Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

94 results about "New disease" patented technology

Fruit tree protection glue for preventing fruit tree disease scar and wound generated by pruning from rot

The invention relates to a fruit tree protective agent, particularly a kind of fruit protective glue for preventing fruit tree scar and rotting wound produced by pruning. The invention solves the problems existing in present technology, for instance the traditional technology of treating fruit tree wound and cut is simple, the effect is bad, and so on. The product is composed of the following materials: 60-70 parts by weight of polyvinyl alcohol, 10-20 parts by weight of glycerol, 0.004-0.006 parts by weight of GA, 4-5 parts by weight of asomate, 85-100 parts by weight of water, heating and dissolving and at last forming a jelly solution. The product can prevent rot disease, and occurrence of new diseases, heal the wound and scar gradually, prevent the cracks between the tree bark and the xylem, make the tissue around the scar or wound heal in Jun-Jul in present year, and the efficiency is 95%. The product is applied in apple tree, pear tree, peach tree and other economic crops. The product is easy to use all year round without preparation at the scene.
Owner:郑永昌

Removeable stents

There is disclosed novel removable stent grafts and methods for removing stent grafts. There is also disclosed new diseases and disorders that can now be treated with removable stents.
Owner:KUO MICHAEL D

Rice leaf blast disease resistance identification grading method based on multi-scale hyperspectral image processing

The invention discloses a rice leaf blast disease resistance identification grading method based on multi-scale hyperspectral image processing. Hyperspectral images of rice leaves with different resistance grades infected by rice blast are colleted by a hyperspectral imaging system. Spectral features of rice leaf blast disease spots and a normal position area of interest are analyzed at leaf scale, two wave bands with greater differences are obtained, two-dimensional scatter plot analysis of the two wave bands is made, and hyperspectral images only containing the disease spots are extracted. And then principal component analysis (PCA) is made at a disease spot scale, a principal component image which is beneficial for segmentation of brown disease spots and grey disease spots is obtained, and the grey disease spots are segmented out through an OTSU method. Finally, rice leaf blast disease resistance grading is conducted according to two parameters of elongation rate and suffered rate. With the rice leaf blast disease resistance identification grading method based on the multi-scale hyperspectral image processing, workload of resistance identification can be reduced, accuracy of resistance evaluation is improved, reasonable promotion and use of new disease-resistant varieties are supplied with scientific basis, and detection of rice leaf blast disease degree in the field is supplied with research foundation.
Owner:SOUTH CHINA AGRI UNIV

Application of Arabidopsis glycosyltransferase gene UGT73C7 in improving plant disease resistance

The invention discloses an application of Arabidopsis glycosyltransferase gene UGT73C7 in improving plant disease resistance, wherein the nucleotide sequence of the glycosyltransferase gene UGT73C7 is shown in SEQ ID No. 1 and is cloned by RT-PCR from Arabidopsis thaliana. The ene UGT73C7 is used to construct a plant overexpressing vector for plant transgene operation, so as to obtain the transgenic plants. The detection results show that the disease resistance of the transgenic plants is significantly improved, suggesting that new disease-resistant plants can be created after the implementation of the application disclosed by the invention, and the application can be used for the subsequent crop variety improvement and has great significance for China's agricultural production.
Owner:SHANDONG UNIV

Multi-gene high rice blast resistance material breeding method adopting marker assisted selection

The invention relates to a multi-gene high rice blast resistance material breeding method adopting marker assisted selection, and belongs to the field of rice breeding. According to the method, specific molecular marker assisted selection of rice blast resistance genes pita and pi5 is adopted, field resistance identification is combined, and accordingly, a new disease-resistant variety can be bred effectively. The method comprises implementation modes as follows: 1, parents P1 and P2 containing the rice blast resistance genes pita and pi5 respectively are hybridized with a susceptible parent Liaoxing 1 to establish a resistant and susceptible offspring group; 2, extraction of DNA of single resistant and susceptible offspring, PCR (polymerase chain reaction) amplification and electrophoretic analysis of different markers are performed; 3, the parents P1 and P2, the susceptible variety Liaoxing 1 and the single plant of the hybridized offspring group are planted in a rice blast high incidence area Donggang, Dandong, and leaf blast and spike and stem blast resistance identification is performed at a seedling stage and a maturation stage respectively. In combination of the resistance gene marker selection, the new multi-gene rice blast resistance variety containing pita and pi5 is directionally improved and cultivated.
Owner:天津天隆农业科技有限公司

