KASP molecular marker tmsk23 related to eggplant reverse temperature-sensitive male sterility and application thereof

Abstract

The present application relates to the field of molecular genetic technology, in particular to a KASP molecular marker TMSK23 related to eggplant reverse temperature-sensitive male sterility and application thereof. The molecular marker site is obtained by crossing 05ms as female parent and S132 as male parent, and obtaining F2 separation population. According to the published high-quality eggplant genome information, the whole genome resequencing technology is used to pool and sequence the homozygous dominant fertile plants and homozygous recessive sterile plants in the F2 generation of eggplant, and the SNP difference sites of the fertile gene and sterile gene pool are screened out, and the difference sites are verified by KASP gene typing method and protein three-dimensional structure prediction. The present application solves the problems of large workload in hybrid seed production in the prior art, avoids the problem of a large number of measurement and matching in the transgenic process, improves the breeding efficiency and has other advantages.

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, and in particular to a KASP molecular marker TMSK23 associated with reverse thermosensitive nuclear male sterility in eggplant and its applications. Background Technology

[0002] Eggplant (Solanum melongena L.), belonging to the Solanaceae family, is an annual crop and one of the world's most important vegetable crops, with China being the largest producer. Eggplant exhibits significant hybrid vigor and high utilization value, not only increasing fruit yield and quality but also enhancing plant disease resistance and stress tolerance. Currently, the vast majority of eggplant varieties promoted in my country are F1 hybrids, but eggplant hybrid production still primarily relies on artificial emasculation and pollination. Utilizing male-sterile lines of eggplant to produce F1 hybrids eliminates the need for artificial emasculation, saving time and labor, significantly reducing seed production costs and difficulties, and substantially improving seed purity, making it an important approach to utilizing hybrid vigor. Therefore, research on male sterility has always received considerable attention from scholars both domestically and internationally.

[0003] Heterosis is a common phenomenon in crops, where the first generation of hybrids outperforms their parents in terms of growth vigor, vitality, stress resistance, yield, and quality. The use of male-sterile lines reduces the production cost of artificial emasculation, simplifies seed production, increases seed production volume and speed, and accelerates the promotion of hybrid seeds. Male sterility is mainly divided into two types: cytoplasmic male sterility (CMS) and genetic male sterility (GMS). The development of the "three-line" hybrid rice system based on CMS (first generation) and the "two-line" hybrid rice system based on photoperiod- and thermo-sensitive genic male sterility (PGMS and TGMS) (second generation) have made significant contributions to increased rice production and food security in China. Compared with "three-line" hybrids, "two-line" hybrids are easier to operate and have higher efficiency in utilizing germplasm resources. The two-line hybrid system is an important innovation and is becoming increasingly popular in large-scale hybrid seed production in China. Generally, high-temperature infertility and low-temperature fertility are referred to as thermosensitive infertility; while low-temperature infertility and high-temperature fertility are referred to as reverse thermosensitive infertility.

[0004] CMS seed production requires a three-line system. Although it has been applied to eggplant varieties, its application in eggplant remains challenging, primarily due to the difficulty in finding superior restorer lines. GMS lines have simple genetics and a wide range of restorer lines, but the maintenance of their sterility relies solely on pollen from heterozygous materials. In the offspring population, half of the individual plants will always remain fertile heterozygous, necessitating the removal of these fertile plants during hybridization, severely impacting seed production efficiency. In 2005, the applicant discovered a male-sterile mutant in the long eggplant inbred line S63. Through multiple generations of directional selection, a thermosensitive male-sterile line, 05ms, was developed. Research revealed it to be different from the aforementioned materials; it is sterile at low temperatures but fertile at high temperatures, controlled by a pair of recessive nuclear genes, belonging to the reverse thermosensitive nuclear male sterility (rTGMS) type. The acquisition of this material laid the germplasm foundation for eggplant two-line hybridization breeding research. This type of sterile line is a superior hybridization breeding material, as fertility can be restored by changing temperature conditions. It serves as both a sterile line and a maintainer line, thus simplifying the seed production process. Breeding stable male-sterile lines from traditional nuclear male-sterile materials takes 7–10 years. Molecular marker-assisted selection can effectively shorten the breeding cycle and improve breeding efficiency. To date, very few molecular markers for eggplant male sterility have been reported, including one DNA marker for the restoration gene in cytoplasmic male sterility, but no reports on molecular markers for nuclear male sterility.

