Landrace origin or a synthetic line thereof, and the corresponding trait is GMP content.

[0032] For (XI)-(XIV), the pig is of American Large White origin or a synthetic line thereof, and the corresponding trait is GMP content.

[0033] For (XV), the pig is of American Landrace, American Large White, American Duroc origin or a synthetic line thereof, and the corresponding trait is GMP content.

[0034] A primer combination for detecting the above-mentioned SNP marker, comprising at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, the nucleotide sequences of which are shown in SEQ ID NO: 4-9;

[0035] A kit for detecting the above-mentioned SNP marker, comprising the above-mentioned primer combination.

[0036] The SNP marker, primer combination or kit is used for identifying the IMP or GMP content or meat quality related traits of pigs or pork, screening pigs with high IMP or GMP content or excellent meat quality, or genetic breeding of IMP or GMP content or meat quality related traits of pigs.

[0037] A method for genetic improvement of pigs, comprising the following steps:

[0038] Determining the above-mentioned SNP marker of the breeding pigs in the breeding pig core group, and making a corresponding selection according to the SNP marker:

[0039] For (I), selecting a breeding pig individual with G / G genotype at position 23634644 on chromosome 14 in the international pig genome version 11.1 from the breeding pig core group, and eliminating a breeding pig individual with G / A genotype, so as to increase the frequency of allele G at the site generation by generation;

[0040] For (II), selecting a breeding pig individual with A / A or G / A genotype at position 61539869 on chromosome 5 in the international pig genome version 11.1 from the breeding pig core group, and eliminating a breeding pig individual with G / G genotype, so as to increase the frequency of allele A at the site generation by generation;

[0041] For (III), selecting a breeding pig individual with C / C or C / T genotype at position 73318431 on chromosome 6 in the international pig genome version 11.1 from the breeding pig core group, and eliminating a breeding pig individual with T / T genotype, so as to increase the frequency of allele C at the site generation by generation;

[0042] For (IV), selecting a breeding pig individual with AT / AT or AT / A genotype at position 9931110 on chromosome 15 in the international pig genome version 11.1 from the breeding pig core group, and eliminating a breeding pig individual with A / A genotype, so as to increase the frequency of allele AT at the site generation by generation;

[0043] For (V), selecting from the core group of breeding swine, breeding swine individuals that are A / A or A / G genotypes at position 7924927 on chromosome 15 of the International Pig Genome 11.1 version, and culling breeding swine individuals that are G / G genotypes, to increase the frequency of allele A at this locus from generation to generation;

[0044] For (VI), selecting from the core group of breeding swine, breeding swine individuals that are G / A or A / A genotypes at position 73963573 on chromosome 7 of the International Pig Genome 11.1 version, and culling breeding swine individuals that are G / G genotypes, to increase the frequency of allele A at this locus from generation to generation;

[0045] For (VII), selecting from the core group of breeding swine, breeding swine individuals that are T / T or T / C genotypes at position 49824761 on chromosome 15 of the International Pig Genome 11.1 version, and culling breeding swine individuals that are C / C genotypes, to increase the frequency of allele T at this locus from generation to generation;

[0046] For (VIII), selecting from the core group of breeding swine, breeding swine individuals that are T / T or T / C genotypes at position 195476736 on chromosome 13 of the International Pig Genome 11.1 version, and culling breeding swine individuals that are C / C genotypes, to increase the frequency of allele T at this locus from generation to generation;

[0047] For (IX), selecting from the core group of breeding swine, breeding swine individuals that are A / C or C / C genotypes at position 122321344 on chromosome 8 of the International Pig Genome 11.1 version, and culling breeding swine individuals that are A / A genotypes, to increase the frequency of allele C at this locus from generation to generation;

[0048] For (X), selecting from the core group of breeding swine, breeding swine individuals that are A / G or G / G genotypes at position 122335895 on chromosome 8 of the International Pig Genome 11.1 version, and culling breeding swine individuals that are A / A genotypes, to increase the frequency of allele G at this locus from generation to generation;

[0049] For (XI), selecting from the core group of breeding swine, breeding swine individuals that are C / T or C / C genotypes at position 30422074 on chromosome 12 of the International Pig Genome 11.1 version, and culling breeding swine individuals that are T / T genotypes, to increase the frequency of allele C at this locus from generation to generation;

[0050] For (XII), selecting from the core group of breeding swine, breeding swine individuals that are A / G or A / A genotypes at position 30398438 on chromosome 12 of the International Pig Genome 11.1 version, and culling breeding swine individuals that are G / G genotypes, to increase the frequency of allele A at this locus from generation to generation;

[0051] For (XIII), selecting from the core group of breeding pigs, breeding pigs with GTCACACACAC / G or GTCACACACAC / GTCACACACAC genotype at position 7723118 on chromosome 2 of the International Pig Genome 11.1 version, and eliminating breeding pigs with G / G genotype, so as to increase the frequency of allele GTCACACACAC at the locus generation by generation;

[0052] For (XIV), selecting from the core group of breeding pigs, breeding pigs with A / T or T / T genotype at position 34106157 on chromosome 6 of the International Pig Genome 11.1 version, and eliminating breeding pigs with A / A genotype, so as to increase the frequency of allele T at the locus generation by generation;

[0053] For (XV), selecting from the core group of breeding pigs, breeding pigs with C / T or T / T genotype at position 79119746 on chromosome 7 of the International Pig Genome 11.1 version, and eliminating breeding pigs with C / C genotype, so as to increase the frequency of allele T at the locus generation by generation.