Web-enabled disease-specific monitoring

A set of applications can access a specific patient's real-time or historical physiological data from a clinical care unit and calculate new disease specific physiological indicators or be a virtual physiological monitor for that patient. The applications are run on a remote server and push the resulting data to an endpoint device.
Owner:MEDICAL INFORMATICS

Polygalacturonase arrestin gene CaPGIP1 and disease resistance technology thereof

The invention belongs to the field of plant biotechnology, in particular provides a polygalacturonase arrestin gene CaPGIP1 cloned from hot pepper, the gene can specially inhibit the activity of polygalacturonase (PGs) secreted by pathogenic bacteria. The invention provides the function verification techniques based on the coding of the gene, such as protein making, enzyme activity testing, gene silencing, transgenic excessive expression and the like and the application of the techniques. Based on the gene and protein operation technology, the CaPGIP1 gene is proved to effectively participate in the defense reaction of hot pepper under the induction of a stress facto, and can inhibit the activity of polygalacturonase (PGs) secreted by various pathogenic bacteria. The gene silence and transgenic technology are further used for proving that the silence or less expression of the gene in the hot pepper reduces the disease resistance of a host, and the excessive expression of the gene in the transgenic tobacco can enhance the resistance; therefore, the gene codes an important disease-resistance related protein. The invention provides an important technological reserve for transforming the polygalacturonase arrestin (PGIP) gene and cultivating a new disease-resistant variety.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Application of a cotton GhLecRK1 gene in plant greensickness resistance

ActiveCN107653258AReduced resistance to verticillium wiltSusceptibleTransferasesFermentationAgricultural scienceNucleotide sequencing
The invention discloses application of a cotton GhLecRK1 gene in plant greensickness resistance. The nucleotide sequence of the cotton GhLecRK1 gene is as shown in SEQ ID NO.1, and the amino acid sequence is as shown in SEQ ID NO.1. The GhLecRK1 gene has higher expression in cotton roots compared with that of other tissues, and the gene is induced and expressed by verticillium dahliae; the gene inthe cotton is silenced, verticillium dahliae is more likely to infect plants, and the greensickness resistance of the cotton is reduced, so that it is indicated that the cotton has the greensicknessresistance, the gene can be applied to creation of a new disease-resistant species, and then plant variety improvement is carried out.
Owner:HENAN UNIVERSITY

Standard disease name checking method and system

InactiveCN104598642AReduce the amount of memory dataGuaranteed disease diagnosisData processing applicationsSpecial data processing applicationsDisease classificationComputer science
The invention provides a standard disease name checking method which comprises the following steps: firstly, establishing a standard disease name databank, when acquiring input checking conditions, checking in the standard disease name databank according to the checking conditions, and acquiring checking result according to preset conditions. According to the scheme, corresponding standard disease names can be acquired according to the input checking conditions, by establishing the standard disease name databank, standard disease names can be provided for medical operators to refer, the memory data volume of the medical operators can be greatly reduced, the medical operators can diagnose diseases by using standard disease names, later disease classification statistics and tracking can be convenient, and when new disease names are added, only corresponding contents need to be correspondingly added into the databank, thus being simple and convenient, and the databank can be easily updated.
Owner:杜雨阳

System and method for inspecting subway tunnel segment structure defects through multi-lens shooting