[0005] Patent document CN116287359A discloses a "molecular marker and primers for detecting the Saet-derived cytoplasmic male sterility restorer gene in eggplant." Based on the F1 hybrid population of the eggplant Saet-derived cytoplasmic male sterility restorer line 3-26 and maintainer line EP26, the restorer gene is located on chromosome Ch06. A SNP molecular marker SmRf186, closely linked to the restorer gene, is designed through sequence analysis. This molecular marker technology allows for rapid detection of the eggplant Saet-derived cytoplasmic male sterility restorer gene at the seedling stage, improving breeding efficiency. The SNP marker SmRf186 is located at position 1860648 on chromosome 6 of the eggplant genome, with a base of either C or G. SNPs with a base of G at the mark indicate an eggplant Saet-derived cytoplasmic male sterility restorer line, while SNPs with a base of C indicate an eggplant Saet-derived cytoplasmic male sterility maintainer line. The molecular marker mentioned in the aforementioned patent document is a restoration gene for cytoplasmic male sterility in eggplant, while the molecular marker mentioned in this patent is related to thermosensitive nuclear male sterility in eggplant, and the detection types are completely different.

[0006] Purpose of the invention:

[0007] The purpose of this invention is to provide a KASP molecular marker TMSK23 associated with thermosensitive male sterility in eggplant and its application. The marker site was obtained by crossing the eggplant rTGMS line 05ms as the female parent with the eggplant high-generation inbred line S132 as the male parent to obtain a segregating F2 population. Based on published high-quality eggplant genome information, whole-genome resequencing technology was used to establish and sequence homozygous dominant fertile plants and homozygous recessive sterile plants in the F2 generation. Differentially identified SNPs in the fertility and sterility gene pools were screened, and the identified differentially identified sites were verified using KASP genotyping and protein three-dimensional structure prediction.

[0008] The overall technical concept of this invention is:

[0009] The KASP molecular marker TMSK23, associated with reverse thermosensitive nuclear male sterility in eggplant, has a SNP site corresponding to a C-to-G mutation at nucleotide position 85,846,822 on eggplant chromosome 6, leading to different fertility phenotypes in eggplant. The base sequence of nucleotide position 85,846,822 on eggplant chromosome 6 is shown in SEQ ID No. 4, wherein:

[0010] When the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is GG, the eggplant is sterile.

[0011] When the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is the CC genotype, the eggplant is homozygous and fertile.

[0012] When the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is the GC genotype, the eggplant is heterozygous and fertile.

[0013] Applications of the KASP molecular marker TMSK23 associated with reverse thermosensitive nuclear male sterility in eggplant include:

[0014] (1) Application in detecting the reverse thermosensitive nuclear male sterility gene in eggplant, or the genotype of the gene;

[0015] (2) Application in screening or detecting eggplants with reverse thermosensitive male sterility phenotype;

[0016] (3) Application in identifying reverse thermosensitive nuclear male sterility in eggplant;

[0017] (4) Application in the preparation of reverse thermosensitive nuclear male sterile transgenic eggplant;

[0018] (5) Application in the seed production of reverse thermosensitive genic male sterile eggplant.

[0019] The specific technical concept of this invention also includes:

[0020] The identification or detection includes using a substance that detects polymorphism or genotype at nucleotide position 85,846,822 on chromosome 6 of eggplant to detect the genotype of the eggplant, and identifying or assisting in the identification of the eggplant's fertility phenotype based on the genotype of the eggplant to be tested.

[0021] The 85846822nd nucleotide site is a molecular marker SNP site associated with reverse thermosensitive nuclear male sterility in eggplant, such as nucleotide 815 of SEQ ID No. 4, whose nucleotide type is G or C;

[0022] The genotype at the 85,846,822nd nucleotide site on chromosome 6 of the eggplant is the GG genotype, and the eggplant to be tested is sterile.

[0023] The genotype at nucleotide position 85846822 on chromosome 6 of the eggplant is the CC genotype, and the eggplant to be tested is homozygous and fertile.

[0024] The genotype at nucleotide position 85846822 on chromosome 6 of the eggplant is the GC genotype, and the eggplant to be tested is heterozygous and fertile.

[0025] The substance used to detect the polymorphism or genotype at locus 85846822 on chromosome 6 of eggplant is as follows: A1), A2), or A3):

[0026] A1) The polymorphic or genotype material contains KASP primers that amplify the 85,846,822nd nucleotide site on eggplant chromosome 6.

[0027] The polymorphic or genotype substance mentioned in A2) is a KASP primer reagent containing the KASP primers mentioned in A1);

[0028] A3) A kit containing the KASP primers described in A1) or the KASP primer reagents described in A2).

[0029] The KASP primers are a primer set consisting of single-stranded DNA with base sequences as shown in SEQ ID No. 1, single-stranded DNA with base sequences as shown in SEQ ID No. 2, and single-stranded DNA with base sequences as shown in SEQ ID No. 3.

