Porcine NTF3 promoter region SNP as molecular marker for boar breeding traits and applications of porcine NTF3 promoter region SNP

A technique for molecular markers and boars, applied in the direction of DNA/RNA fragments, recombinant DNA technology, microbial determination/inspection, etc.

A technique for molecular markers and boars, applied in the direction of DNA/RNA fragments, recombinant DNA technology, microbial determination/inspection, etc.

CN107022604AActive Publication Date: 2017-08-08HUAZHONG AGRI UNIV

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine NTF3 promoter region SNP as molecular marker for boar breeding traits and applications of porcine NTF3 promoter region SNP
  • Porcine NTF3 promoter region SNP as molecular marker for boar breeding traits and applications of porcine NTF3 promoter region SNP
  • Porcine NTF3 promoter region SNP as molecular marker for boar breeding traits and applications of porcine NTF3 promoter region SNP

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Extraction of Boar Semen Genomic DNA Using Phenol Extraction

[0032]Inject the fresh semen of the boar collected on the spot (from China, Yaji Mountain Pig Artificial Insemination Center under Guangxi Yangxiang Pig Gene Technology Co., Ltd., the princess is a routinely reported American Duroc and Large White breed, the same below) Store in a 10ml centrifuge tube at -20°C. It was transported to the laboratory in a cold chain below 0°C, and then thawed in a water bath to extract the genomic DNA of boar semen. Specific steps are as follows:

[0033] (1) Take 1ml of semen, put it in a 2ml centrifuge tube, centrifuge at 5000rpm for 7min, discard the supernatant.

[0034] (2) Add 1000 ul of sperm washing liquid or normal saline to each centrifuge tube, mix by pipetting repeatedly, centrifuge at 12000 rpm for 7 min, and discard the supernatant.

[0035] (3) Repeat the above washing steps 1 to 2 times.

[0036] (4) Add 1000ul sperm lysate and 15-20ul proteinase K...

Embodiment 2

[0043] Embodiment 2: the acquisition of boar NTF3 5 ' flanking promoter region specific DNA fragment and the establishment of SNP detection method

[0044] The foreign blood-related pig "Duroc" and the Chinese local pig breed "Meishan pig" (from the experimental pig farm of Huazhong Agricultural University, which is a routinely reported breed) were selected as experimental materials, and the pig NTF3 gene (GeneBank accession number DQ917625.1 The mRNA sequence of ) is seed, compares in the genome of pig, designs following primer according to its 5' flanking sequence:

[0045] Forward primer F: 5'CTGGACCTCACAGGGGATG 3'

[0046] Reverse primer R: 5'CGATGGACACCTTGTTCACC 3'

[0047] Using the blood genome DNA of Duroc pigs (foreign blood-related pig breeds) and Meishan pigs (local pig breeds in China) as templates, PCR amplification was carried out with the above primer pairs, and the results are shown in figure 1 .

[0048] The PCR reaction system is shown in Table 1.

[00...

Embodiment 3

[0056] Example 3: Application of molecular markers cloned by the present invention in association analysis of boar reproductive traits

[0057] Statistics of Genotype Frequency and Allele Frequency

[0058] Genotype frequency: refers to the proportion of a specific genotype in a population to all genotypes in the population. The statistical method of genotype frequency is: genotype frequency = number of individuals of this genotype / total number of measured populations

[0059] Allele frequency: refers to the relative proportion of a gene in a population to the total genes at that locus. Statistical method of allele frequency: genotype frequency of homozygote of this gene + genotype frequency of heterozygote containing this gene / 2

[0060] Table 3 The genotype frequencies and allele frequencies of SNPs in the NTF3 promoter region in three breeds of pigs

[0061]

[0062]

[0063] In order to determine whether the SNP in the 5' flanking promoter region of the porcine NT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of porcine molecular marker screening, and in particular relates to porcine NTF3 promoter region SNP as a molecular marker for the boar breeding traits and applications of the porcine NTF3 promoter region SNP. The molecular marker is cloned from the 5' flank promoter fragment of the porcine NTF3 gene, the nucleotide sequences of the molecular marker are shown as SEQ ID NO:1 and SEQ NO:2, allele mutation of A / G and G / A exists at the 92nd basic group site of the sequence shown as SEQ ID NO:1 and SEQ NO:2, and the allele mutation causes the polymorphism of MvaI-RFLP. The marker is utilized for carrying out correlation analysis on the boar breeding traits of large white pigs and duroc pigs. The breeding traits comprise the boar sperm motility and the sperm density trait. The invention further discloses a typing detection method of the marker, and therefore, a novel marker is provided for selecting the boar breeding traits. The marker can be used for evaluating the boar breeding traits and researching the genetic improvement on the breeding boar breeding performance.

Description

technical field [0001] The invention relates to the technical field of pig molecular marker screening, in particular to a pig NTF3 promoter region SNP as a boar reproductive traits molecular marker and its application. The present invention is related to the technical field of pig breeding and marker-assisted selection Background technique [0002] Molecular marker-assisted selection (MAS, marker-assisted selection) is a new technology produced with the rapid development of modern molecular biology technology, which can quickly and accurately analyze the genetic composition of individuals at the molecular level, so as to realize the genotype Direct selection, molecular breeding. Molecular markers are directly expressed in the form of DNA, which can be detected in all tissues and developmental stages of organisms, and are not restricted by seasonal environments; polymorphisms are abundant and large in number; most of them are co-dominant, and can distinguish homozygous and h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
08 Aug 2017
Publication
CN107022604A
IPC
C12Q1/68; C12N15/11
CPC
C12Q1/6888; C12Q2600/124; C12Q2600/156
Inventors
徐德全; 夏文