The invention discloses a system for inspecting subway tunnel segment structure defects through multi-lens shooting. A light, efficient and safe acquisition platform is adopted to realize acquisitionof various data; three-dimensional reconstruction of a tunnel scene model with scale information is carried out based on the collected data; and detection of a new disease area and monitoring of an existing disease area are carried out based on the reconstructed three-dimensional scene model in combination with image data, so that the occurrence and development process of diseases is mastered, anda powerful data support is provided for timely maintenance and safety management of subway tunnel segments. The invention further discloses a method, three-dimensional reconstruction with scale information is adopted, a reconstructed image has measurement capability, tunnel inspection is performed based on a three-dimensional reconstruction result, and the position and the range of a disease canbe directly obtained; remote processing is carried out based on the cloud platform technology, segment defects are accurately obtained, and the disease development process is mastered.
Owner:武汉至科检测技术有限公司

Probe set and kit for detecting pathogenic gene of autoinflammatory disease

The invention provides a probe set and a kit for detecting a pathogenic gene of an autoinflammatory disease. The probe set comprises probes capable of simultaneously specifically capturing pathogenicgenes affecting inflammasome defects, non-inflammasome defects and autoinflammatory diseases associated with defects in an interferon pathway. The probe set and the kit for detecting the pathogenic gene of the autoinflammatory disease are capable of simultaneously detecting the pathogenic genes of 50 types of known autoinflammatory diseases; based on the probe set which is high in targeted screening, stable and reliable in gene acquisition and used for detecting the pathogenic gene of the autoinflammatory disease, and combined with a high-throughput sequencing method, a diagnosis cycle of theautoinflammatory disease can be accelerated, the diagnostic efficiency can be improved, and several new diseases can be diagnosed, especially for children with the autoinflammatory diseases, so that the effects of no missed detection, no missed diagnosis, relatively small amount of data analysis, shortened inspection cycle are achieved.
Owner:PEKING UNION MEDICAL COLLEGE HOSPITAL CHINESE ACAD OF MEDICAL SCI

Set of antisense RNA for inhibiting AMH gene expression and method for promoting gonad degeneration of male tilapia mossambica and increasing weight gain

The invention provides a set of antisense RNA for inhibiting AMH gene expression and a method for promoting gonad degeneration of male tilapia mossambica and increasing weight gain, and belongs to thetechnical field of aquaculture breeding. The antisense RNA for inhibiting AMH gene expression comprises antisense RNA1 and antisense RNA2, can accurately inhibit the transcriptional level of anti-mullerian hormone gene mRNA, interferes mRNA transport and translation of the anti-mullerian hormone gene mRNA, and influences the protein expression level of the anti-mullerian hormone gene mRNA. The invention further provides the method for promoting gonad degeneration of male tilapia mossambica and increasing weight gain. Two antisense RNAs are introduced into ova by adopting an antisense RNA sequence introduction technology, damage to the ova is small, and the success rate is high. The method can effectively carry out target gene research and development of new disease-resistant and growth-promoting varieties, and has a very strong application prospect.
Owner:FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI

Breeding method of new disease-resistance large white pig strain

The invention discloses a breeding method of a new disease-resistance large white pig strain. The method includes the following steps that 1, a feed adding method is adopted to conduct an Escherichia coli infection experiment on weaned piglets of a core group in large white pigs, and an Escherichia coli resistant breeding basic group in the large white pigs is established; 2, concentration determination is conducted on cytokines of interleukin 1beta, interleukin 4, interleukin 6, interleukin 8, interleukin 10, transforming growth factor beta, tumor necrosis factor alpha and interferon gamma of an Escherichia coli resistant population in the basic group; reproductive performances are detected and selected, growth speeds, lean meat ratios and carcass quality characters, and a first generation is established; 3, a group subculture selective breeding method and a molecular-marker-assisted selection method are adopted. In this way, by the adoption of the breeding method of the new disease-resistance large white pig strain, after four to five generations, a vested breeding target is achieved gradually, a new-strain core group is established, and the morbidity of piglet diarrheal diseases is expected to be reduced.
Owner:TAICANG JINZHU AGRI DEV

