Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

44 results about "Puccinia graminis tritici" patented technology

Gene TaFBK1 with F-box structure field, and expression vector and application thereof

The invention belongs to the field of gene engineering, and discloses a gene TaFBK1 with F-box structure field, and an expression vector and application thereof. The cDNA (complementary deoxyribonucleic acid) sequence of the gene TaFBK1 with F-box structure field is SEQ ID NO.1, and the coded amino acid sequence is SEQ ID NO.2. The gene is from common wheat (Triticum asetivum L.) 92R137. The TaFBK1 is induced by Puccinia strilformis to enhance the expression in anti-Puccinia-strilformis wheat species 92R137, and the expression level is much higher than that in the Puccinia-strilformis-infected wheat species Yangmai 158. When the gene is inserted into pBI220 to obtain an overexpression vector and used for transforming the Puccinia-strilformis-infected wheat species Yangmai 158, the T1-generation anti-Puccinia- strilformis identification result on the positive transformed plant indicates that the overexpression of the TaFBK1 can enhance the Puccinia strilformis resistance of the Puccinia-strilformis-infected wheat species.
Owner:NANJING AGRICULTURAL UNIVERSITY

Molecule detection method for puccinia striiformis f.sp.tritici No.17 physiological race

The invention discloses a molecule detection method for puccinia striiformis f.sp.tritici No.17 physiological race. By employing a method for converting a RAPD molecular marker into a SCAR molecular marker, the specific primers (upstream primer 5' -TTCCCCCGCTGTCT and downstream primer 5'- GTTGAGCGGGGGAA) of No.17 physiological race are obtained, and are subjected to PCR amplified reaction (reaction conditions: 94 DEG C, 5 min, 1 cycle; 94 DEG C, 30 s, 60 DEG C, 1 min, 72 DEG C, 90 s, 35 cycles; 72 DEG C, 7 min, 1 cycle) and 2% agarose gel electrophoresis, so that an specific strip with a length of about 1000 bp is obtained. Therefore, the molecule detection method helps to rapidly discriminate and distinguish puccinia striiformis f.sp.tritici No.17 physiological race in molecular level, and establishes a base for developing research on wheat stripe rust molecular epidemiology.
Owner:NORTHWEST A & F UNIV

Penconazole and zhongshengmycin-containing sterilization composition and application thereof

The invention relates to the field of pesticide compounding techniques, particularly relates to a penconazole and zhongshengmycin-containing sterilization composition, and also relates to an application thereof. The penconazole and zhongshengmycin-containing sterilization composition comprises effective ingredients of penconazole and zhongshengmycin with a weight part ratio of (90:1)-(1:90), and the penconazole and zhongshengmycin-containing sterilization composition is prepared into a wettable powder, a suspending agent, an emulsion in water, a water dispersible granule, emulsifiable concentrate and the like after being added with assistants and an excipient, and is used for controlling fungal diseases caused by germs such as erysiphe, uromyces, mortierella, septoria and venturia and bacterial diseases caused by germs such as Gram-positive bacteria, Gram-negative bacteria, mycobacteria and saccharomycetes. The penconazole and zhongshengmycin-containing sterilization composition has a relatively good synergism within a certain range, is superior to a single preparation on the aspect of control effects, is relatively durable in pesticide effect, has a special effect on controlling powdery mildew, rust diseases, scab, leaf spot diseases, gray mold, white rot, soft rot, streak diseases, rice blast, ring spot, gibberellic diseases and bacterial diseases, is relatively low in residue, is relatively easily decomposed after a lasting period, is relatively environment-friendly, and is beneficial to the increase of yield and income in an agricultural district.
Owner:江西绿川生物科技实业有限公司

Thaumatin-like protein related to wheat leaf rust resistance and encoding gene and application thereof

The invention discloses a thaumatin-like protein gene TcLr19PR5 related to wheat leaf rust resistance and a gene encoded through the thaumatin-like protein gene TcLr19PR5. Through RT-PCR and the electronic cloning technology, a 516bp thaumatin-like protein gene is cloned, and 171 amino acid residues are coded; and real-time fluorescence quantification PCR analysis shows that at different time points after puccinia triticina is inoculated, the expression quantity of the gene in non-affine combinations is higher than that of the gene in affine combinations, it is indicated that expressions are induced through the wheat puccinia triticina, the expression amount of stems is higher than the expressions of the leaves and the roots, and meanwhile it is clear that the expressions are induced by adversity signal molecules of abscisic acid (ABA) and salicylic acid (SA). According to the thaumatin-like protein gene and the gene, basic data are provided for in-depth exploration of wheat and puccinia triticina interaction molecular mechanisms, and the theory basis is provided for cultivating leaf-rust-resistance wheat varieties.
Owner:HEBEI AGRICULTURAL UNIV.

