Rs334225108 site snp molecular marker related to live birth number trait of large white pig and application thereof
By screening the rs334225108 SNP molecular marker using LcWGS, primer pairs and kits were designed, solving the genetic improvement problem of the live piglet number trait in Large White pigs and improving the reproductive performance and production efficiency of sows.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-08
- Publication Date
- 2026-06-05
AI Technical Summary
Existing technologies are insufficient to effectively improve the number of live piglets produced in Large White pigs, as there is a lack of relevant genetic markers and detection methods, which affects the annual productivity of sows and the economic benefits of pig farming.
Genome-wide association analysis was performed using low-depth resequencing (LcWGS) technology to screen for the rs334225108 SNP molecular marker, which was significantly associated with the number of live piglets produced in Large White pigs. Specific primer pairs and kits were designed for detection, and strains with the T/T genotype were selected for breeding.
It significantly increased the number of live piglets produced in Large White pigs, improved the reproductive performance and production efficiency of sows, and provided a theoretical basis and practical means for genetic improvement.
Smart Images

Figure CN122146894A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biotechnology and livestock breeding, and relates to the rs334225108 SNP molecular marker associated with the live piglet count trait in Large White pigs and its application. This molecular marker is located at base 14804839 of chromosome 3 of pigs. Background Technology
[0002] Large White pigs are one of the main breeds in intensive pig farming globally, holding a significant position in my country's breeding pig market due to their advantages in reproductive performance and growth rate. Live piglet count (NBA) is a core economic trait for measuring sow reproductive efficiency, directly impacting the economic benefits of pig production and influencing sow productivity per sow (PSY). Increasing the NBA can significantly increase PSY and sow productivity, which is crucial for improving the high-quality development and profitability of my country's pig industry. [1] In recent years, the development of molecular breeding technology has provided an effective means for the genetic improvement of traits with low heritability and limited traits, laying a technical foundation for breeding such traits.
[0003] Low-depth resequencing (LcWGS) is a cost-effective and efficient large-scale SNP genotyping strategy. Its core idea is to perform low-coverage sequencing on a large number of samples and then use genotype imputation techniques to accurately infer missing sites in the sequencing data, ultimately obtaining a high-density SNP dataset covering the entire genome. Compared to other genotyping techniques, LcWGS has significant advantages in genome coverage, high-density genetic marker identification, and detection costs, and has been successfully applied to genome-wide association studies (GWAS) and genome selection (GS) in animals such as humans, pigs, cows, and sheep. [2] Studies have confirmed that LcWGS performs well in GWAS analysis of important economic traits in pigs. [3] Wang Xiaoqing et al. used LcWGS to perform GWAS analysis on the reproductive traits of 1423 Large White pigs, screening out potential candidate genes such as EPC2 and MBD, as well as related genetic marker loci. [4] Lü Lingyan et al. used low-depth sequencing data after genotype filling for GWAS analysis, which effectively improved the reliability of candidate gene discovery and the accuracy of pig genome breeding while reducing sequencing costs, providing important technical support for the genetic improvement of pig reproductive traits. [5] . Summary of the Invention
[0005] To overcome the shortcomings of existing technologies, the primary objective of this invention is to provide a molecular marker for the rs334225108 locus SNP related to the live piglet count trait in Large White pigs and its application, to screen genetic markers associated with the live piglet count trait in Large White pigs, and to provide a detection method for the corresponding SNP locus, thereby providing new loci and theoretical basis for marker-assisted selection of the live piglet count trait in Large White pigs.
[0006] The nucleotide sequence of the above SNP molecular marker is shown in SEQ ID NO.1. There is a T>C base mutation at position 351 of the sequence. This site is significantly associated with the number of live piglets produced in Large White pigs.
[0007] Another object of the present invention is to provide the application of the above-mentioned SNP molecular markers in the following aspects: a) screening for pig breeds with high live piglet counts; b) increasing the live piglet count of Large White sows.
[0008] To achieve the above objectives, the present invention adopts the following technical solution: The rs334225108 SNP molecular marker, associated with the live piglet count trait in Large White pigs, is located at chr3:14804839 in the genome version EnsemblSscrofa11.1, with a polymorphism R of either T or C. The SNPs screened in this invention can serve as molecular markers for the live piglet count trait in pigs. For the rs334225108 locus, breeds with the T / T genotype should be selected for breeding, as the T / T genotype significantly increases the live piglet count.