Resistant protein and coding gene of bacterial blight

InactiveCN107267523AExpanding the genetic base of blight resistanceRich genetic resources for disease resistancePlant peptidesFermentationAgricultural scienceAmino acid
The invention belongs to the technical field of genetics and discloses a resistant protein and a coding gene of bacterial blight. The cDNA sequence of the bacterial blight resistant protein coding gene is SEQ ID NO:1; and the amino acid sequence of the bacterial blight resistant protein is SEQ ID NO:2. A construction method of the bacterial blight resistant protein coding gene comprises the following steps of performing homologous searching on an oryza granulata transcriptome CDS library and obtaining an Om46055 cDNA sequence; designing a primer according to the sequence of the Om46055, and adopting a 3' / 5'RACE-PCR method to clone the overall length of the Om46055 from oryza granulata; and building an overexpression vector and a gene function. A new disease-resistant gene which is dominant and is high in bacterial blight resistance and a coding protein thereof are obtained, disease-resistant gene resources of cultivated rice are enriched, and the resistant protein and the coding gene have important application value in cultivating new disease-resistant breed and preventing and controlling bacterial blight.
Owner:YUNNAN AGRICULTURAL UNIVERSITY

Kiwi fruit canker susceptible gene AcBXL1 and application thereof

The invention discloses a kiwi fruit canker susceptible gene AcBXL1 and application thereof. The gene AcBXL1 and the sequence of the encoding protein thereof are respectively shown as SEQ ID NO: 1 and 2. According to the invention, through analysis of kiwi fruit genome and transcriptome, the gene sequence of kiwi fruit AcBXL1 is successfully obtained, and through transient expression and stable transformation genetic transformation experiments, the gene AcBXL1 is proved to have the function of promoting the susceptibility of kiwi fruit to canker, thus laying the foundation for creating new disease-resistant varieties for follow-up gene editing and controlling canker.
Owner:ANHUI AGRICULTURAL UNIVERSITY

Incidence relation prediction method of circular RNA

The invention discloses an incidence relation prediction method of circular RNA. The method comprises the steps that step one, a circular RNA Gauss kernel similarity first matrix and a disease Gauss kernel similarity first matrix are constructed; step two, the relation initial values between new circular RNA and each disease, a new disease and each circular RNA are calculated based on a decreasingweight method; step three, a circular RNA Gauss kernel similarity second matrix and a disease Gauss kernel similarity second matrix are constructed; step four, a circular RNA similarity matrix and adisease similarity matrix are constructed; step five, a Kronecker product least square method is adopted to calculate a circular RNA and disease relation score matrix, and the relation scores of the new circular RNA and all diseases and the relation scores of the new disease and all circular RNA are obtained. By means of the method, prediction is conducted on incidence relation of circular RNA diseases through a computing prediction model, and the vacant of a computing model used for predicting the relation between circular RNA and disease is filled.
Owner:CENT SOUTH UNIV

Public opinion prediction method and device, terminal and storage medium

The invention discloses a public opinion prediction method comprising the steps of receiving at least one keyword of a disease input by a user; determining a data source related to the keyword in theInternet, and crawling disease data related to the keyword from the data source by using a crawler program; analyzing the disease data to acquire a public opinion factor of the disease; performing data cleaning and abnormal value treatment on the public opinion factor of the disease; performing data standardization on the public opinion factor of the disease that is subjected to data cleaning andabnormal value treatment to acquire new disease data; and computing a derived variable of the public opinion factor of the disease according to the new disease data, and predicting the disease according to the derived variable. The invention also provides a public opinion data prediction device, a terminal and a storage medium. According to the method, device terminal and storage medium provided by the invention, the relatively complete disease data can be crawled, the disease data can be handled, deeply analyzed and computed, and thus the purpose from basic data display to decision data display is achieved, and the reference base is provided for disease prediction.
Owner:PING AN TECH (SHENZHEN) CO LTD