Detection primers and molecule detection method for pathogenic fungi of austral puccinia sorghi

The invention relates to specific primers and a molecule detection method for pathogenic fungi of austral puccinia sorghi. The specific primers comprise a forward primer 5'-CTCCAAGAACTTCCTCCTC-3' and a reverse primer 5'-TGACATGAAGTAGAAATTCT-3'. The primers are subjected to PCR (Polymerase Chain Reaction) amplification and agarose gel electrophoresis, and the bacteria bearing condition of corns infield can be detected by adopting the primers and amplification products with segment length of 540bp, obtained through PCR amplification, wherein PCR amplification comprises the following steps of: pre-modifying for 5 minutes at 95 DEG C; then modifying for 45 seconds at 94 DEG C, annealing for 45 seconds at 55 DEG C, stretching for 90 seconds at 72 DEG C, and repeating the steps for 30 cycles; and finally stretching for 10 minutes at 72 DEG C. The primers disclosed by the invention have strong specificity for corn puccinia strilformis, can be used for detecting corn rust diseases and has high sensitivity up to 0.001 ng / mu m L. The detecting method disclosed by the invention has good practicability and is simple, convenient and quick to operate.
Owner:HENAN AGRICULTURAL UNIVERSITY

Acquisition of edited wheat susceptible gene plants and application of edited wheat susceptible gene plants in disease-resistant variety cultivation

The invention belongs to the technical field of disease-resistant variety cultivation, and discloses an acquisition of edited wheat susceptible gene plants and application of edited wheat susceptiblegene plants in disease-resistant variety cultivation. The edited wheat susceptible gene plants have B, D and A copies in wheat. The RNAi mutants of the TaRIPK1 with two genetic backgrounds are obtained. According to the invention, an agrobacterium tumefaciens-mediated genetic transformation method is adopted, and a CRISPR-Cas9 gene editing technology is utilized to obtain the gene edited plant ofTaRIPK1. Through inoculation of wheat stripe rust bacteria, it is found that TaRIPK1 RNAi plant bacteria with two genetic backgrounds have remarkable resistance to stripe rust bacteria toxic race CYR32, disease resistance identification is conducted on a TaRIPK1 gene editing technology, and it is found through results that the disease resistance of TaRIPK1 gene editing plants is remarkably improved. The resistance to main epidemic races of puccinia striiformis and puccinia leaf rust is remarkable, and the plants can be used as a germplasm new material for genetic improvement of wheat rust resistance.
Owner:NORTHWEST A & F UNIV

Molecular detection method for rapid detection of new puccnia striiformis West f.sp.tritici strain

The invention discloses a molecular detection method for rapid detection of new toxic strain V26 of puccnia striiformis West f.sp.tritici; by a large number of screening, a specific marker of the new toxic strain V26 of the puccnia striiformis West f.sp.tritici is obtained, the specific marker is sequenced, and according to sequencing results, a pair of specific primers comprising V26SP1:5'CTGTAAAGCGGATAAAGGAA 3', and V26SP2:5'CATAAGAGCCACACTTGACC3'. Optimal PCR (polymerase chain reaction) conditions of the pair of the specific primers are established. Different single spore strains of the V26 strain is detected by use of an optimal PCR method, and specific SCAR (sequence characterized amplified regions) markers of the V26 can be obtained by respectively taking of other 13 physiological races and ultra pure water as controls. The molecular detection method is mainly used for early-stage rapid detection of the V26 strain in a large field, the dynamic variation conditions can be known, and the molecular detection method provides reliable technical support and theoretical basis for monitoring of the strain and prevention and control decisions of wheat yellow stripe rust disease.
Owner:王保通 +1

Transcription factor for improving rust disease resistant wheat varieties and screening and obtaining method of transcription factor