[0009] The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.1; the SNP molecular marker is located at position 351 (R in the sequence) of the nucleotide sequence shown in SEQ ID NO.1.
[0010] TAACCCCCGGCAACCACTATTCTGTCTTCCTTTTCTAAAACGCTGTGCTCCAGAGAGTAACATCCCCAGAGGCCTTGTTTCCTGTAGGGAGTGTACCTAGGCCCAGATGGACATTAATCTCGAACCCACTGTGACTCAGTTTATGGGAAGAAACGGGCAAACAATCCATGAGACT TATGGGGCATTTCCACCCTAAGACCCCTATTGGACAAGGACTGATACAGGTAACTGGGCAAGGCCAATGGGAGAAAAACCACATCTTTCTGGACCTCACGTTGGTAACCCCCATCCTGAAGGGATAAAAACCTCTATAGGACAATGGGGTTGGGGGGAACCTTGTCTTCCCCCT RCCAGCTGTCCTGGGAGCTGTTTGCTTTCCTGTAGGAAAGACTGTGCTCGCTTGCAAAAAAAAGTTATATAGATTCAGAGACAAGATGGTGGAGGAGAAGGACTCAAGCTCCTCTCCTCCTGAAAACACCCAAATTACAACTAACCACTGAACAAACATCAACAAAATAGACT GGAAACTACCCAAAAGGATAGCCTACAGCCAAAACCAAAAAAGAGCCACATCAAGATGGCAGGAGGGGGGCTTTCATGATAAAAGCAATCCCATACCCACCCAGTGGGCAACCCAGTCTGAAAAATAGCTACATCACAGAGGCTCTCCCACAGGAGTGAGAGTTCTAAACCCCACA A primer pair for detecting the above-mentioned SNP molecular markers, the nucleotide sequence of which is as follows: Forward primer: 5'-TCACGTTGGTAACCCCCATC-3'; (SEQ ID NO.2); Reverse primer: 5'-CTGGGTGGGTATGGGATTGC-3'; (SEQ ID NO.3).
[0011] The application of the aforementioned molecular markers or primer pairs in pig breeding includes screening for pig breeds with high live piglet counts and increasing the live piglet count of Large White sows.
[0012] A kit for detecting the above-mentioned molecular markers, comprising the above-mentioned primer pairs.
[0013] The above-mentioned kits are used in screening pig breeds with high live piglet counts or in breeding to increase the live piglet count of Large White sows.
[0014] A method for identifying pig breeds with high live piglet production includes the following steps: detecting the SNP locus of the molecular marker described in claim 1 or 2 on chromosome 3 of pigs, determining the live piglet production based on the genotype of the SNP locus, wherein the TT genotype of the SNP locus produces the most live piglets, the TC genotype produces a moderate number of live piglets, and the CC genotype produces the fewest live piglets.
[0015] A method for screening pig breeds with high live piglet counts includes the following steps: detecting the SNP site of the molecular marker described in claim 1 or 2 on pig chromosome 3, eliminating individuals whose single nucleotide of the SNP site is C, and retaining individuals whose single nucleotide of the SNP site is T as breeding pigs; the pig breed is Canadian Large White.
[0016] A method for improving pig breeds includes the following steps: detecting the chromosome 3 of pigs described above. SNP molecular markers are used to select breeds with the TT genotype for breeding, thereby increasing the number of live piglets and improving the reproductive performance of sows.
