Gene TaFBK1 with F-box structure field, and expression vector and application thereof

An expression vector and f-box technology, applied in the field of genetic engineering, can solve the problems of reduced wheat yield and no grain harvest, and achieve the effect of improving resistance and improving stripe rust resistance.

Active Publication Date: 2015-05-06
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disease often causes severe reduction in wheat production, even grain failure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene TaFBK1 with F-box structure field, and expression vector and application thereof
  • Gene TaFBK1 with F-box structure field, and expression vector and application thereof
  • Gene TaFBK1 with F-box structure field, and expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Cloning of gene TaFBK1 with F-box domain induced by stripe rust in 92R137

[0026] 92R137 is a translocation line created by Nanjing Agricultural University by crossing tetraploid Triticum turgitum with diploid Triticum villosa (Haynaldia villosa) and backcrossing with hexaploid common wheat several times. (Chen, P.D., Qi, L.L., Zhou, B., S.Z. Zhang, D.J. Liu. 1995 Development and molecular cytogenetic analysis of wheat-Haynaldia villosa 6VS / 6AL translocation lines specifying resistance to powdery mildew. TAG, (91): 1125-1128. ). Chromosome 1B of 92R137 contains the wheat stripe rust resistance gene Yr26, which has a high resistance-immune level to dominant races 29, 31, and 32 in the highly virulent race (Chunmei Wang, Yiping Zhang, Dejun Han, Zhensheng Kang, Guiping Li, Aizhong Cao, Peidu Chen. SSR and STS markers for wheat stripe rust resistance gene Yr26. Euphytica, 2008, 159:359-366.).

[0027] In order to clone the resistance-related genes in the Yr26 ...

Embodiment 2

[0029] Example 2 Analysis of expression characteristics of TaFBK1 gene induced by stripe rust

[0030] In order to study the expression pattern of TaFBK1 in stripe rust-resistant materials, the RNA reverse transcription cDNA of the resistant material 92R137 and the susceptible material Yangmai 158 induced by stripe rust for 0, 6, 12, 24, and 72 hours were used as templates. Using P3 (GTTTGCTTGTTGTGCATTGG, SEQ ID NO.5) and P4 (CGCTTGCGACATTCAAGATA, SEQ ID NO.6) as primers for real-time fluorescent quantitative PCR (Q-PCR) analysis. The PCR program is as follows: the PCR reaction is amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad Company, USA) and the fluorescence is detected. The 20uL PCR reaction system contains 10uL of 2×SYBR Green PCR Master Mix, 0.5μM primers P3 and P4, and 2uL of reverse transcription cDNA template. The amplification parameters were: 95°C for 10 minutes, then 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 1 minute, ...

Embodiment 3

[0031] Example 3 Construction of TaFBK1 overexpression vector and its transformation into common wheat Yangmai 158 and identification of its resistance to stripe rust

[0032] Using the cDNA from 92R137 as a template, the primers P5 (ATCCCGGGTATGGTTGAGTGCACAATGG, SEQ ID NO.7) and P6 (ATAGGTACCGAGCCTAGATCTTCAGCAGA, SEQ ID NO.8) spanning the ORF were designed with the full-length sequence of the TaFBK1 gene, and P5 carried the SmaI enzyme Cutting site, P6 has KpnI restriction site. PCR amplification was performed using primer pairs P5 and P6, and amplified fragments were recovered. The amplified product was double digested with SmaI and KpnI, and the digested product was inserted into the vector pBI220 (Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J.1987,6:3901-3907.), put TaFBK1 at the multiple cloning site behind the 35S promoter, and replace the GUS gene carried by the vector itsel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, and discloses a gene TaFBK1 with F-box structure field, and an expression vector and application thereof. The cDNA (complementary deoxyribonucleic acid) sequence of the gene TaFBK1 with F-box structure field is SEQ ID NO.1, and the coded amino acid sequence is SEQ ID NO.2. The gene is from common wheat (Triticum asetivum L.) 92R137. The TaFBK1 is induced by Puccinia strilformis to enhance the expression in anti-Puccinia-strilformis wheat species 92R137, and the expression level is much higher than that in the Puccinia-strilformis-infected wheat species Yangmai 158. When the gene is inserted into pBI220 to obtain an overexpression vector and used for transforming the Puccinia-strilformis-infected wheat species Yangmai 158, the T1-generation anti-Puccinia- strilformis identification result on the positive transformed plant indicates that the overexpression of the TaFBK1 can enhance the Puccinia strilformis resistance of the Puccinia-strilformis-infected wheat species.

Description

technical field [0001] The invention belongs to the field of genetic engineering and discloses a gene TaFBK1 with an F-box structure domain, its expression vector and application. Background technique [0002] Wheat (Triticum aestivum L.) is the grain crop with the largest planting area in the world, and it is also an important grain crop in my country. The high and stable yield of wheat is related to the food security of our country. Wheat stripe rust is an airborne fungal disease caused by the infection of wheat stripe rust (Puccinia striiformis f.sp.tritic). It occurs mainly on leaves, followed by leaf sheaths and stems. occur. Wheat stripe rust is widely distributed. In major wheat-producing countries in the world such as the United States, China, India, Russia, Canada, Pakistan, Australia and some countries in Western Europe, wheat stripe rust is an important disease. It can be said that there are places where wheat is cultivated. There is occurrence of wheat stripe r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00
Inventor曹爱忠葛帅刑书娟邢莉萍蒋正宁张国琴王秀娥陈佩度
OwnerNANJING AGRICULTURAL UNIVERSITY