The invention belongs to the technical field of crop variety breeding, and discloses a transcription factor for improving rust disease resistant wheat varieties and a screening and obtaining method ofthe transcription factor. The transcription factor is TaWRKY19 and BdWRKY67 of a WRKY transcription factor in brachypodium distachyon, wherein the ORF coding sequence of the TaWRKY19 is SEQID NO:1, and the ORF coding sequence of the BdWRKY67 of the WRKY transcription factor gene in the brachypodium distachyon is SEQID NO: 2. An RNAi mutant of the WRKY transcription factor is obtained through agrobacterium tumefaciens mediated heredity and transformation, brachypodium sylvaticum is inoculated for disease resistance identification, and through the result, the inventor finds that the RNAi plantdisease resistance of the BdWRKY67 is notably improved. The disease resistance of plant wheat obtained through silencing of the TaWRKY19 transcription factor is notably improved, and the resistance ofplants subjected to instantaneous overexpression to puccinia striiformis is also obviously diminished, so that the transcription factor can be used for heredity improvement of stripe rust resistant wheat.
Owner:NORTHWEST A & F UNIV

Wheat stem rust resistance gene

The present invention relates to a transgenic plant which has integrated into its genome an exogenous polynucleotide encoding a polypeptide which confers resistance to Puccinia graminis f. sp. tritici, such as the Ug99 group of races Puccinia graminis f. sp. tritici. In an embodiment, the polynucleotide is the Sr33 gene from Aegilops tauschii.
Owner:COMMONWEALTH SCI & IND RES ORG

Sterilizing composition

The invention discloses a sterilizing composition. The effective components are Sedaxane and captan, the mass ratio of the both is 50:1-1:50. The composition has obvious synergism and is effective totreat diseases caused by rhizoctonia solani, puccinia horiana, pyrenophora graminea, ustilago esculenta, Tilletia, Erysiphe, pyrenophora teres, Septoria musiva, and Ramularia; the composition has special effect to seed-borne disease. The composition can be applied to treat seeds and spray stems and leaves, the effect duration lasts for 4-6 weeks; the composition can be applied to the disease prevention and treatment of cereal type crops; particularly, it is applied to the seed treatment for preventing wheat ustilago esculenta, wheat tilletia, wheat basal rot, sphacelotheca reiliana, corn stalkrot, corn gall smut and rice bakanae disease.
Owner:SHENZHEN NOPOSION AGROCHEM

Application of glycoalkaloids as pesticides for controlling plant diseases

The present invention relates to farm chemical with glucoside alkaloid as the effective component for preventing and controlling plant mycosis and its application. The fungicidal glucoside alkaloid preparation has up to five kinds of glucoside alkaloid with obvious effect of preventing and controlling plant diseases caused by Verticillium, monospermous rust fungi, Fusarium and other fungi. The fungicidal glucoside alkaloid preparation has broad spectrum, low toxicity, environment friendship, low cost and other features.
Owner:NORTHEAST NORMAL UNIVERSITY

Method for forecasting field kendir rust disease and special device therefor

The invention discloses a method for forecasting a kendir rust disease caused by kendir Melampsora and a special device therefor. The method mainly comprises the following steps: manufacturing of a carrier, preparation of a sampling device, sampling and trapping of spores, isolated culture and pathogenicity calculation. The occurrence of the Melampsora of the field-planted kendir can be accurately forecast and predicted, so that a control plan can be effectively made. Compared with the prior art, the invention can effectively determine the quantity of pathogenic bacteria having infectivity while the quantity of pathogenic bacteria can be determined, and especially can solve the problem that isolated kendir leaves which have been sampled in an aeroscope can be easily polluted and rotten in the culture process. Thus, the invention is suitable for forecasting and predicting the Melampsora of the field commercially-planted kendir.
Owner:XINJIANG ALTAY PREFECTURE GAUBAO KENDER CO LTD

Fungal Resistant Plants Expressing HCP5

The present invention relates to a method of increasing resistance against fungal pathogens of the order Pucciniales, preferably the family Phacopsoraceae, in plants and / or plant cells. This is achieved by increasing the expression of an HCP5 protein or fragment thereof in a plant, plant part and / or plant cell in comparison to wild type plants, wild type plant parts and / or wild type plant cells. Furthermore, the invention relates to transgenic plants, plant parts, and / or plant cells having an increased resistance against fungal pathogens, in particular, pathogens of the order Pucciniales, preferably the family Phacopsoraceae, and to recombinant expression vectors comprising a sequence that is identical or homologous to a sequence encoding an HCP5 protein.
Owner:BASF PLANT SCI GMBH