[0017] Compared with the prior art, the beneficial effects of the present invention are: This invention utilizes LcWGS to perform GWAS analysis on the live piglet count trait in Large White pigs, screening for SNP loci significantly associated with live piglet count. It provides the rs334225108 SNP molecular marker related to the live piglet count trait in Large White pigs. This SNP molecular marker is located at chr3:14804839 in the genome version EnsemblSscrofa11.1, with the polymorphism R being either T or C. The SNP screened in this invention can serve as a molecular marker for the live piglet count trait in pigs. For the rs334225108 locus, breeds with the T / T genotype should be selected for breeding, as the T / T genotype significantly increases the live piglet count. Genetic variation at this locus has a significant impact on the live piglet count in Large White pigs, representing a large-effect variation locus, and has great application potential in molecular marker breeding for the Large White piglet count trait. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0019] Figure 1Distribution density map of all SNPs identified in Example 1 on pig autosomes; Figure 2 Example 1: Histogram of frequency distribution of live piglet number trait (NBA) in Large White pigs; Figure 3 Example 1: Manhattan plot of genome-wide association analysis results for Large White piglet number (NBA) trait; SNPs with smaller P-values above the threshold at chr3:14804839 were selected for further analysis. Different colored bars represent different chromosomes of the pig, dashed lines represent reference significance thresholds, and solid lines represent genome-wide significance thresholds. Figure 4 Example 1: Genotypic effect diagram of the significant association locus chr3:14804839 SNP for the Large White piglet number trait (NBA); the vertical axis represents the phenotypic value of the number of live piglets produced, and the horizontal axis represents the genotypes TT, CT, and CC of the three groups. Detailed Implementation
[0020] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0021] Example 1: Genome-wide association analysis of genotyping and live offspring number trait (1) Blood samples were collected from 679 Danish Large White pigs at XX pig farm in Shaanxi Province. DNA was extracted from the samples and subjected to low-depth (1×) whole-genome resequencing to obtain initial genotyping data. QUILT2 was used to fill the initial genotype data with genotypes. PLINK v1.9.0 software was then used to perform quality control filtering on the filled data, retaining SNP loci with MAF > 0.05 and a genotype detection rate greater than 0.9. After quality control screening, a total of 5,756,902 SNP loci were obtained for subsequent genome-wide association analysis. The SNPs obtained from the quality control screening were distributed on all 18 pig autosomes, and their genome coverage and distribution density are as follows: Figure 1 As shown, the quality-controlled data covered the entire genome, and the marker density was evenly distributed across 18 euchromatograms, confirming its suitability for genome-wide association analysis.
[0022] (2) Data processing of the live piglet number phenotypic traits of Large White pigs, using... yc =EBV+ ePhenotypic values of the live piglet number trait (NBA) in 679 Large White pigs were corrected to obtain standardized phenotypic values for subsequent GWAS studies. The frequency distribution histogram of the Large White piglet number trait is shown below. Figure 2 As shown, the higher the NBA value, the higher its frequency, and the trait distribution is consistent with the actual production results of the pig farm.
[0023] (3) Based on the QUILT2-filled genotype data, GWAS analysis was performed on the SNP loci and the live piglet number trait in Large White pigs using the MLM model in GCTA v1.94.1. The specific model is as follows: yc = Xα + Zβ + Wμ + e, Where y is the vector of phenotypic values of the number of live piglets produced by Large White pigs; Xα is a fixed effect , Zβ This is a marking effect; Wμ It is a random effect; e This is the vector of random residual effects.
[0024] (4) The significance threshold for genome-wide significance was set at 5 × 10⁻⁶ in this study. -8 The reference significance threshold is 5×10 -6 Using the R package CMPLOT, SNP density plots and Manhattan plots are generated. Figure 3 As shown in the figure, the X-axis represents the 18 chromosomes of pigs, and the Y-axis represents the statistical significance results, expressed in terms of -logi. 10 ( p () indicates. A total of one genome-wide significant SNP locus was identified, located on chromosome 3.
[0025] (5) In this invention, the SNP at accession number rs334225108, located at nucleotide position 14,804,839 on chromosome 3, was further screened from SNP sites above the genome-wide significance threshold. The differences in population phenotypic values among different genotypes at this site and the distribution of the number of individuals with the corresponding phenotypic values are as follows: Figure 4 As shown in the figure. Specifically, the NBA genotype was significantly higher in individuals with the TT genotype than in individuals with the TC and CC genotypes, and the NBA genotype was significantly higher in individuals with the TC genotype than in individuals with the CC genotype. For the SNP loci finally selected, strains with the T / T genotype should be selected for breeding.
[0026] Table 1. Individuals with significantly associated chr3:14804839 SNP loci genotypes for the Large White piglet number trait (NBA). Phenotypic value of live litter number
[0027] Example 2: Amplification of Target DNA Sequence and Application of SNP Sites (1) Design the following primers for the sequence shown in SEQ ID NO.1: Forward primer (SEQ ID NO.2): 5'-TCACGTTGGTAACCCCCATC-3'; Reverse primer (SEQ ID NO.3): 5'-CTGGGTGGGTATGGGATTGC-3'.
[0028] (2) PCR amplification system PCR reaction system: Add 5 μL TaqMix, 0.2 μL each of forward and reverse primers, 1 μL DNA template, and 3.6 μL ddH2O to a 10 μL reaction system. PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 10 s, 35 cycles; final extension at 72℃ for 5 min.
[0029] (3) Finally, the PCR amplified products are sequenced. The gene fragment sequencing requires bidirectional sequencing.