[0030] The application of molecular markers associated with reverse thermosensitive nuclear male sterility in eggplant includes the following steps:

[0031] A. Extracting DNA from seedlings obtained from the F2 generation of the hybrid offspring of eggplant sterile line 05ms and fertile line S132;

[0032] B. Using the F2 seedling DNA from step A as a template, perform PCR amplification using the KASP primers in A1), A2), A3) or SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3. Amplify using a real-time PCR instrument and perform genotyping using the KASP genotyping module that comes with the instrument.

[0033] C. According to the typing results in step B, when the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is GG, the eggplant to be tested is sterile.

[0034] When the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is CC, the eggplant to be tested is homozygous and fertile.

[0035] When the genotype at nucleotide position 85846822 on chromosome 6 of eggplant is GC, the eggplant to be tested is heterozygous and fertile.

[0036] The eggplant thermosensitive karyotype male sterile line 05ms and the fertile line S132 in this application were both provided by the applicant's eggplant research laboratory. The sterility of the sterile line is controlled by a pair of recessive single nuclear genes, and the genetic stability is maintained. KASP primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0037] The KASP primer combination used to amplify the SNP sites includes:

[0038] TMSK23-Primer1:GAAGGTGACCAAGTTCATGCTTGCAGTGTTTGACATGGAATATTC, as shown in SEQ IDNo.1;

[0039] TMSK23-Primer2:GAAGGTCGGAGTCAACGGATTTGCAGTGTTTGACATGGAATATTG, as shown in SEQ ID No. 2.

[0040] TMSK23-PrimerCommon:AATGTGCTTGTAATGCAGTTCGAA, as shown in SEQ ID No. 3.

[0041] The DNA extraction of eggplant F2 generation seedlings in step A was performed using a DNA extraction kit from Chengdu Fuji Biotechnology Co., Ltd.

[0042] In step B, the PCR reaction uses a 10 μL reaction system: 5 μL PARMS PCR Mix (2×), 5 μL DNA extraction buffer (dried), 0.4 μL forward primer, 0.15 μL each of the two reverse primers, and 4.3 μL ddH2O. The PCR amplification program is as follows: 94℃ for 15 min; 94℃ for 20 s, 65℃ for 1 min (10 cycles, decreasing by 0.8℃ per cycle); 94℃ for 20 s, 57℃ for 1 min, for a total of 32 cycles; incubate at 25℃, collect fluorescence signals, and read data.

[0043] In step B, the PCR Mix enzyme was 2X PARMS SNPGentyping PCR Mix developed by Wuhan Jingtai Biotechnology Co., Ltd., which was used as the mix enzyme for PCR reaction and KASP detection.

[0044] Add 5 μL of the above PARMS Mix solution to each of the 96-well PCR wells to be reacted, bringing the total volume to 10 μL. Seal the plate with a membrane, vortex, and place the plate in a real-time PCR instrument for the following program: 94℃ for 15 min; 94℃ for 20 s, 65℃ for 1 min (10 cycles, decreasing by 0.8℃ per cycle); 94℃ for 20 s, 57℃ for 1 min, for a total of 32 cycles; incubate at 25℃, collect fluorescence signals, and read the data.

[0045] The conditions for fluorescence signal acquisition and SNP data analysis in step B are as follows:

[0046] PARMS fluorescence signals can be detected simultaneously with PCR amplification. Both ABI and BioRad series quantitative PCR instruments have built-in genotyping data analysis modules. After PARMS reading, SNP allelic data genotyping can be performed according to the instrument manual. KASP reactions were performed using an Applied Biosystems 7500 Real-Time PCR System, employing the endpoint method for fluorescence signal scanning. ROX fluorescence was used as an internal control. The ΔRn value for each sample [ΔRn=(Rn+)-(Rn-)] was calculated using 7500 Software v2.0.6 for data analysis. All reactions were performed on a 96-well PCR module (Applied Biosystems).

[0047] The essential features and significant technical advancements of this invention are as follows:

[0048] 1. In order to further improve breeding efficiency, this invention provides a KASP molecular marker that is closely linked to eggplant thermosensitive genic male sterility. This molecular marker exhibits cosegregation with the fertility of eggplant thermosensitive genic male sterility, and can accurately identify the genotype of fertile and sterile plants.

[0049] 2. Based on the KASP molecular marker of eggplant thermosensitive genic male sterility, this invention provides a pair of KASP marker primers, which can be used to rapidly identify the fertility phenotype of eggplant, laying a good foundation for the conversion of eggplant thermosensitive genic male sterility genes.

[0050] 3. Compared with the traditional method of identifying plant fertility based on morphological characteristics, fertility traits, and economic traits, molecular markers can identify plant fertility and genotype in advance during the seedling stage. During the breeding process, the genotypes of fertile F2 plants (MSms, MSMS) can be identified. Fertile plants (MSms) can be crossed with sterile plants (msms) for breeding, effectively avoiding the problem of excessive side-crossing during the breeding process and improving the efficiency of breeding.