Method for constructing retinitis pigmentosa disease model, application and breeding method

The invention discloses a method for constructing a retinitis pigmentosa disease model, application and a breeding method, and relates to the technical field of gene editing. According to the method, a Mettl14 gene of a target animal is modified, so that the target animal shows typical retinitis pigmentosa disease characteristics, and the target animal can be used as the retinitis pigmentosa disease model. According to the method, a new disease model with retinitis pigmentosa disease characteristics can be constructed. The disease model can be used for related research on the pathogenesis process and mechanism of the retinitis pigmentosa disease, can also be used for screening related drugs of the retinitis pigmentosa disease, and has a wide application prospect.
Owner:SICHUAN PROVINCIAL PEOPLES HOSPITAL

Coding region of rice blast resistant gene Pi 25 and application thereof

The invention relates to isolation, cloning and application of a coding region of a rice blast resistant gene Pi 25, and discloses the nucleotide sequence of the rice blast resistant gene Pi 25, SEQ ID No.1, and the amino acid sequence of a coded protein thereof, SEQ ID No.2. The transfer of the Pi 25 gene coding region into an infected plant is beneficial to generating a new disease resistant plant, especially accumulating multiple disease resistant genes by a hybridization and transformation method without generating the problem of linkage drag in a genome accompanying in the traditional breeding technique; and the breeding time can be shortened, and the selective-breeding efficiency can be raised. The cloning of the disease resistant genes is the foundation to solve the obstacle existing in interspecific gene transfer in the traditional breeding. The invention also provides a primer pair for amplifying the rice blast resistant gene Pi25, SEQ ID No:3 and SEQ ID No:4, wherein the nucleotide sequence of the SEQ ID No:3 is GGGGTACCCCATCGGCAGTGTAGCGTTTTT, and the nucleotide sequence of the SEQ ID No:4 is GCTCTAGAGCGCAATCGTGGAACAGGAAT. The invention also provides a vector containing the coding region of the rice blast resistant gene Pi25.
Owner:CHINA NAT RICE RES INST

Named entity identification method and device, computer equipment and storage medium

The embodiment of the invention belongs to the technical field of artificial intelligence, and relates to a named entity identification method. The method comprises the steps: receiving an identification request carrying an original text sent by a user terminal; carrying out preprocessing operation on the original text to obtain annotation data; inputting the annotation data into a trained entityprediction model to perform entity prediction operation, and obtaining an entity prediction result; taking the entity prediction result meeting a prediction threshold as an entity identification result; and outputting the entity identification result to the user terminal. The invention further provides a named entity recognition device, computer equipment and a storage medium. The generalization ability of the model is improved; disease entities which do not appear in the dictionary base can also be identified and processed; a new disease combination entity can also be identified; the model can identify the disease entity according to the context semantic information, and the recall rate and accuracy of the model are improved.
Owner:深圳平安医疗健康科技服务有限公司

Disease-resistant variety breeding method of wild ganoderma lucidum

InactiveCN105494088AKeep good traitsStrong disease resistance and comprehensiveFungi productsLichen productsSnow moldAnimal science
The invention relates to a disease-resistant variety breeding method of wild ganoderma lucidum. An original strain is a mycelium cultured after wild ganoderma lucidum vegetative mass cells induce calluses, the original strain is inoculated in a PDA culture medium containing trichoderma viride spores and cultured in a constant-temperature box which is 25 DEG C, strong fruiting bodies are selected for tissue separation, separated strains are subjected to laboratory-scale cultivation, two best strains are screened out, the two strains are cultured into mycelia in cultivation bottles respectively and irradiated by gamma-ray with the radiation intensity of 0.58-0.76 r / day for 10 days, the strains with higher mycelia concentration degree are selected for rejuvenated culture, different strains are separated and purified, and the optimal strain is selected according to mycelia growth conditions to serve as a new disease-resistant variety. The ganoderma lucidum variety bred through the method is high in trichoderma viride resistance, and the problems that the ganoderma lucidum yield is low and the quality of the ganoderma lucidum is poor because of trichoderma viride can be prevented.
Owner:ZHENJIANG SHENGHONG LANDSCAPE PLANT

