79 results about "Puccinia" patented technology

The present invention discloses a pyrazolyl pyrilamine compound, the compound has a structure as shown in formula (I), and the substituent groups in the (I) are as defined in the specification. The pyrazolyl pyrilamine compound has good control effects on downy mildew of cucumber, puccinia polysra, wheat powdery mildew and other diseases, and is especially better in the control effect on the downy mildew of cucumber.

The invention relates to an antibacterial composition in the field of compounding of pesticides, and the antibacterial composition comprises two effective components (bupirimate and proquinazid or a binary mixture of quinoxyfen) and the balance of auxiliary components which are allowable and acceptable in pesticides, wherein the weight percentage of the two effective components is (90:1)-(1:90), preferably (2-65):(70-3); the total weight percent of the effective components in the antibacterial composition is 1-90%, preferably 5-70%; and the antibacterial composition can be prepared into wettable powder, a suspending agent, an emulsifiable concentrate, a soluble liquid solvent, an emulsion in water, and water dispersible granules by using known methods. The antibacterial composition disclosed by the invention is mainly used for preventing and treating diseases arising from erysiphe, puccinia, colisporites, pyrenophora and septoria bacteria.

The invention relates to a method for measuring the growth cycle of puccinia striiformis by using a microcalorimetric method. The method comprises the following steps: under normal pressure and selected temperature, measuring the heat flow value of culture solution of puccinia striiformis in real time by using a C80 microcalorimetric instrument, storing the heat flow value in a computer, and then calculating to obtain a growth cycle curve of puccinia striiformis. The method has the advantages of being simple and convenient in operation as well as high in reliability. According to the measured growth cycle curve, the growth stages, the time length in the growth stages, the heat varying speed and the specific value in the growth cycle of puccinia striiformis can be clearly distinguished so as to provide useful reference for researching and preventing puccinia striiformis.

The invention belongs to the field of gene engineering, and discloses a gene TaFBK1 with F-box structure field, and an expression vector and application thereof. The cDNA (complementary deoxyribonucleic acid) sequence of the gene TaFBK1 with F-box structure field is SEQ ID NO.1, and the coded amino acid sequence is SEQ ID NO.2. The gene is from common wheat (Triticum asetivum L.) 92R137. The TaFBK1 is induced by Puccinia strilformis to enhance the expression in anti-Puccinia-strilformis wheat species 92R137, and the expression level is much higher than that in the Puccinia-strilformis-infected wheat species Yangmai 158. When the gene is inserted into pBI220 to obtain an overexpression vector and used for transforming the Puccinia-strilformis-infected wheat species Yangmai 158, the T1-generation anti-Puccinia- strilformis identification result on the positive transformed plant indicates that the overexpression of the TaFBK1 can enhance the Puccinia strilformis resistance of the Puccinia-strilformis-infected wheat species.

The invention belongs to the field of agricultural fungicide and particularly relates to an agricultural compound fungicide. The effective components of the fungicide are pyraclostrobin and fenpyrazamine which are compounded. The weight ratio of the two components is 1: 0.1-10, preferably, 1: 2-3. The prepared fungicide expands fungicide spectrum and has high activity on botrytis cinerea, rhizoctonia, puccinia, ustilago, tilletia, corticium, pyrenophora and other pathogenic fungi, and is remarkable in synergy which is not simple composition of activity of the components. The fungicide is strong in preventive treatment efficacy, long in effect lasting time, small in resistance risk and capable of reducing field usage of effective components, reducing production and using cost and reducing fungicide residue and environment pollution. The fungicide is favorable for overcoming and delaying production of bacteria drug resistance and is safe for crops due to effective components with different action mechanisms.

The present invention provides wheat cultivars that are resistant to leaf rust and / or stripe rust disease caused by strains of the fungus Puccinia and to means and methods for producing same. Particularly, the present invention provides wheat cultivars comprising a chromosome segment of Ae. sharonensis, the chromosome segment confers, enhances, or otherwise facilitates resistance of the wheat plants to leaf rust and / or stripe rust disease.

The invention relates to a detection and identification kit of a composite PCR of wheat stripe rust fungus and leaf rust fungus, which belongs to the technical fields of biotechnology, crop disease control and plant quarantine. The kit detects the specific genome DNA sequences of the wheat stripe rust fungus 171 bp and the leaf rust fungus 226 bp simultaneously in a primary PCR reaction by three primers from a fungal beta-tubulin gene conserved sequence and wheat stripe rust fungus and leaf rust fungus specific sequences. The invention provides supplement and improvement on the wheat stripe rust fungus and leaf rust fungus specific primer detecting method, and is suitable for the diagnostic detection of the stripe rust fungus and the leaf rust fungus in an infected wheat leaf before disease symptoms appear. Composite PCR technology is adopted in the kit, and in a PCR-SMART reaction solution, the three primers are amplified simultaneously, so the detection accuracy is increased, the detection time is saved, the operation is simple, and the kit can be applied and popularized at plant protection and plant quarantine departments in China.