[0051] 4. Compared with first-generation molecular markers (RELP, RADP, AFLP) and second-generation molecular markers (SSR, ISSR), competitive allele-specific polymerase chain reaction (KASP) is a novel genotyping technology based on single nucleotide polymorphisms (SNPs), enabling high-throughput screening of a large number of SNPs daily. It features high throughput, high speed, high accuracy, high flexibility, short detection cycle, and low cost.

[0052] 5. The molecular marker TMSK23 can effectively genotype male-sterile lines and restorer lines, and is used for marker-assisted selection. The development of this marker provides important technical support for the targeted introduction of male-sterile traits, broadening the genetic basis of eggplant germplasm, creating reverse temperature-sensitive male-sterile inbred lines with superior traits, improving hybrid seed production efficiency, and breeding new male-sterile eggplant varieties. Attached Figure Description

[0053] The accompanying drawings of this invention are as follows:

[0054] Figure 1 This is a schematic diagram of the genotyping results of the molecular marker TMSK23 in the F2 generation.

[0055] pass Figure 1 As can be seen, the scatter plot is divided into three parts: circles represent genotype C, indicating homozygous fertile plants; triangles represent genotype G, indicating homozygous sterile plants; and squares represent genotype GC, indicating heterozygous fertile plants.

[0056] Figure 2 This is a schematic diagram comparing the floral morphology of the wild-type fertile line and the reverse thermosensitive nuclear male sterile line 05ms.

[0057] Note: The anthers of the fertile line are full and normal in both periods; the anthers of the sterile line turn brown and shrunken in the low temperature period, but are full and normal in the high temperature period. Detailed Implementation

[0058] The present invention will be further described below with reference to embodiments, but this is not intended to limit the present invention. The scope of protection of the present invention shall be determined by the contents of the claims. Any equivalent technical means substitution made in accordance with the specification shall not depart from the scope of protection of the present invention.

[0059] Example 1

[0060] The KASP molecular marker TMSK23, associated with reverse thermosensitive nuclear male sterility in eggplant, has a SNP site corresponding to a C-to-G mutation at nucleotide position 85,846,822 on eggplant chromosome 6, leading to different fertility phenotypes in eggplant. The base sequence of nucleotide position 85,846,822 on eggplant chromosome 6 is shown in SEQ ID No. 4, wherein:

[0061] When the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is GG, the eggplant is sterile.

[0062] When the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is the CC genotype, the eggplant is homozygous and fertile.

[0063] When the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is the GC genotype, the eggplant is heterozygous and fertile.

[0064] Applications of the KASP molecular marker TMSK23 associated with reverse thermosensitive nuclear male sterility in eggplant include:

[0065] (1) Application in detecting the reverse thermosensitive nuclear male sterility gene in eggplant, or the genotype of the gene;

[0066] (2) Application in screening or detecting eggplants with reverse thermosensitive male sterility phenotype;

[0067] (3) Application in identifying reverse thermosensitive nuclear male sterility in eggplant;

[0068] (4) Application in the preparation of reverse thermosensitive nuclear male sterile transgenic eggplant;

[0069] (5) Application in the seed production of reverse thermosensitive genic male sterile eggplant.

[0070] The identification or detection includes using a substance that detects polymorphism or genotype at nucleotide position 85,846,822 on chromosome 6 of eggplant to detect the genotype of the eggplant, and identifying or assisting in the identification of the eggplant's fertility phenotype based on the genotype of the eggplant to be tested.

[0071] The 85846822nd nucleotide site is a molecular marker SNP site associated with reverse thermosensitive nuclear male sterility in eggplant, such as nucleotide 815 of SEQ ID No. 4, whose nucleotide type is G or C;

[0072] The genotype at the 85,846,822nd nucleotide site on chromosome 6 of the eggplant is the GG genotype, and the eggplant to be tested is sterile.

[0073] The genotype at nucleotide position 85846822 on chromosome 6 of the eggplant is the CC genotype, and the eggplant to be tested is homozygous and fertile.

[0074] The genotype at nucleotide position 85846822 on chromosome 6 of the eggplant is the GC genotype, and the eggplant to be tested is heterozygous and fertile.

[0075] The substance used to detect the polymorphism or genotype at locus 85846822 on chromosome 6 of eggplant is as follows: A1), A2), or A3):

[0076] A1) The polymorphic or genotype material contains KASP primers that amplify the 85,846,822nd nucleotide site on eggplant chromosome 6.

[0077] The polymorphic or genotype substance mentioned in A2) is a KASP primer reagent containing the KASP primers mentioned in A1);

[0078] A3) A kit containing the KASP primers described in A1) or the KASP primer reagents described in A2).

[0079] The KASP primers are a primer set consisting of single-stranded DNA with base sequences as shown in SEQ ID No. 1, single-stranded DNA with base sequences as shown in SEQ ID No. 2, and single-stranded DNA with base sequences as shown in SEQ ID No. 3.