[0030] The sequencing results are shown in SEQ ID NO. 4: TCACGTTGGTAACCCCCATCCTGAAGGGATAAAAACCTCTATAGGACAATGGGGTTGGGGGGAACCTTGTCTTCCCCCTRCCAGCTGTCCTGGGAGCTGTTTGCTTTCCTGTAGGAAAGACTGTGCTCGCTTGCAAAAAAAAGTTATATAGATTCAGAGACAAGATGGTGGAGGAGAAG GACTCAAGCTCCTCTCCTCTCCTGAAAACACCCAAATTACAACTAACCACTGAACAAACATCAACAAAATAGACTGGAAACTACCCAAAAGGATAGCCTACAGCCAAAACCAAAAAAGAGCCACATCAAGATGGCAGGAGGGGGGCTTTCATGATAAAAGCAATCCCATACCCACCCAG; Note: The sequence at the beginning and end of this sequence is bolded to show the sequence corresponding to the primer.
[0031] (4) The present invention provides a method for breed improvement of the number of live piglets produced in pigs, including the following steps: detecting the SNP site (rs334225108 site) at nucleotide 14804839 on chromosome 3 of pigs, selecting the T / T genotype at this site for breeding, thereby increasing the number of live piglets produced in the Large White pig during the production process, so as to improve the reproductive efficiency of sows.
[0032] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
[0033] References: [1] Zhou Mei, Zhang Yu, Wang Chonglong. Research progress on candidate genes for pig litter size trait [J]. Journal of Animal Ecology, 2020, 41(08): 1-6. [2] Zhang Qike. Optimization and clinical application of low-depth whole-genome sequencing genotype filling method [D]; Southern Medical University, 2024. [3] Wang Wenbin. Mining mutation sites related to economic traits in pigs based on low-depth resequencing [D]; Huazhong Agricultural University, 2023. [4] Wang Xiaoqing. Study on filling strategies for low-coverage sequencing data in pigs and the effects of GS and GWAS [D]; Chinese Academy of Agricultural Sciences, 2023. [5] Lv Lingyan, Lin Changhua, Zhang Shengbin, et al. Genome-wide association analysis of pig reproductive traits based on resequencing data [J]. Chinese Journal of Animal Husbandry, 2025, 61(01): 235-41.
Claims
1. A molecular marker at the rs334225108 locus SNP associated with the live piglet count trait in Large White pigs, characterized in that, The SNP molecular marker is located at chr3:14804839 in the genome version Ensembl Sscrofa11.
1.
2. The SNP molecular marker related to the number of live piglets born in Large White pigs according to claim 1, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein there is a single nucleotide mutation site at the 351st base of the sequence, and the polymorphic site is T or C.
3. A primer pair for detecting the molecular marker of claim 1, characterized in that, The nucleotide sequences of the primer pair are as follows: Forward primer: 5'-TCACGTTGGTAACCCCCATC-3' Reverse primer: 5'-CTGGGTGGGTATGGGATTGC-3'.
4. The application of the molecular marker according to claim 1 or 2 or the primer pair according to claim 3 in the breeding of pigs, characterized in that, The applications include a) screening for pig breeds with high live piglet counts; and b) increasing the live piglet count of Large White sows.
5. A kit for detecting the molecular marker of claim 1 or 2, characterized in that, The kit includes the primer pair as described in claim 4.
6. The application of the kit according to claim 5 in screening pig breeds for increasing the number of live piglets produced or in breeding Large White sows.
7. A method for identifying pig breeds with high live piglet counts, characterized in that, The method includes the following steps: detecting the SNP locus of the molecular marker described in claim 1 or 2 on chromosome 3 of pigs, and determining the number of live piglets produced within pigs based on the genotype of the SNP locus: pigs with the T / T genotype of the SNP locus have a higher number of live piglets produced than those with the T / C genotype; pigs with the T / C genotype of the SNP locus have a higher number of live piglets produced than those with the C / C genotype.
8. A method for screening pig breeds with high live piglet count, comprising the following steps: detecting the SNP site of the molecular marker described in claim 1 or 2 on pig chromosome 3, eliminating individuals whose single nucleotide of the SNP site is C, and retaining individuals whose single nucleotide of the SNP site is T as breeding pigs; wherein the pig breed is Large White pig.
9. A method for improving pig breeds, comprising the following steps: Detect the SNP locus described in claim 1 or 2 on chromosome 3 of pigs, select the TT genotype for breeding, increase the number of live piglets produced, and improve the reproductive performance of sows.