The invention discloses an isothiazole-o-pyrimidone compound. The compound has the structure shown in the general formula I, wherein each substituent group is defined in the specification. The compound with the general formula I has high activity on multiple pathogenic bacteria in the agricultural field and particularly has a good effect of preventing and treating rice blast, cucumber downy mildew, cucumber gray mold and puccinia polysra under low dose; moreover, the compound also has high insecticidal activity. Therefore, the invention comprises application of the compound which is shown in the general formula I and serves as a fungicide and a pesticide in the fields of agriculture and the like.

The invention relates to specific primers and a molecule detection method for pathogenic fungi of austral puccinia sorghi. The specific primers comprise a forward primer 5'-CTCCAAGAACTTCCTCCTC-3' and a reverse primer 5'-TGACATGAAGTAGAAATTCT-3'. The primers are subjected to PCR (Polymerase Chain Reaction) amplification and agarose gel electrophoresis, and the bacteria bearing condition of corns infield can be detected by adopting the primers and amplification products with segment length of 540bp, obtained through PCR amplification, wherein PCR amplification comprises the following steps of: pre-modifying for 5 minutes at 95 DEG C; then modifying for 45 seconds at 94 DEG C, annealing for 45 seconds at 55 DEG C, stretching for 90 seconds at 72 DEG C, and repeating the steps for 30 cycles; and finally stretching for 10 minutes at 72 DEG C. The primers disclosed by the invention have strong specificity for corn puccinia strilformis, can be used for detecting corn rust diseases and has high sensitivity up to 0.001 ng / mu m L. The detecting method disclosed by the invention has good practicability and is simple, convenient and quick to operate.

The invention belongs to the technical field of disease-resistant variety cultivation, and discloses an acquisition of edited wheat susceptible gene plants and application of edited wheat susceptiblegene plants in disease-resistant variety cultivation. The edited wheat susceptible gene plants have B, D and A copies in wheat. The RNAi mutants of the TaRIPK1 with two genetic backgrounds are obtained. According to the invention, an agrobacterium tumefaciens-mediated genetic transformation method is adopted, and a CRISPR-Cas9 gene editing technology is utilized to obtain the gene edited plant ofTaRIPK1. Through inoculation of wheat stripe rust bacteria, it is found that TaRIPK1 RNAi plant bacteria with two genetic backgrounds have remarkable resistance to stripe rust bacteria toxic race CYR32, disease resistance identification is conducted on a TaRIPK1 gene editing technology, and it is found through results that the disease resistance of TaRIPK1 gene editing plants is remarkably improved. The resistance to main epidemic races of puccinia striiformis and puccinia leaf rust is remarkable, and the plants can be used as a germplasm new material for genetic improvement of wheat rust resistance.

The invention discloses an IF2 translation initiation factor gene relevant to wheat yellow rust resistance. The overall length of a cDNA sequence of the gene is 1810bp, and a nucleotide sequence of the gene is shown as SEQ.ID.NO.1, wherein 1-165bp is a 5' non-translated region; 166-1386bp codes 406 kinds of amino acid, 1513-1665bp codes 50 kinds of amino acid, and 1666-1810bp is a 3' non-translated region. The gene is a conservative gene of wheat yellow rust resistance; RT-PCR expression analysis indicates that the gene has trace expressions under the normal condition, the induction expressionis increased after duress for 24 hours in a CY32 bacterial system, and the expression reaches the maximum for 72 hours and then is reduced in the following 4-7 days; disease resistant wheat leaves can display a symptom of suffering from puccinia striiformis infection by silencing the expression of the gene in yellow rust resistant wheat by an RNA interference technology.

The invention discloses application of a primer for identifying physiological race THTS of puccinia triticcina and a THTS race-specific DNA (deoxyribonucleic acid) sequence. The primer sequence is a primer pair which is composed of forward and reverse nucleotide sequences of primer Ptssr0125 in a sequence table. Fast physiological race identification can be carried out on the puccinia triticcina with an EST-SSR (expressed sequence tag-simple sequence repeat) molecular marker.