[0080] The application of the KASP molecular marker TMSK23 associated with reverse thermosensitive nuclear male sterility in eggplant includes the following steps:

[0081] A. Extracting DNA from seedlings obtained from the F2 generation of the hybrid offspring of eggplant sterile line 05ms and fertile line S132;

[0082] B. Using the F2 seedling DNA from step A as a template, perform PCR amplification using the KASP primers in A1), A2), A3) or SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3. Amplify using a real-time PCR instrument and perform genotyping using the KASP genotyping module that comes with the instrument.

[0083] C. According to the typing results in step B, when the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is GG, the eggplant to be tested is sterile.

[0084] When the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is CC, the eggplant to be tested is homozygous and fertile.

[0085] When the genotype at nucleotide position 85846822 on chromosome 6 of eggplant is GC, the eggplant to be tested is heterozygous and fertile.

[0086] The eggplant thermosensitive karyotype male sterile line 05ms and the fertile line S132 in this application were both provided by the applicant's eggplant research laboratory. The sterility of the sterile line is controlled by a pair of recessive single nuclear genes, and the genetic stability is maintained. The Kasp primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0087] The KASP primer combination used to amplify the SNP sites includes:

[0088] TMSK23-Primer1:GAAGGTGACCAAGTTCATGCTTGCAGTGTTTGACATGGAATATTC, as shown in SEQ IDNo.1;

[0089] TMSK23-Primer2:GAAGGTCGGAGTCAACGGATTTGCAGTGTTTGACATGGAATATTG, as shown in SEQ ID No. 2.

[0090] TMSK23-PrimerCommon:AATGTGCTTGTAATGCAGTTCGAA, as shown in SEQ ID No. 3.

[0091] The DNA extraction of eggplant F2 generation seedlings in step A was performed using a DNA extraction kit from Chengdu Fuji Biotechnology Co., Ltd.

[0092] In step B, the PCR reaction uses a 10 μL reaction system: 5 μL PARMS PCR Mix (2×), 5 μL DNA extraction buffer (dried), 0.4 μL forward primer, 0.15 μL each of the two reverse primers, and 4.3 μL ddH2O. The PCR amplification program is as follows: 94℃ for 15 min; 94℃ for 20 s, 65℃ for 1 min (10 cycles, decreasing by 0.8℃ per cycle); 94℃ for 20 s, 57℃ for 1 min, for a total of 32 cycles; incubate at 25℃, collect fluorescence signals, and read data.

[0093] In step B, the PCR Mix enzyme was 2X PARMS SNPGentyping PCR Mix developed by Wuhan Jingtai Biotechnology Co., Ltd., which was used as the mix enzyme for PCR reaction and KASP detection.

[0094] Add 5 μL of the above PARMS Mix solution to each of the 96-well PCR wells to be reacted, bringing the total volume to 10 μL. Seal the plate with a membrane, vortex, and place the plate in a real-time PCR instrument for the following program: 94℃ for 15 min; 94℃ for 20 s, 65℃ for 1 min (10 cycles, decreasing by 0.8℃ per cycle); 94℃ for 20 s, 57℃ for 1 min, for a total of 32 cycles; incubate at 25℃, collect fluorescence signals, and read the data.

[0095] The conditions for fluorescence signal acquisition and SNP data analysis in step B are as follows:

[0096] PARMS fluorescence signals can be detected simultaneously with PCR amplification. Both ABI and BioRad series quantitative PCR instruments have built-in genotyping data analysis modules. After PARMS reading, SNP allelic data genotyping can be performed according to the instrument manual. KASP reactions were performed using an Applied Biosystems 7500 Real-Time PCR System, employing the endpoint method for fluorescence signal scanning. ROX fluorescence was used as an internal control. The ΔRn value for each sample [ΔRn=(Rn+)-(Rn-)] was calculated using 7500 Software v2.0.6 for data analysis. All reactions were performed on a 96-well PCR module (Applied Biosystems).

[0097] I. Field trait identification

[0098] 356 F2 plants obtained by self-pollination of the F1 generation of eggplant thermosensitive genic male sterile line 05ms and fertile line S132 were transplanted into a greenhouse on March 22nd. Fertility was assessed at the flowering period (low-temperature sterility period) at the end of April. The F2 population showed 264 fertile plants and 92 sterile plants. Individual fertile plants (MSms, MSMS) from the F2 population were saved for seed production and planted separately, with each planting group consisting of 40 plants. Based on the fertility segregation within the F3 generation, the genotypes of fertile plants in the F2 generation were deduced. 75 pure dominant fertile plants (MSMS) and 188 heterozygous fertile plants (MSms) were found in the F2 generation. Detailed results are shown in Table 1.