Disease and metabolite network construction method based on similarity calculation

The invention provides a disease and metabolite network construction method based on similarity calculation, and belongs to the field of disease and metabolite similarity network construction. The network construction method comprises the following steps: acquiring information of different diseases and metabolites; obtaining a known metabolite related to the disease; finding out the similarity ofdifferent diseases by using an InfD-isSim method; introducing an MISM method to obtain the similarity of metabolites; establishing a network of metabolite similarity; discovering new disease-metabolite relationship by random walk. By means of the method, more potential metabolites related to diseases can be obtained, and the method has extremely important significance in clinical diagnosis, treatment and development of new targeted drugs; by adopting the method, high cost and low efficiency of biological experiments can be avoided; through the method, the first several candidate metabolites ofa certain disease are determined, and through biological experiment verification, the method is an efficient and money-saving method.
Owner:HARBIN INST OF TECH

System, Method and Computer Program Product for Administering Consumer Care Initiatives

Consumer care initiatives are implemented by comparing recommended healthcare services with services assumed to have been received by the consumer which are identified through analyzing real-time consumer data. Based on the comparison, assumed gap closures in care are identified, and a consumer outreach suppression period is initiated for the one or more recommended healthcare services with the assumed gap closure during which an outreach initiative is inactive. Reactivation of the initiative may occur when the assumed gap closure is unconfirmed, or the initiative is removed when the healthcare services associated with the assumed gap closure is confirmed to have been received by the consumer. Evaluation of the real-time consumer data further allows for identification of a new disease or condition the consumer is assumed to be experiencing, resulting in the identification of assumed quality gap openings, which enables new care initiatives to be added to the consumer's outreach plan.
Owner:OPTUM

Easily-wearable medical latex glove and using method thereof

The invention relates to an easily-wearable medical latex glove and a using method thereof. The inner side of the glove body is fixedly provided with a middle easily-wearable device. The inner side ofa flanging is fixedly provided with a bottom easily-wearable device. The inner sides of a thumb glove, an index finger glove, a middle finger glove, a fourth finger glove and a little finger glove are fixedly provided with a top easily-wearable device. The middle easily-wearable device is connected with the bottom easily-wearable device and the top easily-wearable device. The middle easily-wearable device, the bottom easily-wearable device and the top easily-wearable device are used for overcoming a problem that the wearing of the glove is hindered in the wearing process, and greatly improving the wearing speed and efficiency. The wearing is easy and troubles are avoided. Talcum powder does not need to be used firstly, a risk of producing new diseases is avoided, and the wearing is successful once without the repeated humidification treatment to the glove. A risk of infection is greatly reduced, and the success rate of the wearing is high, so the internal contamination is difficultlycaused by a source of infection, and the dissemination of pollutants outside the glove is avoided as possible while the glove is taken off.
Owner:安徽安宇乳胶制品有限公司

Molecular identification method for distant hybridization progeny of Sesame indicum L. and Sesame radiatum

Belonging to the field of biotechnologies, the invention discloses a molecular identification method for a distant hybridization progeny of Sesame indicum L. and Sesame radiatum. The method includes: extracting the genomic DNA of Sesame indicum L., 2n=26, the Sesame radiatum, 2n=64 and the hybridization progeny F1, conducting PCR amplification and gel electrophoresis detection, and determining whether the distant hybridization progeny F1 is true or false according to whether parental specific bands can be amplified simultaneously. The molecular identification method for a sesame distant hybridization progeny established in the invention solves the problems of long distant hybrid identification cycle, low accuracy and the like in the process of sesame distant hybridization breeding study, and fills the vacancy of sesame distant hybridization breeding technology in China. By means of the method, the sesame distant hybridization progeny F1 can be identified efficiently and rapidly, thus laying the material and technology bases for breeding of new disease-resistant sesame varieties.
Owner:HENAN ACAD OF AGRI SCI