The invention discloses a quinazoline (sulfur) ketone compound with a broad-spectrum bactericidal activity. The structure of the compound is as shown in the general formula (I), and each substituent group in the formula is as defined in the specification. The compound has a broad-spectrum bactericidal activity and has an excellent effect of preventing and curing diseases such as cucumber downy mildew, puccinia polysra and the like. By applying a low dosage of the compound, a good effect can be achieved. The compound provided by the invention has characteristics of simple preparation method and the like.

The invention relates to a sterilization composition in the field of pesticide preparation. The active ingredients of the sterilization composition include tetraconazole and simeconazole which are mixed, wherein the weight percent ratio of the two active ingredients is (80:1)-(1:80), preferably (50:1)-(1:50); the total content of the active ingredients in the sterilization composition in percentage by weight is 1-90%, preferably 5-50%; and other components in the sterilization composition are allowed and acceptable auxiliary components. The sterilization composition containing tetraconazole and simeconazole can be prepared into wettable powder, suspending agent, missible oil, soluble liquid, emulsion in water and water dispersible granules; and the sterilization composition provided by the invention is mainly used for preventing and controlling diseases caused by erysiphe, puccinia, rhynchosporium, pyrenophora and septoria.

The invention provides a wheat gene Yr10 molecular marker and application thereof to screening of puccinia striiformis westend.f.sp.tritici-resistant wheat and belongs to the technical field of wheatbreeding. The wheat gene Yr10 molecular marker is characterized in that the Yr10 molecular marker has a nucleotide sequence shown as SEQ ID No.1 in a sequence table. The molecular marker is completelylinked with a puccinia striiformis westend.f.sp.tritici-resistant gene Yr10 and is named Xsdau79. Through detecting the molecular marker, whether the wheat gene Yr10 exists or not can be known, so that whether wheat varieties have the characteristics of puccinia striiformis westend.f.sp.tritici resistance or not can be determined. The molecular marker provided by the invention can accurately andquickly identify the puccinia striiformis westend.f.sp.tritici-resistant gene Yr10; therefore, the invention provides the application of a primer to the screening of the puccinia striiformis westend.f.sp.tritici-resistant wheat.

The invention relates to a sterilization composition in the compounding field of farm chemicals, which is characterized in that: active ingredients of the sterilization composition are formed by mixing bupirimate and kasumin or polyxin, the weight percentage of the two active ingredients is 90:1 to 0.1:90, and the preferential weight percentage is (2 to 65):(50 to 0.1); total content by weight percent of the active ingredients in the sterilization composition is 0.1 percent to 90 percent, and the preferential content is 5 percent to 70 percent, rest ingredients of the sterilization composition are auxiliary ingredients which are allowed to be used and are acceptable in the farm chemical, and the sterilization composition can be made into wettable powder, suspending agent, water agent, emulsion oil, soluble liquid agent, water emulsion and water dispersion granule; and the sterilization composition is mainly used for plant diseases caused by bacteria of Erysiphe, Puccinia, rhynchosporium, Pyrenophora and Septoria.

The invention relates to specific primers and a molecular detection method for pathogenic fungi of corn common rust. The specific primers comprise an upstream primer: 5'-TTTAGTAGTCTCTATCTCAACAACA-3', and a reverse primer: 5'-AAGACTCTTTTGCATGGTTT-3'. PCR (Polymerase Chain Reaction) amplification and agarose gel electrophoresis are performed on the specific primers, wherein the amplification parameters are as follows: pre-denaturating for 5 minutes at 95 DEG C, then denaturating for 45 seconds at 94 DEG C, annealing for 45 seconds at 55 DEG C, extending for 90 seconds at 72 DEG C, circulating for 30 times, and extending for 10 minutes at 72 DEG C, and the germ carrying condition of field corn is detected by the amplified product (with the fragment length of about 480bp). The primer provided by the invention has strong specificity on corn strip rust fungi and can be used for detection of the corn rust with the sensitivity of 0.001ng / mu L, and the detection method provided by the invention has good practicability and is simple and quick to operate.

The invention discloses a substituted pyrimidinamine compound with broad-spectrum bactericidal, insecticidal and acaricidal activity. The structure of the compound is shown as general formula (I) in the specification. All substituent groups in the formula are defined as the specification. The compound provided by the invention has broad-spectrum bactericidal, insecticidal and acaricidal activity, has excellent control effect on cucumber downy mildew, puccinia polysra, wheat powdery mildew, Phyricularia oryzae, cucumber gray mold and other diseases, especially has better control effect on cucumber downy mildew, puccinia polysra, Phyricularia oryzae and the like, and also has good control effect on diamondback moth, armyworm, aphid and Tetrangychus cinnabarinus. The compound can achieve a good effect under a low dosage.