[0099] II. Plant DNA Extraction

[0100] DNA was extracted from the leaves of 356 individual plants from the F2 generation (genotypes MSMS, MSms, and msms) of the eggplant sterile line 05ms and fertile line S132 parents and the F1 generation (genotype MSms) of the hybrid (genotype MSms). The DNA was extracted from the leaves using a DNA extraction kit from Chengdu Fuji Biotechnology Co., Ltd.

[0101] III. Construction of DNA Gene Pool and Sequencing

[0102] Thirty extremely homozygous fertile plants and thirty extremely sterile plants were selected from the F2 generation of eggplant. DNA was extracted and mixed in equal amounts to construct a fertile DNA pool (MSMS) and a sterile DNA pool (msms). DNA from the parental single plants and the two extreme pools was sequenced using BSA-seq technology.

[0103] IV. Sequencing Data Analysis

[0104] (1) Data quality control

[0105] The total Clean Data obtained from sequencing was 116.07 Gbp, with a Q30 of 94.28. The average alignment efficiency between the sample and the reference genome was 99.66%, the average coverage depth was 24.25X, and the genome coverage was 90.78% (at least one base covered).

[0106] (2) Mutation detection

[0107] SNP detection: A total of 720,248 SNPs were obtained between the parents, of which 6,783 were nonsynonymous mutations; a total of 127,054 SNPs were obtained between the mixed pools, of which 900 were nonsynonymous mutations. InDel detection: A total of 96,493 Small InDels were obtained between the parents; a total of 27,905 Small InDels were obtained between the mixed pools.

[0108] (3) Association Analysis

[0109] SNP Results: The SNP-index association algorithm yielded 7 candidate regions related to the trait, with a total length of 27.89 Mb; the ED association algorithm yielded 1 candidate region related to the trait, with a total length of 7.03 Mb. The intersection of the two methods yielded another candidate region related to the trait, with a total length of 7.03 Mb. InDel Results: The InDel-index association algorithm yielded 15 candidate regions related to the trait, with a total length of 15.96 Mb; the ED association algorithm yielded 8 candidate regions related to the trait, with a total length of 17.65 Mb. The intersection of the two methods yielded another candidate region related to the trait, with a total length of 6.00 Mb.

[0110] Results of SNP and InDel intersection: Taking the intersection of the SNP and InDel associated regions, a total of 1 candidate region related to the trait was obtained, located at loci 83669840 to 89668480 on chromosome 6, with a total length of 6.00 Mb. This associated region contains a total of 709 genes, including 31 nonsynonymous mutant genes and 3 frameshift mutant genes.

[0111] V. Develop molecular markers for KASP validation

[0112] A polymorphic SNP molecular marker was developed between parents in the region of chromosome 6 from 83669840 to 89668480. KASP detection was performed on the parents and the above-mentioned F2 generation population. Combined analysis of genotyping and phenotypic identification, the mutation site at position 85846822 (located in the CDS sequence of gene Smechr0602754.1, where the 875th base is changed from C to G, causing premature termination of the amino acid sequence translation) was screened out, and the highest accuracy was found in fertility surveys.

[0113] VI. Identification of plant fertility genotypes using the KASP genotyping method

[0114] KASP primers were designed based on the candidate gene SNP locus 85846822 on eggplant chromosome 6. The primer combination includes:

[0115] TMSK23-Primer1: GAAGGTGACCAAGTTCATGCTTGCAGTGTTTGACATGGAATATTC, as shown in SEQ IDNo.1;

[0116] TMSK23-Primer2: GAAGGTCGGAGTCAACGGATTTGCAGTGTTTGACATGGAATATTG, as shown in SEQ ID No. 2.

[0117] TMSK23-PrimerCommon: AATTGTGCTTGTAATGCAGTTCGAA, as shown in SEQ ID No. 3.

[0118] PCR amplification reaction

[0119] The PCR reaction used a 10 μL reaction system: 5 μL PARMS PCR Mix (2×), 5 μL DNA extraction buffer (dried), 0.4 μL forward primer, 0.15 μL each of the two reverse primers, and 4.3 μL ddH2O;

[0120] PCR amplification program: 94℃ for 15 min; 94℃ for 20 s, 65℃ for 1 min (10 cycles, decreasing by 0.8℃ per cycle); 94℃ for 20 s, 57℃ for 1 min, for a total of 32 cycles; incubate at 25℃, collect fluorescence signals, and read data.

[0121] Amplification was performed using a real-time PCR instrument, and SNP allelic data were genotyped using the instrument's built-in Genotyping data analysis module. Plant lines with polymorphism G at SNP locus 85846822 were homozygous sterile plants, those with polymorphism C were homozygous fertile plants, and those with polymorphism GC were heterozygous fertile plants.

