SNP molecular marker extremely significantly related to sucrose content of soybean seed for food and its application
By using genome-wide association analysis and PCR amplification technology, we discovered and identified SNP molecular markers related to sucrose content in soybean seeds, which solved the problem of difficult localization in the breeding of soybean varieties and improved breeding efficiency.
Patent Information
- Application Number
- CN202310684785.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-09
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2043-06-09
AI Technical Summary
Existing technologies make it difficult to efficiently locate the major genes responsible for sucrose content in vegetable soybean seeds, leading to difficulties in variety selection.
Genome-wide association analysis revealed SNP molecular markers on soybean chromosome 14 that were significantly associated with sucrose content. Primers were designed and PCR amplification was performed to detect genotypes and identify sucrose content.
This method enables efficient identification of sucrose content in vegetable soybean seeds, significantly improving the efficiency of variety breeding.
Smart Images

Figure CN116837128B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker application technology in crop genetic breeding, specifically involving SNP markers related to sucrose content in vegetable soybeans and their applications. Background Technology
[0002] Vegetable soybeans, also known as edamame, are a general term for soybeans harvested when the seeds are plump and bright green. They have a short maturity period and high economic value. Currently, vegetable soybeans are widely cultivated in the southeastern coastal areas such as Jiangsu, Zhejiang, Fujian, Guangdong, and Guangxi, with some cultivation also in the northeast and southwest regions. Vegetable soybeans have a sweet taste and are rich in nutrients, including protein, isoflavones, folic acid, and trace elements, making them valuable for both food and health. Their sucrose content significantly affects the taste and nutritional quality of vegetable soybeans and is a crucial indicator for grading commercial vegetable soybeans, as well as a core requirement for variety selection.
[0003] The sucrose content of soybeans is a typical quantitative trait with high heritability, indicating the presence of major genes that significantly influence this trait. Traditional mapping methods are generally used for gene localization of sucrose content in crops, but these mapping intervals are large, making it difficult to identify the target gene. Summary of the Invention
[0004] The purpose of this invention is to provide an SNP molecular marker that is highly correlated with the sucrose content of soybean seeds and its application.
[0005] This invention provides an SNP molecular marker related to the sucrose content of soybean seeds. The molecular marker is a T / G polymorphic site at position 151 of the nucleotide sequence shown in SEQ ID NO.1. The genotype G / G indicates a high sucrose content in soybean seeds, and the genotype T / T indicates a low sucrose content in soybean seeds.
[0006] This invention determined the sucrose content of fresh-eating seeds in local soybean germplasm populations in China and performed genome-wide association analysis using 82,187 SNP markers, identifying a significantly associated SNP on chromosome 14. This SNP marker is located on the nucleotide sequence shown in SEQ ID NO.1, with the SNP site at position 151 from the 5' end; the SNP is located at position 45,682,176 (bp) on soybean chromosome 14, falling within the intron region of the Glyma.14G192100 gene.
[0007] The present invention also provides primers or kits for amplifying the SNP molecular markers described herein.
[0008] The present invention also provides the application of the SNP molecular marker, or primers or kits for amplifying the SNP molecular marker of the present invention, in the identification or auxiliary identification of sucrose in vegetable soybean seeds or in the breeding of vegetable soybean seeds.
[0009] A method for identifying the sucrose content of soybean seeds for vegetable use, specifically, involves detecting the genotype of the SNP molecular marker described in this invention.
[0010] The genotype of the SNP molecular marker described in this invention can be detected using conventional methods in the art, such as PCR amplification.
[0011] This invention compares samples from different genotypes at significant loci, with a mean difference of 2.50 mg / g between groups (P < 0.01). Therefore, relatively speaking, genotype G / G is a highly significant molecular marker of high sucrose content, typically greater than 17 mg / g, while genotype T / T is a highly significant molecular marker of low sucrose content, typically less than 15 mg / g.
[0012] This invention uses genome-wide association analysis to discover SNP molecular markers associated with sucrose content in vegetable soybeans, and uses these markers as molecular markers for quality breeding of vegetable soybeans to accelerate the process of variety selection. Attached Figure Description
[0013] Figure 1 Manhattan plot of genome-wide association analysis of sucrose content in vegetable soybean seeds.
[0014] Figure 2 A QQ plot of genome-wide association analysis of sucrose content in soybean seeds for vegetable use. Detailed Implementation
[0015] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.
[0016] Example 1: Phenotypic Data Collection
[0017] 1.1 Cultivation of germplasm materials
[0018] The 133 germplasm accessions used in this invention were planted in 2021 and 2022 at the Jiangsu Academy of Agricultural Sciences and the Wanjiang Base of Nanjing Agricultural University. Both experiments employed a completely randomized block design with a total of three replicates. Each germplasm accession in each replicate was assigned a field planting number, indicating its group, replicate, and germplasm name. Row length was set at 1 meter, row spacing at 0.5 meters, and plant spacing at 0.2 meters, with 6 plants per row. A planting sign was placed every ten rows, clearly indicating the accession number and other information. Other pre-sowing treatments, fertilization, and pest control measures were the same as general field management practices.