[0054] A method for identifying the IMP, GMP content or meat quality related traits of pigs or pork, comprising the following steps:

[0055] Determining the above-mentioned SNP markers of pigs or pork, and judging the IMP, GMP content or meat quality related traits of pigs or pork according to the SNP loci of the SNP markers:

[0056] For (I), the IMP content of the pigs or pork from high to low or the meat quality traits from good to poor, the genotype at position 23634644 on chromosome 14 of the International Pig Genome 11.1 version is ranked in turn as follows: G / G genotype, G / A genotype;

[0057] For (II), the IMP content of the pigs or pork from high to low or the meat quality traits from good to poor, the genotype at position 61539869 on chromosome 5 of the International Pig Genome 11.1 version is ranked in turn as follows: A / A genotype, G / A genotype and G / G genotype;

[0058] For (III), the IMP content of the pigs or pork from high to low or the meat quality traits from good to poor, the genotype at position 73318431 on chromosome 6 of the International Pig Genome 11.1 version is ranked in turn as follows: C / C genotype, C / T genotype and T / T genotype;

[0059] For (IV), the IMP content of the pigs or pork from high to low or the meat quality traits from good to poor, the genotype at position 9931110 on chromosome 15 of the International Pig Genome 11.1 version is ranked in turn as follows: AT / AT genotype, AT / A genotype and A / A genotype;

[0060] For (V), the pigs or pork IMP content from high to low or meat quality traits from good to poor, the genotype of the 7924927th position on chromosome 15 of the international pig genome 11.1 version is ranked in turn as follows: A / A genotype, A / G genotype and G / G genotype;

[0061] For (VI), the pigs or pork GMP content from high to low or meat quality traits from good to poor, the genotype of the 73963573th position on chromosome 7 of the international pig genome 11.1 version is ranked in turn as follows: A / A genotype, G / A genotype and G / G genotype;

[0062] For (VII), the pigs or pork GMP content from high to low or meat quality traits from good to poor, the genotype of the 49824761th position on chromosome 15 of the international pig genome 11.1 version is ranked in turn as follows: T / T genotype, T / C genotype and C / C genotype;

[0063] For (VIII), the pigs or pork GMP content from high to low or meat quality traits from good to poor, the genotype of the 195476736th position on chromosome 13 of the international pig genome 11.1 version is ranked in turn as follows: T / T genotype, T / C genotype and C / C genotype;

[0064] For (IX), the pigs or pork GMP content from high to low or meat quality traits from good to poor, the genotype of the 122321344th position on chromosome 8 of the international pig genome 11.1 version is ranked in turn as follows: C / C genotype, A / C genotype and A / A genotype;

[0065] For (X), the pigs or pork GMP content from high to low or meat quality traits from good to poor, the genotype of the 122335895th position on chromosome 8 of the international pig genome 11.1 version is ranked in turn as follows: G / G genotype, A / G genotype and A / A genotype;

[0066] For (XI), the pigs or pork GMP content from high to low or meat quality traits from good to poor, the genotype of the 30422074th position on chromosome 12 of the international pig genome 11.1 version is ranked in turn as follows: C / C genotype, C / T genotype and T / T genotype;

[0067] For (XII), the pigs or pork GMP content from high to low or meat quality traits from good to poor, the genotype of the 30398438th position on chromosome 12 of the international pig genome 11.1 version is ranked in turn as follows: A / A genotype, A / G genotype and G / G genotype;

[0068] For (XIII), the pigs or porks are ranked from high to low in GMP content or from good to poor in meat quality according to the genotype at position 7723118 on chromosome 2 of the international pig genome version 11.1, and the ranking is as follows: GTCACACACAC / GTCACACACAC genotype, GTCACACACAC / G genotype and G / G genotype;

[0069] For (XIV), the pigs or porks are ranked from high to low in GMP content or from good to poor in meat quality according to the genotype at position 34106157 on chromosome 6 of the international pig genome version 11.1, and the ranking is as follows: T / T genotype, A / T genotype and A / A genotype;

[0070] For (XV), the pigs or porks are ranked from high to low in GMP content or from good to poor in meat quality according to the genotype at position 79119746 on chromosome 7 of the international pig genome version 11.1, and the ranking is as follows: T / T genotype, C / T genotype and C / C genotype.

[0071] The SNP marker, primer combination or kit is used in the field of gene editing or transgenic.

[0072] A method for establishing a new pig strain and / or a new pig breed for increasing the IMP and GMP content of pigs or improving the quality of pork, comprising the following steps:

[0073] The SNP marker of the pig is determined, and the following mutation is carried out based on the SNP marker:

[0074] For (I), the pig with the genotype G / A of the SNP marker is mutated from G / A genotype to G / G genotype by site-directed mutation;

[0075] For (II), the pig with the genotype G / A or G / G of the SNP marker is mutated from G / A or G / G genotype to A / A genotype by site-directed mutation;

[0076] For (III), the pig with the genotype C / T or T / T of the SNP marker is mutated from C / T or T / T genotype to C / C genotype by site-directed mutation;

[0077] For (IV), the pig with the genotype AT / A or A / A of the SNP marker is mutated from AT / A or A / A genotype to AT / AT genotype by site-directed mutation;

[0078] For (V), the pig with the genotype A / G or G / G of the SNP marker is mutated from A / G or G / G genotype to A / A genotype by site-directed mutation;

[0079] For (VI), the pig with the genotype of G / A or G / G of the SNP marker is mutated to the genotype of A / A by site-directed mutation;

[0080] For (VII), the pig with the genotype of T / C or C / C of the SNP marker is mutated to the genotype of T / T by site-directed mutation;

[0081] For (VIII), the pig with the genotype of T / C or C / C of the SNP marker is mutated to the genotype of T / T by site-directed mutation;

[0082] For (IX), the pig with the genotype of A / C or A / A of the SNP marker is mutated to the genotype of C / C by site-directed mutation;

[0083] For (X), the pig with the genotype of A / G or A / A of the SNP marker is mutated to the genotype of G / G by site-directed mutation;

[0084] For (XI), the pig with the genotype of C / T or T / T of the SNP marker is mutated to the genotype of C / C by site-directed mutation;

[0085] For (XII), the pig with the genotype of A / G or G / G of the SNP marker is mutated to the genotype of A / A by site-directed mutation;

[0086] For (XIII), the pig with the genotype of GTCACACACAC / G or G / G of the SNP marker, the genotype of GTCACACACAC / G and G / G is mutated to the genotype of GTCACACACAC / GTCACACACAC by site-directed mutation;

[0087] For (XIV), the pig with the genotype of A / T or A / A of the SNP marker is mutated to the genotype of T / T by site-directed mutation.