[0122] KASP genotyping results for eggplant sterility genes: Among 356 F2 generation eggplant plants, 188 were heterozygous fertile, 75 were homozygous fertile, and 92 were sterile. Except for plant number 254, which showed no SNP genotyping results, the expression of other plants was consistent with field traits, verifying the reliability of the candidate SNP locus. Specific results are shown in Table 1 and... Figure 1 .

[0123] Table 1. KASP genotyping and field data results for the temperature-sensitive male sterility SNP locus 85846822 in eggplant.

[0124]

[0125]

[0126]

[0127]

[0128]

[0129] Note: M represents infertile; F represents fertile; Y represents homozygous fertile; Z represents heterozygous fertile.

[0130] Example 2

[0131] Seed purity identification using the molecular marker TMSK23

[0132] I. Field trait identification

[0133] Eggplant thermosensitive kernicterus male-sterile line 05ms and fertile line S63 were planted in open field without isolation, in close proximity, and seeds were collected after natural pollination. The self-crossed male-sterile line was then transplanted into a greenhouse on March 20, 2023. Fertility was assessed at the end of April during the flowering period (low-temperature sterility period). The survey of 50 plants revealed that 7 were sterile and the other 43 were fertile.

[0134] II. Seedling cultivation and DNA extraction

[0135] The eggplant seedlings were cultured as follows: eggplant seeds were soaked and germinated until they sprouted, then sown in seedling trays. After the plants had grown 2-3 true leaves, DNA was extracted from the leaves using a DNA extraction kit from Chengdu Fuji Biotechnology Co., Ltd.

[0136] II. Identification of plant genotypes using the KASP typing method

[0137] PCR amplification was performed using the KASP primer TMSK23 provided by the present invention. The PCR method mentioned in Example 1 was used for amplification and data reading. After detection, the data was genotyped.

[0138] Plants with polymorphism G at SNP locus 85846822 are homozygous sterile plants, while plants with polymorphism GC are heterozygous fertile plants. The identification results are consistent with the field trait expression, verifying the reliability of the marker. The results are shown in Table 2 and can be used for seed purity identification.

[0139] Table 2. Genotyping and field data results of the TMSK23 molecular marker for eggplant temperature-sensitive male sterility.

[0140] serial number SNP site Field characteristics serial number SNP site Field characteristics 1 GC F 26 GC F 2 GC F 27 GC F 3 GC F 28 GC F 4 GC F 29 GC F 5 GC F 30 GC F 6 GC F 31 GC F 7 GC F 32 GC F 8 GC F 33 GC F 9 GC F 34 GC F 10 GC F 35 GC F 11 GC F 36 GC F 12 GC F 37 GC F 13 G M 38 G M 14 GC F 39 GC F 15 G M 40 GC F 16 GC F 41 GC F 17 GC F 42 GC F 18 GC F 43 G M 19 GC F 44 GC F 20 GC F 45 GC F 21 GC F 46 G M 22 GC F 47 GC F 23 GC F 48 GC F 24 G M 49 G M 25 GC F 50 GC F

[0141] Note: M represents infertility; F represents fertility.

[0142] Example 3

[0143] Improving Transformation Efficiency Using Molecular Marker TMSK23

[0144] I. Field trait identification

[0145] The eggplant thermosensitive kernicterus male-sterile line 05ms was crossed with four superior fertile round eggplant inbred lines. Through continuous hybridization and backcrossing, the sterility gene was transferred into the superior round eggplant inbred lines, creating four new round eggplant thermosensitive kernicterus male-sterile germplasm (22-4, 22-7, 22-12, and 22-14). All four lines had a sterility rate of over 98% and a sterility rate of 100%, laying a material foundation for hybrid seed production using the round eggplant thermosensitive kernicterus line. To evaluate the fertility of these four newly created sterile materials, the self-pollinated varieties of the sterile lines were transplanted into greenhouses on March 20, 2023, and fertility was assessed at the end of April during the flowering period (low-temperature sterility period). The investigation revealed that all 16 plants in category 22-4 were sterile; all 29 plants in category 22-7 were sterile; all 13 plants in category 22-12 were sterile; and all 16 plants in category 22-14 were sterile.

[0146] II. DNA Extraction

[0147] On April 28, the first new leaf from the top of the plant was taken, and DNA was extracted from the fresh leaf using a DNA extraction kit from Chengdu Fuji Biotechnology Co., Ltd.

[0148] II. Identification of plant genotypes using the KASP typing method

[0149] PCR amplification was performed using the KASP primer TMSK23 provided by the present invention. The PCR method mentioned in Example 1 was used for amplification and data reading. After detection, the data was genotyped.