[0019] 1.2 Sample Collection
[0020] Sampling was conducted when soybeans reached the R6-R7 stage. Around 9:00 AM, 10 pods were taken from each location on each plant, with 60 pods taken from each row. After sampling, the samples were immediately flash-frozen in liquid nitrogen and then stored in a -40°C freezer.
[0021] 1.3 Determination of sucrose content
[0022] The sucrose content of fresh soybean seeds was determined using a WATERS ACQUITY UPLC H-Class ultra-high performance liquid chromatograph, an UPLC ACQUITY BEHAmide 1.7um*2.1*100mm column, and an evaporative light scattering detector (ELSD). The parameters of the liquid chromatograph are set as shown in Table 1.
[0023] Table 1: Parameters and Conditions of Ultra-High Performance Liquid Chromatography
[0024]
[0025] Example 2: Genome-wide association analysis of sucrose content in vegetable soybeans
[0026] This invention uses the MLM(PCA+K) model in TASSEL v5.2 software to perform genome-wide association analysis on sucrose content in edible soybeans, setting the threshold for significant association between SNP markers and target shapes to -log. 10 (P) =3.5, a highly significantly associated SNP molecular marker was detected at 45682176 (bp) on chromosome 14, and combined with the linkage disequilibrium decay distance of 119.07 kb, the candidate gene Glyma.14G192100 was identified. Figure 1 and Figure 2 The results are detailed in Table 2. This molecular marker is characterized by a T / G polymorphism at position 151 of the nucleotide sequence shown in SEQ ID NO.1. The genotype G / G indicates a high sucrose content in soybean seeds, while the genotype T / T indicates a low sucrose content in soybean seeds.
[0027] Table 2: Genome-wide association analysis of sucrose content in soybean seeds for vegetable use
[0028]
[0029] Example 3: Intergroup comparison of Chr14-45682176
[0030] This locus includes two genotypes: T / T and G / G. The t-test results of the phenotypic mean differences between the different genotype groups are shown in Table 3. The difference between the T / T and G / G groups was highly significant, with a mean difference of 2.5 mg / g. Genotype G / G is a molecular marker for high sucrose content, while genotype T / T is a molecular marker for low sucrose content.
[0031] Table 3 Comparison of mean values between groups
[0032]
[0033] Example 4: Verification of site effectiveness
[0034] To verify the validity of this site, a pair of primers was designed using the sequence of the SNP site containing the significantly related sucrose content of edible soybean obtained in Example 2 as a template. The primer sequences are as follows:
[0035] Forward primer: AAGGGACCTCTGTCATTGGG (SEQ ID NO 2)
[0036] Reverse primer: GCCTATAGCCATTGAGCATTCAC (SEQ ID NO 3)
[0037] The genomic DNA of the soybean to be screened was amplified by conventional PCR using the primers described above. The amplification system was as follows: 12.5 μl of 2×Rapid Taq Master Mix, 1 μl of 10 μM forward primer, 1 μl of 10 μM reverse primer, 1 μl of 10 μM DNA template, and 9.5 μl of ddH2O. The PCR amplification program was 95℃ for 5 min; 95℃ for 30 s, 56℃ for 30 s, 72℃ for 30 s, for 34 cycles; 72℃ for 5 min. After obtaining the DNA fragment, sequencing was performed, and the sequencing results were compared with the relevant gene fragment SEQ ID NO1 of the soybean to detect the genotype carried by the SNP site at position 151 of the sequence, thus enabling effective selection of sucrose content in the soybean.
[0038] To verify the practicality of the above markers, 20 soybean varieties were randomly selected for sequencing, genotyping, and determination of sucrose content during the fresh consumption period. The results are shown in Tables 4 and 5, indicating that the markers described in this invention are practical.
[0039] Table 4: Sucrose content of 20 different vegetable soybeans
[0040]
[0041]
[0042] Table 5: Comparison of intergroup means for 20 vegetable soybean varieties
[0043]
Claims
1. The application of reagents for detecting SNP molecular markers in the identification or auxiliary identification of sucrose content in vegetable soybean seeds, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.
1. The SNP site of the SNP molecular marker is located at position 151 of the sequence shown in SEQ ID NO.
1. The base polymorphism is T or G. The genotype G / G indicates that the soybean seeds have a high sucrose content, and the genotype T / T indicates that the soybean seeds have a low sucrose content.
2. A method for identifying the sucrose content of soybean seeds, specifically, detecting the genotype of an SNP molecular marker, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, the SNP site of the SNP molecular marker is located at position 151 of the sequence shown in SEQ ID NO.1, and the base polymorphism is T or G. A genotype G / G indicates a high sucrose content in soybean seeds, and a genotype T / T indicates a low sucrose content in soybean seeds.
3. The method according to claim 2, characterized in that, The genotype of the SNP molecular marker was detected by PCR amplification.