The invention relates to a Specificity SCAR marker for detecting puccinia striiform, and belongs to the technical fields of biology and plant quarantine. The length of the nucleotide sequence of the provided specificity SCAR marker is 180 bp. The SCAR marker has a high specificity on detecting puccinia striiform. The marker stably appears in the puccinia striiform standard samples from different wheat producing areas in China, and does not have polluting amplification on puccinia triticcina, puccinia graminis, or other wheat pathogenic fungi. So the SCAR marker can be applied to the diagnosis, detection, investigation, and prediction of wheat stripe rust disease.

The invention discloses a sterilizing composition. The effective components are Sedaxane and captan, the mass ratio of the both is 50:1-1:50. The composition has obvious synergism and is effective totreat diseases caused by rhizoctonia solani, puccinia horiana, pyrenophora graminea, ustilago esculenta, Tilletia, Erysiphe, pyrenophora teres, Septoria musiva, and Ramularia; the composition has special effect to seed-borne disease. The composition can be applied to treat seeds and spray stems and leaves, the effect duration lasts for 4-6 weeks; the composition can be applied to the disease prevention and treatment of cereal type crops; particularly, it is applied to the seed treatment for preventing wheat ustilago esculenta, wheat tilletia, wheat basal rot, sphacelotheca reiliana, corn stalkrot, corn gall smut and rice bakanae disease.

The invention provides application of a puccinia striiformis PSTG_06025 gene to wheat stripe rust prevention and treatment. The sequence of the PSTG_06025 gene is shown as Seq ID No.1. The PSTG_06025gene can be used for effectively regulating and controlling the growth and the breeding of the puccinia striiformis; the PSTG_06025 gene is used as a transcriptional control molecular target or a protein function inhibition gene target; the effect of inhibiting the growth and the breeding of the puccinia striiformis is achieved through silencing the PSTG_06025 gene. The wheat obtained by the method for culturing the anti-puccinia striiformis wheat by using the gene provided by invention has obvious puccinia striiformis resistance.

The invention belongs to the technical field of plant protection and provides a method for measuring the relative content of puccinia striiformis DNA (deoxyribose nucleic acid) in wheat leaves. The method comprises steps as follows: acquiring near-infrared spectrum information of to-be-tested leaves in the incubation period of wheat stripe rust; applying a measurement model to determine the relative content of puccinia striiformis DNA corresponding to the near-infrared spectrum information of the to-be-tested leaves in the incubation period of wheat stripe rust, wherein the measurement model indicates the corresponding relation between the near-infrared spectrum information and the relative content of puccinia striiformis DNA. The method for measuring the relative content of puccinia striiformis DNA in the wheat leaves can be used for measuring the relative content of puccinia striiformis DNA in the incubation period of wheat stripe rust quickly, accurately and quantitatively.

The invention provides a puccinia striiformis quantitative detection kit and application thereof. The kit comprises a normal reagent for fluorescent quantitation PCR amplification, and is characterized by further comprises a primer for detecting puccinia striiformis; the forward and reverse nucleotide sequences of the primer are as follows: osgQ607 / osg / Q608:GGATGCCTCGAAGGGTTATACC / TGCTAGATACAATGGCACATCTGA. The invention further discloses a method for quantitatively detecting the number of puccinia striiformis copies in wheat by utilizing the kit. Through adoption of the kit and the method, the infection amount of puccinia striiformis in a gleying state can be measured relatively accurately and quantitatively, the characteristics such as a low detection limit as well as high sensitivity, specificity and amplification efficiency are achieved, and a reliable detection means is provided for early prediction and control of wheat stripe rust.

The invention relates to the technical field of biology, and particularly discloses a Puccinia triticinia resistant protein as well as a coding gene and application thereof. The Puccinia triticinia resistant protein has an amino acid sequence as shown in SEQ ID NO: 1, or has an amino acid sequence which is obtained by deleting, replacing or adding one or more amino acids to the amino acid sequenceas shown in SEQ ID NO: 1 and has a function of improving Puccinia triticinia resistance. The Puccinia triticinia resistant protein or the coding gene thereof can be applied to regulation or improvement of Puccinia triticinia resistance. The invention provides the Puccinia triticinia resistant protein, and particularly discloses the amino acid sequence of the Puccinia triticinia resistant protein,resistance of wheat to Puccinia triticinia can be remarkably improved by improving expression quantity of the Puccinia triticinia resistant protein in wheat, and the Puccinia triticinia resistant protein has great application and popularization value for Puccinia triticinia resistance breeding.