Puccinia graminis chitin deacetylase as well as preparation method and application thereof

The invention discloses a puccinia graminis chitin deacetylase as well as a preparation method and application thereof. According to codon preference of pichia pastoris, an optimized nucleic acid sequence is shown as SEQ ID NO.2, and a chitin deacetylase encoding gene sequence of the puccinia graminis is obtained by utilizing a whole-gene synthesis method. Furthermore, a pichia pastoris expressionsystem is used for outperforming secretory expression on the optimized chitin deacetylase encoding gene to obtain chitin deacetylase, and the amino acid sequence of the chitin deacetylase is shown asSEQ ID NO.1. The obtained chitin deacetylase disclosed by the invention can be used for removing acetyl in chitin, chitosan and chitosan oligosaccharide, so that the chitosan or the chitosan oligosaccharide adopting a specific structure is obtained. The chitosan or the chitosan oligosaccharides adopting specific structures can have new or higher biological activity. Therefore, the puccinia graminis chitin deacetylase and a deacetylation product thereof have good industrial application prospects.
Owner:ZHONGKE RUNXIN SUZHOU BIOLOGICAL TECH CO LTD

Monoclonal antibody, immune fluorescence method and kit for detecting puccinia striiformis f.sp.tritici, puccinia triticina f.sp.tritici and puccicinia graminis f.sp.tritici

The invention discloses 'a monoclonal antibody, an immune fluorescence method and a kit for detecting puccinia striiformis f.sp.tritici, puccinia triticina f.sp.tritici and puccicinia graminis f.sp.tritici' and belongs to the field of agricultural biotechnology. The invention mainly provides the monoclonal antibody for detecting puccinia striiformis f.sp.tritici, puccinia triticina f.sp.tritici and puccicinia graminis f.sp.tritici, which is secreted by hybridoma cell line with a collection number CGMCC No.4414 and can identify puccinia triticina f.sp.tritici, puccicinia graminis f.sp.tritici and puccinia striiformis f.sp.tritici at the same time. The invention also provides a detection method based on the combination of the monoclonal antibody and an immune fluorescence technology and a kit. The monoclonal antibody, the detection method and the kit have the advantages of high specificity, high sensitivity, and simplicity and quickness of operation.
Owner:INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI

Small GTP binding protein gene TaRab18 and expression vector and application thereof

InactiveCN105200063AImprove stripe rust resistanceIncrease resistancePlant peptidesFermentationSmall GTP binding proteinTriticeae
The invention belongs to the field of gene engineering, and discloses a small GTP binding protein gene TaRab18 and an expression vector and application thereof. The cDNA sequence of the small GTP binding protein gene TaRab18 is SEQ ID NO.1, and the sequence amino acid coded by the small GTP binding protein gene TaRab18 is SEQ IDNO.2. The gene comes from ordinary wheat (Triticum asetivum L.)92R137. The puccinia striiformis induction expression of TaRab18 in the stripe rust prevention wheat variety 92R137 is enhanced, the expression level of TaRab18 is far higher than the expression level in susceptible wheat variety Yangmai 158. An over-expression vector is obtained by inserting the gene in pBI220, susceptible wheat variety Yangmai 158 is converted, the result of substituting T1 of positive transformation plants to the stripe rust identification shows that the resistance of the susceptible wheat variety to the stripe rust can be improved through the over-expression of TaRab18.
Owner:JIANGSU LIXIAHE REGION AGRI RES INST

Colloidal gold test strip used for detecting wheat leaf rust

The invention provides a colloidal gold test strip used for detecting wheat leaf rust. The colloidal gold test strip comprises a sample pad, a colloidal-gold pad, an NC membrane, absorbent paper and a PS base plate, wherein the sample pad, the colloidal-gold pad, the NC membrane and the absorbent paper are successively arranged on the PS base plate along the chromatographic direction of a sample, the colloidal-gold pad is coated by a colloidal gold-labeled monoclonal antibody against Puccinia triticina, the NC membrane successively comprises a detection line and a quality control line along the chromatographic direction of the sample, the detection line is coated with Puccinia triticina antigen protein that the monoclonal antibody can specifically recognize, and the quality control line is coated with a goat anti-mouse secondary antibody. The monoclonal antibody against Puccinia triticina is secreted by a hybridoma cell with an accession number of CGMCC No. 10884. When the test strip is used for detection, the process from sampling to obtainment of detection results only takes 15 min, operation is simple and convenient, the results are accurate, early warning of wheat leaf rust can be realized, and economic loss caused by diseases is reduced.
Owner:INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI

Biological method for inhibiting rapid growth of mikania micrantha

ActiveCN114514836ADecreased net photosynthetic rateReduced net photosynthetic rateInvasive species monitoringPlant cultivationBiotechnologyStoma
The invention belongs to the technical field of biological prevention and control, and discloses a biological method for inhibiting rapid growth of mikania micrantha, which comprises the following steps: measuring the safety of mikania micrantha puccinia peucedanum on non-target organisms; determining the mikania micrantha puccinia infection process; determining the phenotype of mikania micrantha growth inhibition by mikania micrantha puccinia Determining the inhibition of mikania micrantha hormone synthesis by mikania micrantha puccinia And determining the inhibition of mikania micrantha puccinia peucedanum on the photosynthesis of Through measurement of the net photosynthetic rate and the stomatal conductance of mikania micrantha leaves and content analysis of Kalvin cycle pathway related metabolites, it is found that after mikania micrantha puccinia is infected, the photosynthetic rate and the stomatal conductance of the leaves can be remarkably reduced, the content of Kalvin cycle pathway related compounds is inhibited, the net photosynthetic rate is reduced by 10.57%, and the content of Kalvin cycle pathway related metabolites is reduced by 10.57%. The stomatal conductance is reduced by 26.03%, and the content of Kalvin cycle pathway related compounds is reduced by 1.9-3.4 times.
Owner:AGRI GENOMICS INST CHINESE ACADEMY OF AGRI SCI

Fungal Resistant Plants Expressing MYBTF

The present invention relates to a method of increasing resistance against fungal pathogens of the order Pucciniales in plants and / or plant cells. This is achieved by increasing the expression of a MybTF protein or fragment thereof in a plant, plant part and / or plant cell in comparison to wild type plants, wild type plant parts and / or wild type plant cells. Furthermore, the invention relates to transgenic plants, plant parts, and / or plant cells having an increased resistance against fungal pathogens, in particular, pathogens of the order Pucciniales, and to recombinant expression vectors comprising a sequence that is identical or homologous to a sequence encoding a MybTF protein.
Owner:BASF PLANT SCI GMBH

Penconazole and zhongshengmycin-containing sterilization composition and application thereof

The invention relates to the field of pesticide compounding techniques, particularly relates to a penconazole and zhongshengmycin-containing sterilization composition, and also relates to an application thereof. The penconazole and zhongshengmycin-containing sterilization composition comprises effective ingredients of penconazole and zhongshengmycin with a weight part ratio of (90:1)-(1:90), and the penconazole and zhongshengmycin-containing sterilization composition is prepared into a wettable powder, a suspending agent, an emulsion in water, a water dispersible granule, emulsifiable concentrate and the like after being added with assistants and an excipient, and is used for controlling fungal diseases caused by germs such as erysiphe, uromyces, mortierella, septoria and venturia and bacterial diseases caused by germs such as Gram-positive bacteria, Gram-negative bacteria, mycobacteria and saccharomycetes. The penconazole and zhongshengmycin-containing sterilization composition has a relatively good synergism within a certain range, is superior to a single preparation on the aspect of control effects, is relatively durable in pesticide effect, has a special effect on controlling powdery mildew, rust diseases, scab, leaf spot diseases, gray mold, white rot, soft rot, streak diseases, rice blast, ring spot, gibberellic diseases and bacterial diseases, is relatively low in residue, is relatively easily decomposed after a lasting period, is relatively environment-friendly, and is beneficial to the increase of yield and income in an agricultural district.
Owner:江西绿川生物科技实业有限公司

Fungal resistant plants expressing MybTF

The present invention relates to a method of increasing resistance against fungal pathogens of the order Pucciniales in plants and / or plant cells. This is achieved by increasing the expression of a MybTF protein or fragment thereof in a plant, plant part and / or plant cell in comparison to wild type plants, wild type plant parts and / or wild type plant cells. Furthermore, the invention relates to transgenic plants, plant parts, and / or plant cells having an increased resistance against fungal pathogens, in particular, pathogens of the order Pucciniales, and to recombinant expression vectors comprising a sequence that is identical or homologous to a sequence encoding a MybTF protein.
Owner:BASF PLANT SCI GMBH