Phomopsis asparagi for inducing secretion of high-content cell wall degrading enzyme, cell wall degrading enzyme and stem-blight-resistant variety screening method

The invention discloses a phomopsis asparagi for inducing secretion of high-content cell wall degrading enzyme, cell wall degrading enzyme and a stem-blight-resistant variety screening method, and belongs to the field of biotechnology. The phomopsis asparagi for inducing secretion of the high-content cell wall degrading enzyme is the phomopsis asparagi with the preservation number of CGMCC No. 13874. The phomopsis asparagi for inducing secretion of high-content cell wall degrading enzyme can induce asparagus to secrete the high-content cell wall degrading enzyme, and serves for breeding and rational layout of new disease-resistant varieties and disease-resistant varieties.
Owner:INST OF PLANT PROTECTION JIANGXI ACAD OF AGRI SCI

Sludge-based disease-resistant seedling raising substrate production method

The invention relates to a sludge-based disease-resistant seedling raising substrate production method. The method is characterized by comprising the following steps: uniformly mixing waste materialssuch as mushroom residue particles, agricultural straw crushed substances and sawdust powder with fly ash, sludge and biological control microbial inoculum to obtain a product P1; performing aerobicfermentation on the product P1, and turning and throwing the product P1 every 7 days by a turning and throwing machine to obtain a product P2; sieving a product P3, returning oversize to step S4 for mixing, compounding throughs with perlite, vermiculite, coconut shell silk and trace elements to obtain a matrix P, and adjusting pH and EC of the matrix P to obtain a seedling raising matrix finishedproduct. The invention provides the sludge-based disease-resistant seedling raising substrate production method. Sludge and agricultural waste are used as raw materials, the disease-resistant seedlingraising substrate is produced by oxygen fermentation of microorganisms such as mushroom residue microorganisms and biological control strains, the problem of difficulty in sludge treatment at presentis solved, and a brand-new disease-resistant seedling substrate is provided for agricultural production.
Owner:YANGTZE UNIVERSITY

Wheat antidisense related gene TaEDR1 and its application

A wheat gene TaEDR1 associated with disease resistance is separated from the wheat í‹99-2439íŒ which has high resistance to powdery mildew. The complete length of its cDNA is 3050 bp. The protein coded by said gene is a mitogen protein kinase consisting of 959 amino acids. Said TaEDR1 can be used to improve disease-resistant plant, synthesize new disease-resistant gene and prepare wheat gene chip.
Owner:HENAN AGRICULTURAL UNIVERSITY

GHP and GCN fused Chinese and western medicine relocation method and system and storage medium

The invention discloses a GHP and GCN fused Chinese and western medicine relocation method and system and a storage medium. The relocation method comprises the following steps: collecting multi-source and multi-mode heterogeneous data; gHP-GCN Chinese and western medicine relocation model construction specifically comprises the steps of global heterogeneous pharmacological network GHP construction, global heterogeneous pharmacological network and graph convolutional neural network fusion to form a GHP-GCN model, and "monarch, minister, assistant and guide" and "node semantic neighbor" dual weighted constraint optimization of the GHP-GCN model; constructing a training set and learning and reasoning a GHP-GCN model; contribution degree calculation and result analysis; and verifying and optimizing a result. The method can be applied to Chinese and western medicine relocation research, can predict potential and new drug-target protein / gene, target protein / gene-disease and drug-disease association, identifies new drug targets and new disease-associated pathogenic genes, and discovers and confirms drugs having potential treatment effects on diseases and integration effects and synergistic mechanisms thereof. A scientific basis is provided for explaining the effectiveness of Chinese and western medicine treatment and drug discovery.
Owner:HUNAN UNIV