The invention discloses 'a monoclonal antibody, an immune fluorescence method and a kit for detecting puccinia striiformis f.sp.tritici, puccinia triticina f.sp.tritici and puccicinia graminis f.sp.tritici' and belongs to the field of agricultural biotechnology. The invention mainly provides the monoclonal antibody for detecting puccinia striiformis f.sp.tritici, puccinia triticina f.sp.tritici and puccicinia graminis f.sp.tritici, which is secreted by hybridoma cell line with a collection number CGMCC No.4414 and can identify puccinia triticina f.sp.tritici, puccicinia graminis f.sp.tritici and puccinia striiformis f.sp.tritici at the same time. The invention also provides a detection method based on the combination of the monoclonal antibody and an immune fluorescence technology and a kit. The monoclonal antibody, the detection method and the kit have the advantages of high specificity, high sensitivity, and simplicity and quickness of operation.

The invention relates to application of a frankincense extract in an oral bacteriostatic composition, in particular to application in an oral bacteriostatic composition. The application comprises application in toothpaste, application in mouthwash, application in effervescent tablets, application in chewing gum and application in candy. The frankincense extract has strong inhibitory effects on Helicobacter pylori, Escherichia coli, Streptococcus mutans, Porphyromonas gingivalis, Staphylococcus aureus and Puccinia intermedia.

The invention belongs to the technical field of biological prevention and control, and discloses a biological method for inhibiting rapid growth of mikania micrantha, which comprises the following steps: measuring the safety of mikania micrantha puccinia peucedanum on non-target organisms; determining the mikania micrantha puccinia infection process; determining the phenotype of mikania micrantha growth inhibition by mikania micrantha puccinia Determining the inhibition of mikania micrantha hormone synthesis by mikania micrantha puccinia And determining the inhibition of mikania micrantha puccinia peucedanum on the photosynthesis of Through measurement of the net photosynthetic rate and the stomatal conductance of mikania micrantha leaves and content analysis of Kalvin cycle pathway related metabolites, it is found that after mikania micrantha puccinia is infected, the photosynthetic rate and the stomatal conductance of the leaves can be remarkably reduced, the content of Kalvin cycle pathway related compounds is inhibited, the net photosynthetic rate is reduced by 10.57%, and the content of Kalvin cycle pathway related metabolites is reduced by 10.57%. The stomatal conductance is reduced by 26.03%, and the content of Kalvin cycle pathway related compounds is reduced by 1.9-3.4 times.

The invention discloses a bactericidal composition containing tetramycin and thifluzamide. Binary compounding is performed on the tetramycin and the thifluzamide of effective components of the bactericidal composition, and the remaining components are auxiliary components; the mass ratio of the tetramycin and the thifluzamide of the effective components of the bactericidal composition is (1-50):(50-1); the mass fraction ratio of the tetramycin to the thifluzamide of the effective components in the preparation is 1 percent to 80 percent, and the remaining components are the auxiliary components allowed to be used and accepted in pesticides. The bactericidal composition disclosed by the invention is missible oil, suspending agent, wettable powder, water dispersible granules, emulsion in water, microemulsion, granules, microcapsules and water aqua in dosage form; the bactericidal composition is mainly used for controlling powdery mildew of wheat, strawberries, grapes, apples and cucumbers, meanwhile, is capable of effectively controlling fungi, such as Rhizoctonia, Puccinia, Tolyposporium, Tilletia, Corticium and Pyrenophora, and especially has a special effect on diseases, such as banded sclerotial blight and damping off, caused by Basidiomycetes fungi.

The invention discloses a fungicide composition containing metalaxyl and thifluzamide. The fungicide composition comprises the effective components, including metalaxyl and thifluzamide which are compounded, and the balance of auxiliary components, wherein the mass ratio of the effective components metalaxyl and thifluzamide in the fungicide composition is (1-50) to (50-1), and the mass part ratio of the effective components metalaxyl and thifluzamide in the preparation is 1%-80%, and the balance is auxiliary components required to be used and accepted in pesticides. The fungicide composition has the dosage forms of missible oil, suspension, wettable powder, water dispersible granules, emulsion in water, microemulsion, granules, microcapsules and water aqua, is mainly used for preventing and controlling powdery mildew of wheat, strawberries, grapes, apples, and cucumbers, meanwhile can effectively prevent and control fungi such as rhizoctonia, puccinia, ustilago, tilletia, corticium, pyrenophora, and especially has special effects to banded sclerotial blight, damping off and the like due to basidiomycotina fungus.