PCR quantitative detection method and kit for corn southern rust pathogenic bacteria in incubation period

The invention relates to a real-time fluorescent quantitative PCR technology-based detection method and a kit for corn southern rust pathogenic bacteria puccinia polypoda. Specific primers and TaqMan probes are designed according to ITS of corn southern rust and Actin2 gene sequences of corn, and a PCR quantitative detection system for the incubation period of the corn southern rust is established on the basis of the two pairs of primers and probes. The primers and the probes for the corn southern rust fungus and the corn have the characteristics of high specificity and sensitivity. The PCR quantitative detection system for the puccinia multiflora incubation period, established by the invention, not only can detect the puccinia multiflora in the incubation period, but also can detect the infection amount at different time after infection, and the system can be used for early detection and quantitative detection of the puccinia multiflora. The research method provided by the invention can be effectively applied to early molecular detection of puccinia polypoda, and has important significance in the aspects of early prediction, forecast, comprehensive treatment and the like of the corn southern rust disease.
Owner:CHINA AGRI UNIV

Monoclonal antibody, immune fluorescence method and kit for detecting three rusts

The invention discloses 'a monoclonal antibody, an immune fluorescence method and a kit for detecting puccinia striiformis f.sp.tritici, puccinia triticina f.sp.tritici and puccicinia graminis f.sp.tritici' and belongs to the field of agricultural biotechnology. The invention mainly provides the monoclonal antibody for detecting puccinia striiformis f.sp.tritici, puccinia triticina f.sp.tritici and puccicinia graminis f.sp.tritici, which is secreted by hybridoma cell line with a collection number CGMCC No.4414 and can identify puccinia triticina f.sp.tritici, puccicinia graminis f.sp.tritici and puccinia striiformis f.sp.tritici at the same time. The invention also provides a detection method based on the combination of the monoclonal antibody and an immune fluorescence technology and a kit. The monoclonal antibody, the detection method and the kit have the advantages of high specificity, high sensitivity, and simplicity and quickness of operation.
Owner:INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI

Mannose-1-phosphate guanylyl transferase, coding gene and application

The invention belongs to the technical field of gene engineering, and discloses mannose-1-phosphate guanylyl transferase, a coding gene and application. The amino acid sequence of the mannose-1-phosphate guanylyl transferase is SEQIDNO: 1; the nucleotide sequence of the DNA for coding the mannose-1-phosphate guanylyl transferase is as shown in SEQ ID NO: 2; and the cDNA (complementary deoxyribonucleic acid) nucleotide sequence of the mannose-1-phosphate guanylyl transferase is shown as SEQ ID NO: 3. The mannose-1-phosphate guanylyl transferase PsMT1 provided by the invention is a hexose transport protein family member, has a mannose transport function, and plays an important role in a process of catalyzing conversion of fructose into mannose; and the PsMT1 gene expression is inhibited through a gene engineering technology to influence the thallus growth of wheat stripe rust (Puccinia striiformis), the pathogenicity of wheat stripe rust is reduced, and the gene has a good application prospect in the aspect of developing small molecule nucleotide pesticides for preventing and treating wheat stripe rust.
Owner:天津市农业科学院

Method for researching corn southern rust group inheritance and transmission based on SNP (Single Nucleotide Polymorphism)

The invention provides a method for researching genetic and propagation paths of a corn southern rust group based on an SNP (Single Nucleotide Polymorphism) marker. According to the method, DNA of different strains is subjected to enzyme digestion by using screened restriction enzymes EcoRI and MspI, so that a genome sequencing technology is simplified, SNP markers are mined by using Stacks software, and then the genetic structure and the propagation path of a puccinia multiflora population are researched; the restriction endonucleases EcoRI and MspI provided by the invention have a better cutting effect on the whole genome of puccinia multiflora, and compared with other combinations, more tags can be obtained under the condition of the same sequencing depth. At present, whole genome sequencing of puccinia multiflora is not performed yet, and the method for researching the population genetic structure and the propagation path of puccinia multiflora on the basis of the SNP sites obtained by simplifying genome sequencing and utilizing stacks software has important significance on comprehensive treatment and accurate prevention and control of diseases.
Owner:CHINA AGRI UNIV