[0088] For (XV), the pig with the genotype of C / T or C / C of the SNP marker is mutated to the genotype of T / T by site-directed mutation.

[0089] The mutation is preferably carried out by a method of gene editing.

[0090] The mutation is preferably carried out by a method of gene editing.

[0091] The present application has the following advantages and effects relative to the prior art:

[0092] (1) The present application is based on three test pig populations of American purebred Landrace, American purebred Large White and American purebred Duroc, and uses pig whole genome resequencing and GWAS analysis to research and determine 15 SNP markers related to IMP or GMP content. The related indexes of pigs can be detected by at least one of the SNP markers of the present application, or genetic improvement can be carried out by at least one of the SNP markers.

[0093] (2) The present application is based on SNP markers affecting the IMP or GMP content of pigs, and establishes a set of efficient and accurate molecular marker assisted breeding techniques, including primers and kits for detecting the SNP markers and other products, methods for identifying the IMP, GMP content or meat quality related traits of pigs, and genetic improvement of pigs. When applied to genetic improvement of the IMP or GMP content and meat quality related traits of pigs, the IMP or GMP content and meat quality related traits of pigs can be quickly and accurately selected and bred, and the breeding process can be accelerated.

[0094] (3) The present application uses molecular breeding methods to solve the problem of low IMP or GMP content, and by selecting the advantageous alleles of the above SNP markers, the frequency of advantageous alleles can be increased generation by generation, the IMP or GMP content can be improved, and the genetic improvement of pigs can be accelerated to effectively improve the economic benefits of pig breeding. BRIEF DESCRIPTION OF DRAWINGS

[0095] Figure 1 is a Manhattan plot of GWAS analysis of IMP content traits on different chromosomes in different test populations; wherein, the X axis is the position of the molecular marker site on the chromosome, and the Y axis is the corresponding -log 10 (P value) of the molecular marker site.

[0096] Figure 2 is a Manhattan plot of GWAS analysis of GMP content traits on different chromosomes in different test populations; wherein, the X axis is the position of the molecular marker site on the chromosome, and the Y axis is the corresponding -log 10 (P value) of the molecular marker site.

[0097] Figure 3 is a violin plot of the genotype of all sites in the corresponding population corresponding to the IMP or GMP content, wherein the X axis represents the genotype of the SNP molecular marker site, and the Y axis represents the IMP or GMP content of the individual. DETAILED DESCRIPTION

[0098] The present application will be further described in detail below in conjunction with the embodiments and drawings, but the embodiments of the present application are not limited thereto.

[0099] Unless otherwise specifically indicated, the techniques employed in the examples are standard techniques well known to those of ordinary skill in the art. Unless otherwise described, the reagents, methods, and equipment employed in the present application are conventional reagents, methods, and equipment in the art.

[0100] In the examples, the standard for HPLC detection is inosinic acid (IMP) (131-99-7), guanylic acid (GMP) (5550-12-9), purchased from Shanghai Anpu Experimental Science and Technology Co., Ltd.

[0101] Example 1

[0102] 1. Test animals

[0103] The pig population used in the present application is: American purebred Landrace (173), American purebred Large White (166), American purebred Duroc (158).

[0104] All pigs are from Jidu Jia Large Animal Husbandry Co., Ltd., Jiangxi, and all pigs are slaughtered at 200 days of age in Nanchang Guhong Food Co., Ltd., Jiangxi, and the determination site is the cutting workshop of the slaughterhouse. The white carcass is obtained after the determination individual is slaughtered, bled, removed of hair, internal organs, head, tail, and limbs (below the wrist and joints), and skinned. The sampling time is controlled to be completed within 30 min after slaughter to minimize the influence of post-slaughter metabolism on the content of purine nucleotides and their metabolites; the longissimus dorsi muscle is accurately separated from the left side of the first and second lumbar vertebrae of the pig carcass, and the visible connective tissue and fascia are removed; about 2.0 g of muscle tissue is quickly transferred to a 2 mL low-temperature cryogenic tube and cut into small pieces, immersed in liquid nitrogen (-196℃) for quick freezing, and stored in a -80℃ ultra-low temperature refrigerator until the experiment.

[0105] 2. HPLC quantitative determination of IMP and GMP content in pork

[0106] (1) Extraction of IMP and GMP: accurately weigh 0.4 g (accurate to 0.001 g) of muscle sample from the cut longissimus dorsi muscle sample into a 15 mL polypropylene acid-resistant centrifuge tube.

[0107] (2) Acid extraction: add 6 mL of 6% (w / w) perchloric acid solution pre-cooled to 4℃, and then homogenize the sample with a handheld high-speed homogenizer for 45 s (run for 10 s / pause for 5 s, cycle for 3 times), and intermittently cool in an ice bath to prevent overheating.

[0108] (3) Centrifugal purification: transfer the homogenate to a constant-temperature water bath shaker (4℃) and shake at 200 rpm for 15 min to promote the release of nucleotides; centrifuge at 5,000 rpm for 10 min at 4℃, collect the supernatant into a new tube, and repeat the centrifugation twice, and combine the supernatants from the two centrifugations.

[0109] (4) Precise pH control by acid-base neutralization: The combined supernatant from step (3) is placed in an ice bath, and 3 mol / L NaOH solution is added dropwise using a micropipette to adjust the pH to 6.5 ± 0.1 (monitored in real time using a pH meter), which can minimize the interference of ATPase activity; add ultrapure water to 10 mL, vortex mix and stand for 10 min to promote ion balance.