[0150] Plants with the polymorphism G at SNP locus 85846822 were homozygous sterile plants, while those with the polymorphism GC were heterozygous fertile plants. The identification results are shown in Table 3. Plants 22-4, 22-7, and 22-12 all exhibited the sterile genotype (G), completely consistent with the field phenotypic identification results. Of the 16 plants in 22-14, 15 exhibited the sterile genotype (G), while one plant had the heterozygous fertile genotype (GC). In summary, the concordance rate between the molecular marker results of the 74 plants and the field phenotypic identification results was 98.65%, further verifying the high reliability of this marker. The application of this marker can identify the fertility of converted offspring before transplanting at the seedling stage, allowing for the transplanting of only sterile plants, saving manpower, resources, and planting area, greatly improving conversion efficiency, and accelerating the process of breeding superior varieties.

[0151] Table 3. Genotyping and field data results of the TMSK23 molecular marker for eggplant temperature-sensitive male sterility.

[0152]

[0153]

[0154] Note: M represents infertility; F represents fertility.

Claims

1. The KASP molecular marker TMSK23 associated with reverse thermosensitive nuclear male sterility in eggplant, characterized by... The SNP locus corresponds to the nucleotide locus C at the 85,846,822nd position on chromosome 6 of eggplant, which mutates to G. The 85,846,822nd nucleotide locus is the 815th nucleotide of SEQ ID No. 4, resulting in different fertility phenotypes of eggplant. The base sequence of the KASP molecular marker is as shown in SEQ ID No. 4, where: When the genotype of the nucleotide locus at the 85,846,822nd position on chromosome 6 of eggplant is the GG genotype, the eggplant is sterile; When the genotype of the nucleotide locus at the 85,846,822nd position on chromosome 6 of eggplant is the CC genotype, the eggplant is homozygous fertile; When the genotype of the nucleotide locus at the 85,846,822nd position on chromosome 6 of eggplant is the GC genotype, the eggplant is heterozygous fertile.

2. The application of the KASP molecular marker TMSK23 associated with reverse thermosensitive nuclear male sterility in eggplant according to claim 1, characterized in that... Including: (1) Application in screening or detecting eggplants with reverse thermo-sensitive genic male sterility phenotype; (2) Application in identifying the reverse thermo-sensitive genic male sterility trait of eggplant; (3) Application in preparing transgenic eggplants with reverse thermo-sensitive genic male sterility; (4) Application in seed production of eggplants with reverse thermo-sensitive genic male sterility.

3. The application according to claim 2, characterized in that... The said identification or detection includes using substances that detect the polymorphism or genotype of the nucleotide locus at the 85,846,822nd position on chromosome 6 of eggplant to detect the genotype of eggplant, and identifying or assisting in identifying the fertility phenotype of eggplant according to the genotype of the tested eggplant: The 85,846,822nd nucleotide locus is the SNP locus of the molecular marker related to reverse thermo-sensitive genic male sterility of eggplant, such as the 815th nucleotide of SEQ ID No. 4, and its nucleotide types are G or C; When the genotype of the nucleotide locus at the 85,846,822nd position on chromosome 6 of the said eggplant is the GG genotype, the tested eggplant is sterile; When the genotype of the nucleotide locus at the 85,846,822nd position on chromosome 6 of the said eggplant is the CC genotype, the tested eggplant is homozygous fertile; When the genotype of the nucleotide locus at the 85,846,822nd position on chromosome 6 of the said eggplant is the GC genotype, the tested eggplant is heterozygous fertile.

4. The application according to claim 3, characterized in that... The substance for detecting the polymorphism or genotype of the 85,846,822nd locus on chromosome 6 of eggplant is as follows A1): A1) The substance for detecting polymorphism or genotype contains KASP primers that amplify the nucleotide locus at the 85,846,822nd position on chromosome 6 of the said eggplant.

5. The application according to claim 4, characterized in that... The said KASP primers are a primer set composed of single-stranded DNA with a base sequence as shown in SEQ ID No. 1, single-stranded DNA with a base sequence as shown in SEQ ID No. 2, and single-stranded DNA with a base sequence as shown in SEQ ID No.

3.

6. The application according to claim 4 or 5, characterized in that... Including the following steps: A. Extract the DNA of the seedlings obtained from the F2 generation of the hybrid of the sterile line 05ms and the fertile line S132 of eggplant; B. Using the F2 generation seedling DNA in step A as a template, perform PCR amplification with the KASP primers in claim 4 or 5, perform amplification with a fluorescence quantitative PCR instrument, and perform detection and genotyping with the KASP genotyping module supporting the instrument; C. According to the typing results in step B, when the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is GG, the eggplant to be tested is sterile. When the genotype at the 85,846,822nd nucleotide site on chromosome 6 of eggplant is CC, the eggplant to be tested is homozygous and fertile. When the genotype at nucleotide position 85846822 on chromosome 6 of eggplant is GC, the eggplant to be tested is heterozygous and fertile.

Images