Method and special device for predicting field apocynum rust

The invention discloses a method for predicting Apocynum rust caused by Apocynum palisander and a special device for the method. Disease force calculation steps are realized. It can predict more accurately the occurrence of grid rust in field planting of Apocynum apocynum, and then effectively formulate the prevention and control plan. Compared with the prior art, the present invention solves the problem of effectively measuring the number of pathogenic bacteria with infecting ability while measuring the number of pathogenic bacteria, especially solving the problem that the air microbial sampler completes the sampling of the detached leaves of Apocynum apocynum in vitro. The problem of pollution and rot is suitable for the prediction and forecasting of grid rust in field commercial plantation of apocynum.
Owner:XINJIANG ALTAY PREFECTURE GAUBAO KENDER CO LTD

A kind of animal growth promoter containing Puccinia reedi and its preparation method

The invention belongs to the technical field of development and research of feed additives, and specifically discloses an animal growth promoter containing Puccinia reedi, which contains Puccinia reedi with the nucleotide sequence shown in SEQ ID NO.1. Preparation method: 1. collection of teliospores of Puccinia reed; 2. drying; 3. crushing of reed leaves; 4. crushing of teliospores of Puccinia reed; In the invention, the teliospores of Puccinia reedi are broken and fed to animals in the form of feed additives, which can significantly promote the growth of animals in practice.
Owner:VETERINARY INST XINJINAG ACADEMY OF ANIMAL SCI CLINIC MEDICAL SCI RES CENT XINJIANG ACADEMY OF ANIMAL HUSBANDRY SCI

Application of wheat stripe rust pstg_17694 gene in stripe rust control and breeding method of stripe rust resistant wheat

ActiveCN108559753BRegulate growth and reproductionSignificant resistance to wheat stripe rustPeptidesFermentationBiotechnologyPuccinia graminis tritici
The invention provides application of a puccinia striiformis (PSTG_17694) gene in prevention and treatment of puccinia striiformis. The sequence of the PSTG_17694 gene is shown in Seq ID No.1; the PSTG_17694 gene can effectively regulate and control growth and propagation of puccinia striiformis and is used as a molecular target of transcriptional regulation and control or used as a gene target for inhibiting a protein function, and the PSTG_17694 gene is silenced to achieve the effect of inhibiting the growth and propagation of puccinia striiformis. According to a cultivation method for anti-puccinia-striiformis wheat by using the gene, the obtained wheat has obvious puccinia striiformis resistance.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Application of wheat stripe rust pstg_06371 gene in stripe rust control and breeding method of stripe rust resistant wheat

ActiveCN108220304BRegulate growth and reproductionSignificant resistance to wheat stripe rustPeptidesFermentationBiotechnologyPuccinia graminis tritici
The invention provides application of a puccinia striiformis PSTG_06371 gene to prevention and control of wheat stripe rust. The sequence of the PSTG_06371 gene is shown as SEQ ID No. 5; the PSTG_06371 gene can be used for effectively regulating and controlling growth and proliferation of puccinia striiformis; the PSTG_06371 gene is used as a molecular target for transcriptional regulation or a gene target for inhibiting a protein function; the effect of inhibiting the growth and proliferation of the puccinia striiformis is realized through silencing the PSTG_06371 gene. Wheat obtained by themethod for culturing puccinia striiformis resisting wheat by utilizing the gene has remarkable puccinia striiformis resistance.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Screening method for multigene pedigree of Cylindricaceae

The invention discloses the preparation and application of a multigene pedigree screening database of the Cylindricaceae. The present invention provides the application of the substances shown in a) and b) in identifying or distinguishing the species of Cylindricaceae, and the substance shown in a) is a substance for detecting the following gene sequence in the sample to be tested or the pathogenic bacteria to be tested: ITS and LSU; the material shown in b) is the ITS and LSU gene sequences in the existing Cylindropyraceae species and various genus; the present invention uses the ITS and LSU gene sequences to carry out the construction of the evolutionary tree and the homology comparison, which can Detecting Pillarphyllaceae, at the quarantine port, can quickly and accurately screen samples containing Pillarphyllaceae fungi to prevent the spread of germs along with the import, export and transportation of seeds and other reproductive materials, so as to protect the healthy development of agricultural production in our country , is of great significance.
Owner:INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More