[0110] (5) The contents of IMP and GMP in each individual's longissimus dorsi muscle extract are detected by high performance liquid chromatography (HPLC) (unit: mg / 100g), wherein the HPLC analysis is performed on an ACQUITY UPLC-Class PLUS System (Waters) with a Waters BEH C18 column (1.7 μm, 2.1× 100 mm), a mobile phase of 0.05 mol / L KH2PO4 buffer (pH 6.0)-methanol (95:5, v / v) at a flow rate of 0.2 mL / min (isocratic elution), a column temperature of 30°C, a detection wavelength of 254 nm, an injection volume of 2 μL, and external standard quantification, and the standard curve needs to satisfy R²≥0.999.

[0111] (6) The concentration data obtained from the HPLC system is converted from the original unit µg / mL to mg / 100g by the following formula:

[0112]

[0113] Where C represents the content of each nucleotide in 100 grams of pork (mg / 100g), and C0 represents the concentration of the nucleotide measured by HPLC (µg / mL).

[0114] The present application describes the descriptive statistics of the HPLC detection data of IMP and GMP in the longissimus dorsi muscle of three commercial pig breeds (Large White, Landrace and Duroc), systematically calculates the sample size (N), mean (Mean), standard deviation (SD), extreme value (Min-Max) and coefficient of variation (C.V.), and the descriptive statistics results are shown in Table 1. As shown in Table 1, the gradient of 5'-guanylic acid (GMP) decreases among breeds: Large White > Landrace > Duroc, and the coefficient of variation of Duroc is 83.4%, which indicates that the detection content is low, suggesting that the fluctuation of purine metabolic pathway regulation is higher. The maximum value of IMP in Duroc (396.34 mg / 100g) is much higher than that in other breeds, but the mean value is the lowest (252.62 ± 4.73), the coefficients of variation of Large White and Landrace are similar (13.1%-13.2%), while the coefficient of variation of Duroc is significantly increased (23.7%), indicating that there are high-value specific individuals in the population. The high IMP potential of Duroc can be combined with gene editing and precise nutrition regulation to improve the overall flavor balance.

[0115] Table 1. Descriptive statistics of three IMP and GMP contents (unit: mg / 100g)

[0116]

[0117] Example 2

[0118] 1. Obtaining, quality control and phasing of whole genome resequencing data of pigs

[0119] (1) DNA extraction: Ear tissue samples of each individual of the three test pig populations in Example 1 were collected, and the genomic DNA of each individual was extracted by the standard phenol-chloroform method and dissolved in TE buffer. The quality of the extracted genomic DNA was detected by Nanodrop-ND1000 spectrophotometer. When the A260 / 280 ratio was about 1.8-2.0 and the A260 / 230 ratio was about 1.7-1.9, the quality standard was reached.

[0120] (2) DNA sequencing: The concentration of the DNA sample meeting the standard was diluted to 50 ng / μL, and the whole genome resequencing (double-end 150bp sequencing mode) was completed by Huada sequencing platform. The average sequencing depth of the sample reached 30x, and the original sequencing data fastq format file was obtained. Clean reads were obtained by fastp (v0.23.0) quality control for subsequent analysis.

[0121] (3) Sequence alignment: The data obtained in step (2) was aligned with BWA (v0.7.17) based on Sscrofa11.1 (NCBISuscrofa version 11.1) reference genome to obtain sam format file.

[0122] (4) Variation detection: The sam format file in step (3) was sorted into bam format file using samtools (v1.10), and PCR repeat sequences in the bam format file were removed using Sambamba (v0.8.2). Finally, genetic variation detection was performed on all individual bam using Graphtyper (v2.7.7) to obtain population level genotype data (vcf file).

[0123] (5) Variant quality control: using samtools to quality control the population level genotype data obtained in step (4), wherein the variant sites are retained under the conditions of meeting "FILTER="PASS"" and the variant detection quality value GQ>20; further using Plink (v1.9) to quality control the population level genotype data, excluding the variant sites with minor allele frequency (MAF) less than 5% and the samples with individual genotype detection rate (call rate) less than 80%. Finally, using beagle (r1399) to fill in the genotype to obtain high-quality genotype data.

[0124] After a series of the above methods, 1928103, 1964653 and 1513322 mutation sites (including SNPs and Indels) were obtained in Large White, Landrace and Duroc, respectively.

[0125] 2. Genome-wide association analysis (GWAS) analysis and meta-analysis

[0126] (1) Using Genome-wide Efficient Mixed Model Association algorithm (GEMMA v0.98.1), the phenotype data corrected by confounding factors was subjected to genome-wide association analysis. Specifically:

[0127] ① Phenotype processing: the present application uses the lm() function in R language to complete, that is, the gender and batch are put into the function for simple linear regression, and the obtained corrected residual is used as the phenotype for final association analysis.

[0128] ② Analysis using univariate linear mixed model (ULMM) for statistical inference, and the mathematical expression is constructed as follows:

[0129] Wherein, y represents the n-dimensional vector of the phenotype (quantitative trait or binary vector) to be analyzed, which is the content of IMP or GMP in the present study; W represents a matrix (n x c dimension) composed of a column of "1"; a is the effect of the corresponding covariate and the intercept value vector (c dimension), x represents the vector of the detected site genotype (n dimension); β represents the vector of the effect size of the detected site; u represents the random effect vector (n dimension) of K multivariate normal distribution with mean 0 and covariance-variance matrix λτ -1 K; ε represents the residual error vector (n dimension) of In with mean 0 and covariance-variance matrix τ -1 In. In the two n-dimensional normal distributions, n represents the number of phenotypes, τ -1where λ represents the variance of the residual error, λ represents the ratio of the variance of the random effect to the variance of the residual error, K represents the n x n kinship matrix, In represents the n x n identity matrix, and MVNn represents the n-dimensional multivariate normal distribution. To correct the multiple hypothesis testing, the whole genome significance threshold is set to 0.05 / N (Bonferroni correction), where N is the number of effective SNPs / Indels.

[0130] (2) Using the results obtained by the above GWAS analysis, the IMP and GMP contents in the three populations are subjected to meta-analysis in the METAL software, and the meta-analysis is based on the standard error weighted method (SCHEME STDERR).

[0131] The present application is based on GWAS analysis Figure 1 and Figure 2 , and a total of 15 representative SNP sites (including those obtained by meta-analysis) are obtained, and the basic genetic parameter information is shown in Table 2. The name information of the representative SNP site is obtained from the sus_scrofa.vcf.gz file downloaded from the NCBI database using the bcftools software. If the website does not have the SNP name information of the site, the SNP name of the site is represented in the form of "chromosome_position". Some other important genetic parameter information of each representative site can be obtained from the GWAS analysis results of the GEMMA software, including the chromosome and position information of the site, allele, effect size and P value (Wald test), etc.

[0132] Table 2. Basic genetic parameter information of 15 representative SNP markers

[0133]

[0134] Note: The meta-analysis integrates the whole genome association study data of the Duroc, Landrace and Large White pig populations.

[0135] 3. Difference analysis of IMP and GMP content phenotypes under different genotypes

[0136] The genotypes of each individual of 497 pigs in the three populations at the displayed molecular marker sites are extracted from the sequencing file using Plink (v1.9), the number of individuals of each genotype is counted, and then the genotypes of these individuals are corresponded to the corresponding IMP or GMP content, and then the difference of the phenotype distribution under different genotypes is counted using the summarize function in the dplyr package in R language, and the results are shown in Table 3 and Figure 3 .

[0137] Table 3. Effect of each molecular marker site on IMP or GMP (unit: mg / 100g)

[0138]

[0139] 4. Heritability analysis

[0140] Heritability is one of the most important basic genetic parameters in quantitative genetics, which can be divided into broad-sense heritability, narrow-sense heritability and realized heritability. The heritability in the breeding process generally refers to the narrow-sense heritability (h 2 ), which refers to the proportion of the variance of quantitative trait breeding value to the variance of phenotype, and is the additive effect part after removing the dominance effect and epistatic effect, which can be stably inherited in the process of generation transmission. In the present application, the single marker heritability is estimated based on the effect value (β) and the standard error (SE) of each site in the GWAS result file of step 3 above, and the mean value thereof is taken as the approximate narrow-sense heritability at the whole genome level. The specific calculation formula is as follows:

[0141]

[0142] Wherein, β is the regression coefficient of a single SNP site, and SE is the corresponding standard error.

[0143] Table 4 is the heritability analysis result of IMP and GMP content in three populations, wherein the heritability distribution of IMP content in three populations is 0.327-0.356, and the heritability distribution of GMP content is 0.351-0.362.

[0144] Table 4. Heritability estimation (h 2 ) of IMP and GMP content in three populations

[0145]

[0146] Example 3

[0147] The present embodiment provides a specific detection method and process for the SNP markers in Example 2, which takes SNP markers rs324388776, rs694510214 and 12_30398438 as examples, which correspond to pig breeds of Landrace, Landrace and Large White, and correspond to traits of IMP, GMP and GMP, respectively. The specific method is as follows:

[0148] 1. Primer design

[0149] (1) The target fragment containing the SNP site significantly related to the IMP content of the American long white pig is a 510 bp nucleotide sequence (SEQ ID NO: 1) in chromosome 14, and the upstream and downstream primers for sequence amplification are primer-F1 and primer-R1, and the nucleic acid sequences are as follows:

[0150] The upstream primer primer-F1 is 5'-TCCTCCTCTCCCTGCAAGAG-3' (SEQ ID NO: 4);

[0151] The downstream primer primer-R1 is 5'-CGTGGGTCAGCTGCTTATCT-3' (SEQ ID NO: 5).

[0152] (2) The target fragment containing the SNP site significantly related to the GMP content of the American long white pig is a 153 bp nucleotide sequence (SEQ ID NO: 2) in chromosome 13, and the upstream and downstream primers for sequence amplification are primer-F2 and primer-R2, and the nucleic acid sequences are as follows:

[0153] The upstream primer primer-F2 is 5'-AGTTATCACACTGGAAAGGGGG-3' (SEQ ID NO: 6);

[0154] The downstream primer primer-R2 is 5'-CCTCTCTCTAATCTCCAGCCC-3' (SEQ ID NO: 7).

[0155] (3) The target fragment containing the SNP site significantly related to the GMP content of the American long white pig is a 515 bp nucleotide sequence (SEQ ID NO: 3) in chromosome 12, and the upstream and downstream primers for sequence amplification are primer-F3 and primer-R3, and the nucleic acid sequences are as follows:

[0156] The upstream primer primer-F3 is 5'-TGATGGGGTTGTTTGCTTTTT-3' (SEQ ID NO: 8);

[0157] The downstream primer primer-R3 is 5'-AGTGGAACAGGATAGAAAACCCA-3' (SEQ ID NO: 9).

[0158] 2. PCR amplification

[0159] 10 μL of the reaction system is added with 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2x Taq PCR StarMix with Loading Dye, and 0.3 μL of the forward and reverse primers, respectively. The PCR reaction conditions are as follows: 5 min of pre-denaturation at 94℃, 30 s of denaturation at 94℃, 30 s of annealing at 55-65℃, 45 s of extension at 72℃, 35 cycles, and finally 5 min of extension at 72℃.

[0160] 3. DNA sequence determination

[0161] DNA sequence sequencing identification: performed by Shenzhen Huada Gene Technology Co., Ltd., with two reactions of forward and reverse determination of gene fragments. The obtained sequence is compared with the NCBI genomic sequence, and the mutation of the corresponding SNP site is obtained.

[0162] SEQ ID No. 1 (chr14:23634389-23634899): TCCTCCTCTCCCTGCAAGAGGCGGCATCCTCACCACCATCCTCACCACTGTCGTCGCCACCACCATCGCCGTCAGTATTGTCATCACCACCGTCACGTCCTCACCCCTGTCGTCACCCTCATCCCCAGCAGCAGCAGCAGCACCGTCATACTTATCACCAGATGATCATTATCGCCACCACCGTCACCACCACCACCGTCATCACTGTCATCACCACCATCATCGAGGGCTGTGGTGGCCCGTGGGCAAGATGC M (G>A) CTCACACCAGGGACCAGGAACCTCGTCCCCTCGGCCTTCAGCCCGCGTCCCTCCACTCATCCTGAGGTCAAAGGTCACCACCATCACCATGCTCAGCAGCAGCATCACCAGCATCATCCCTATTTCACAGCTGAGGAAGCCCAGCCACAGGGAACTATGTGATTGCCCCACGGTAAAGACACTACATTTCTCCGAAGCTCACAATTCCCCCTTTCCCCTGAGTCCTTCTGGGCCCAGATAAGCAGCTGACCCACG SEQ ID No. 2 (chr13:195476711-1954776864): AGTTATCACACTGGAAAGGGGGCA M (C>T)GTGGTTCCCCAGGAGGCCTGCCAAGGAGGTCCTGGAACCCAGGTTTGAGGCCTCCAACTGGTCACCTAGATGCAGCCTATACAAAACATCAGAGAGGCTGAGAAGAGGGGCTGGAGATTAGAGAGAGG SEQ ID No. 3 (chr12:30421812-30422327):

[0163] TGATGGGGTTGTTTGCTTTTTTGGTATTGAGCTGCAGAAGGCATTTATAGATTTTTGGAGATTAATCTCTTGTCAGTTGCTTCATTTGCAAATGTTTTCTCCAATTCTGTGGGTTGTCTCTTTGTTTTGT TTAGGGTTTCCTTTGCTGTGCAGAAACTTTTGAGTTTAATTAAGTCCCACTTGTCTATTTTTGTTTTACTGTCATTACTGTAGGAGGTGGATCTTAGAAGATGTTGCTGTCATTTATGTTGGAGAGTGTT M (C>T) GGCTTATGATTTCCTCTAAGAGTTTTAGAGTGTATGGTATTATATCTAGGTCTTTAATCCATTCTGAGTTTATTTTTGTGTATGGTGTTAGGAAGTGTTCTAATTTCATTCTTTTACATGTGGCTA TCCAGTTTTCCCACCACCACTTATTGAAGGGGCTGTCTTCTTCATTGTATCTTCTTGCCTCCATTTTCATAGATTAGTTAACTGTAGGAGCATGGTTTTAATTCTGGGTTTTCTATCCTGTTCCACT

[0164] Note: The M marked in the sequence is the mutation site, which is underlined (the mutated base in brackets is the allele mutation). The bold at the beginning and end of the sequence is the primer sequence binding position.

[0165] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A use of a SNP marker affecting pig IMP or GMP content in identifying pig or pork IMP, GMP content or meat quality related traits, screening pig breeds with high IMP or GMP content or excellent meat quality, and genetic breeding of pig IMP, GMP content or meat quality related traits, characterized in that The SNP markers include at least one of the following SNP markers: (I) The SNP site corresponds to the G>A mutation at position 23634644 on chromosome 14 of the international porcine genome version 11.1; (II) The SNP site corresponds to the G>A mutation at position 61539869 on chromosome 5 of the international porcine genome version 11.1; (III) The SNP site corresponds to the C>T mutation at position 73318431 on chromosome 6 of the international porcine genome version 11.1; (IV) The SNP site corresponds to the AT>A mutation at position 9931110 on chromosome 15 of the international porcine genome version 11.1; (V) The SNP site corresponds to the A>G mutation at position 7924927 on chromosome 15 of the international porcine genome version 11.1; (VI) The SNP site corresponds to the G>A mutation at position 73963573 on chromosome 7 of the international porcine genome version 11.1; (VII) The SNP site corresponds to the T>C mutation at position 49824761 on chromosome 15 of the international porcine genome version 11.1; (VIII) The SNP site corresponds to the T>C mutation at position 195476736 on chromosome 13 of the international porcine genome version 11.1; (IX) The SNP site corresponds to the A>C mutation at position 122321344 on chromosome 8 of the international porcine genome version 11.1; (Ⅹ) The SNP site corresponds to the A>G mutation at position 122335895 on chromosome 8 of the international porcine genome version 11.1; (Ⅺ) The SNP site corresponds to the C>T mutation at position 30422074 on chromosome 12 of the international porcine genome version 11.1; (Ⅻ) The SNP site corresponds to the A>G mutation at position 30398438 on chromosome 12 of the international porcine genome version 11.1; (ⅩⅢ) The SNP site corresponds to the GTCACACACAC>G mutation at position 7723118 on chromosome 2 of the international porcine genome version 11.1; (XIV) The SNP site corresponds to the A>T mutation at position 34106157 on chromosome 6 of the international porcine genome version 11.1; (XV) The SNP site corresponds to the C>T mutation at position 79119746 on chromosome 7 of the international porcine genome version 11.

1.

2. The use according to claim 1, characterized in that: For (I), the nucleic acid sequence of the SNP marker is shown in SEQ ID NO: 1, wherein M in the sequence is G or A; For (VIII), the nucleic acid sequence of the SNP marker is shown in SEQ ID NO: 2, wherein M in the sequence is T or C; For (XI), the nucleic acid sequence of the SNP marker is shown in SEQ ID NO: 3, wherein M in the sequence is C or T.

3. A primer combination for detecting SNP markers affecting pig IMP or GMP content in identifying pig or pork IMP, GMP content or meat quality related traits, screening pig breeds with high IMP or GMP content or excellent meat quality, and genetic breeding for pig IMP, GMP content or meat quality related traits, characterized in that The primer combination comprises at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, and the nucleotide sequences thereof are shown in SEQ ID NOs: 4-9.

4. A kit for detecting SNP markers that affect pig IMP or GMP content for use in identifying pig or pork IMP, GMP content, or meat quality-related traits, screening pig breeds with high IMP or GMP content or excellent meat quality, and genetic breeding for pig IMP, GMP content, or meat quality-related traits, characterized in that: The kit comprises the primer combination described in claim 3.

5. A method for genetic improvement of pigs, characterized in that The following steps are included: Determine the SNP markers of claim 1 or 2 for the sows in the sow core group, and make corresponding selections based on the SNP markers: For (I), select from the core group of sows the G / G genotype at position 23634644 on chromosome 14 of the International Porcine Genome Version 11.1, and eliminate the G / A genotype sows to increase the frequency of the allele G at this position generation by generation; For (II), selecting from the core population of sows those with the A / A or G / A genotype at position 61539869 on chromosome 5 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of allele A at this site generation by generation; For (III), selecting from the core population of sows individuals with a C / C or C / T genotype at position 73318431 on chromosome 6 of the International Porcine Genome Version 11.1, and eliminating sows with a T / T genotype, so as to increase the frequency of the allele C at this site generation by generation; For (IV), selecting from the core group of sows the genotypes of AT / AT or AT / A at position 9931110 on chromosome 15 of the International Porcine Genome Version 11.1, and eliminating the genotypes of A / A sows to increase the frequency of the AT allele at this site generation by generation; For (V), selecting from the core population of sows those with the A / A or A / G genotype at position 7924927 on chromosome 15 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of allele A at this site generation by generation; For (VI), selecting from the core population of sows those with the G / A or A / A genotype at position 73963573 on chromosome 7 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of allele A at this site generation by generation; For (VII), selecting from the core population of sows those with the T / T or T / C genotype at position 49824761 on chromosome 15 of the International Porcine Genome Version 11.1, and eliminating those with the C / C genotype to increase the frequency of the T allele at this site generation by generation; For (VIII), selecting from the core population of sows those with the T / T or T / C genotype at position 195476736 on chromosome 13 of the International Porcine Genome Version 11.1, and eliminating those with the C / C genotype to increase the frequency of the T allele at this site generation by generation; For (IX), selecting from the core population of sows individuals with the A / C or C / C genotype at position 122321344 on chromosome 8 of the International Porcine Genome Version 11.1, and eliminating sows with the A / A genotype to increase the frequency of allele C at this site generation by generation; For (X), selecting from the core population of sows individuals with the A / G or G / G genotype at position 122335895 on chromosome 8 of the International Porcine Genome Version 11.1, and eliminating sows with the A / A genotype to increase the frequency of the allele G at this site generation by generation; For (XI), selecting from the core population of sows those with a C / T or C / C genotype at position 30422074 on chromosome 12 of the International Porcine Genome Version 11.1, and eliminating those with a T / T genotype, so as to increase the frequency of the allele C at this site generation by generation; For (XII), selecting from the core group of sows those with the A / G or A / A genotype at position 30398438 on chromosome 12 of the International Porcine Genome Version 11.1, and eliminating those with the G / G genotype to increase the frequency of allele A at this position generation by generation; For (XIII), selecting from the core group of sows the genotype of GTCACACACAC / G or GTCACACACACAC / GTCACACACAC at position 7723118 on chromosome 2 of the International Porcine Genome Version 11.1, and eliminating the genotype of G / G sows to increase the frequency of the allele GTCACACACAC at this site generation by generation; For (XIV), selecting from the core population of sows individuals with an A / T or T / T genotype at position 34106157 on chromosome 6 of the International Porcine Genome Version 11.1, and eliminating sows with an A / A genotype to increase the frequency of the T allele at this site generation by generation; For (XV), select from the core group of sows those with C / T or T / T genotype at position 79119746 on chromosome 7 of the International Porcine Genome Version 11.1, and eliminate those with C / C genotype to increase the frequency of allele T at this site generation by generation.

6. A method for identifying pig or pork IMP, GMP content or meat quality related traits, characterized in that The following steps are included: Determine the SNP marker of claim 1 or 2 of pigs or pork, and judge the IMP, GMP content or meat quality-related traits of pigs or pork based on the SNP site of the SNP marker: For (I), the pigs or pork are ranked from high to low in terms of IMP content or from good to bad in terms of meat quality traits according to the genotype at position 23634644 on chromosome 14 of the International Porcine Genome Version 11.1, as follows: G / G genotype, G / A genotype; For (II), the pigs or pork are ranked from high to low in terms of IMP content or from good to bad in terms of meat quality traits according to the genotype at position 61539869 on chromosome 5 of the International Porcine Genome Version 11.1, as follows: A / A genotype, G / A genotype, and G / G genotype; For (III), the pigs or pork are ranked from high to low in terms of IMP content or from good to bad in terms of meat quality traits according to the genotype at position 73318431 on chromosome 6 of the International Porcine Genome Version 11.1, in the order: C / C genotype, C / T genotype, and T / T genotype; For (IV), the pigs or pork are ranked from high to low in terms of IMP content or from good to bad in terms of meat quality traits according to the genotype at position 9931110 on chromosome 15 of the International Porcine Genome Version 11.1, as follows: AT / AT genotype, AT / A genotype, and A / A genotype; For (V), the pigs or pork are ranked from high to low in terms of IMP content or from good to bad in terms of meat quality traits according to the genotype at position 7924927 on chromosome 15 of the International Porcine Genome Version 11.1, as follows: A / A genotype, A / G genotype, and G / G genotype; For (VI), the pigs or pork are ranked from high to low in GMP content or from good to bad in meat quality according to the genotype at position 73963573 on chromosome 7 of the International Porcine Genome Version 11.1, in the order: A / A genotype, G / A genotype and G / G genotype; For (VII), the pigs or pork are ranked from high to low in GMP content or from good to bad in meat quality according to the genotype at position 49824761 on chromosome 15 of the International Porcine Genome Version 11.1, as follows: T / T genotype, T / C genotype, and C / C genotype; For (VIII), the pigs or pork are ranked from high to low in GMP content or from good to bad in meat quality according to the genotype at position 195476736 on chromosome 13 of the International Porcine Genome Version 11.1, in the order: T / T genotype, T / C genotype, and C / C genotype; For (IX), the pigs or pork are ranked from high to low in GMP content or from good to bad in meat quality according to the genotype at position 122321344 on chromosome 8 of the International Porcine Genome Version 11.1, in the order: C / C genotype, A / C genotype and A / A genotype; For (X), the pigs or pork are ranked from high to low in terms of GMP content or from good to bad in terms of meat quality traits according to the genotype at position 122335895 on chromosome 8 of the International Porcine Genome Version 11.1, as follows: G / G genotype, A / G genotype, and A / A genotype; For (XI), the pigs or pork are ranked from high to low in GMP content or from good to bad in meat quality according to the genotype at position 30422074 on chromosome 12 of the International Porcine Genome Version 11.1, as follows: C / C genotype, C / T genotype and T / T genotype; For (XII), the pigs or pork are ranked from high to low in GMP content or from good to bad in meat quality according to the genotype at position 30398438 on chromosome 12 of the International Porcine Genome Version 11.1, as follows: A / A genotype, A / G genotype and G / G genotype; For (XIII), the pigs or pork are ranked from high to low in GMP content or from good to bad in meat quality according to the genotype at position 7723118 on chromosome 2 of the International Porcine Genome Version 11.1, as follows: GTCACACACAC / GTCACACACAC genotype, GTCACACACAC / G genotype and G / G genotype; For (XIV), the pigs or pork are ranked from high to low in GMP content or from good to bad in meat quality according to the genotype at position 34106157 on chromosome 6 of the International Porcine Genome Version 11.1, in the following order: T / T genotype, A / T genotype and A / A genotype; For (XV), the pigs or pork GMP content from high to low or meat quality traits from good to bad are arranged according to the genotype at position 79119746 on chromosome 7 of the international porcine genome version 11.1, which are: T / T genotype, C / T genotype and C / C genotype.

7. Use of a SNP marker affecting porcine IMP or GMP content, a primer combination for detecting a SNP marker affecting porcine IMP or GMP content, or a kit for detecting a SNP marker affecting porcine IMP or GMP content in the field of gene editing or transgenics, characterized in that: The SNP marker is the SNP marker described in claim 1; The primer combination comprises at least one of primer pair primer-F1 and primer-R1, primer pair primer-F2 and primer-R2, and primer pair primer-F3 and primer-R3, the nucleotide sequences of which are shown in SEQ ID NOs: 4-9; The kit comprises the above primer combination.

8. A method for establishing a new pig strain and / or new pig breed for increasing the IMP and GMP content of pigs or improving pork quality, characterized in that The following steps are included: Determine the SNP marker of claim 1 or 2 in a pig, and perform the following mutation based on the SNP marker: For (I), the genotype of the SNP marker is G / A in pigs, and the G / A genotype is mutated to G / G genotype by site-directed mutagenesis; For (II), for pigs whose SNP marker genotype is G / A or G / G, the G / A or G / G genotype is mutated to A / A genotype by site-directed mutagenesis; For (III), in pigs whose SNP marker genotype is C / T or T / T, the C / T or T / T genotype is mutated to C / C genotype by site-directed mutagenesis; For (IV), in pigs whose SNP marker genotype is AT / A or A / A, the AT / A or A / A genotype is mutated to the AT / AT genotype by site-directed mutagenesis; For (V), for pigs whose SNP marker genotype is A / G or G / G, the A / G or G / G genotype is mutated to the A / A genotype by site-directed mutagenesis; For (VI), for pigs whose SNP marker genotype is G / A or G / G, the G / A or G / G genotype is mutated to A / A genotype by site-directed mutagenesis; For (VII), the pigs whose SNP marker genotype is T / C or C / C are mutated to T / T genotype by site-directed mutagenesis; For (VIII), for pigs whose SNP marker genotype is T / C or C / C, the T / C or C / C genotype is mutated to a T / T genotype by site-directed mutagenesis; For (IX), the genotype of the SNP marker is A / C or A / A, and the A / C or A / A genotype is mutated to C / C genotype by site-directed mutagenesis; For (X), the genotype of the SNP marker is A / G or A / A in pigs, and the A / G or A / A genotype is mutated to a G / G genotype by site-directed mutagenesis; For (XI), the pigs whose SNP marker genotype is C / T or T / T are mutated to C / C genotype by site-directed mutagenesis; For (XII), the genotype of the SNP marker is A / G or G / G, and the A / G or G / G genotype is mutated to the A / A genotype by site-directed mutagenesis; For (XIII), the genotype of the SNP marker is GTCACACACAC / G or G / G, and the GTCACACACAC / G and G / G genotypes are mutated to GTCACACACAC / GTCACACACAC genotypes by site-directed mutagenesis; For (XIV), the pigs whose SNP marker genotype is A / T or A / A are mutated to T / T genotype by site-directed mutagenesis; For (XV), the genotype of the SNP marker in the pig is C / T or C / C, and the C / T or C / C genotype is mutated to T / T genotype by site-directed mutagenesis.

9. The method for establishing a new pig strain and / or new pig breed for increasing pig IMP and GMP content or improving pork quality according to claim 8, characterized in that: The mutation method is to use a transgenic method or a gene editing method to perform mutation.

Citation Information

Patent Citations

  • Molecular marker related to pork color, detection method, detection kit and application

    CN113186305A

  • SNP (Single Nucleotide Polymorphism) molecular marker for influencing porcine skeletal muscle fiber type composition percentage and application of SNP molecular marker

    CN115369175A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to dystocia traits of sows and application

    CN117757959A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to pig lean meat percentage character and application of SNP molecular marker

    CN117965749A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to eye muscle area of large white pig and application of SNP molecular marker

    CN118460742A