Small GTP binding protein gene TaRab18 and expression vector and application thereof

A technology combining proteins and expression vectors, applied in the field of genetic engineering, can solve the problems of variety resistance loss, single large-scale planting, etc., and achieve the effect of improving resistance and stripe rust resistance

Inactive Publication Date: 2015-12-30
JIANGSU LIXIAHE REGION AGRI RES INST
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Breeding and promoting wheat disease-resistant varieties for many years has been the main means for plant disease scientists and breeders to solve and control wheat stripe rust. Although it is quite effective, due to the high genetic variability of wheat stripe rust

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small GTP binding protein gene TaRab18 and expression vector and application thereof
  • Small GTP binding protein gene TaRab18 and expression vector and application thereof
  • Small GTP binding protein gene TaRab18 and expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1 is subjected to the cloning of the gene TaRab18 with GTP / GDP binding effect induced by stripe rust

[0027] In order to clone the resistance-related genes in the Yr26 disease resistance pathway, gene microarray hybridization was used to screen the differentially expressed genes in stripe rust-resistant wheat 92R137 and stripe rust-susceptible wheat Yangmai 158. An EST probe Ta.1763.2.S1_at with 10-fold up-regulated expression was obtained from multiple screenings. Based on this probe sequence, the amplification product of expected length was obtained by RACE ( figure 1 A), the sequence length after splicing is 1015bp. Full-length primers P1 (CCAGCCATGGACTCTTCTTC, SEQ ID NO.3) and P2 (AGCTGAAAGCTGCCAAGGTA, SEQ ID NO.4) were designed according to the spliced ​​sequence. Using the disease-resistant wheat 92R137cDNA as a template, an amplified product with an expected length of 826bp was obtained by RT-PCR ( figure 1 B), and it is recovered, cloned, and sequ...

Embodiment 2

[0028] Embodiment 2 TaRab18 gene is subjected to the expression characteristic analysis of stripe rust induction

[0029] In order to study the expression pattern of TaRab18 in stripe rust-resistant materials, the RNA reverse transcription cDNA of the resistant material 92R137 and the susceptible material Yangmai 158 induced by stripe rust for 0, 6, 12, 24, and 72 hours were used as templates. Real-time fluorescent quantitative PCR (Q-PCR) analysis was performed using P3 (CGCAGCCGGACTTCGACTACC, SEQ ID NO.5) and P4 (CCCAGACGGCGAGCTTGAGC, SEQ ID NO.6) as primers. The PCR program is as follows: the PCR reaction is amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad Company, USA) and the fluorescence is detected. The 20uLPCR reaction system contains 10uL of 2×SYBRGreenPCRMasterMix, 0.5μM primers P3 and P4, and 2uL of reverse transcription cDNA template. The amplification parameters were: 95°C for 10 minutes, then 95°C for 15 seconds, 60°C for 30 second...

Embodiment 3

[0030] Example 3 Construction of TaRab18 overexpression vector and its transformation into common wheat Yangmai 158 and identification of resistance to stripe rust

[0031]Using the cDNA from 92R137 as a template, the primers P5 (ATCCCGGGTATGGTTGAGTGCACAATGG, SEQ ID NO.7) and P6 (ATAGGTACCGAGCCTAGATCTTCAGCAGA, SEQ ID NO.8) across the ORF were designed with the full-length sequence of the TaRab18 gene, and P5 has a restriction site for BamH1, P6 has a restriction site for KpnI. PCR amplification was performed using primer pairs P5 and P6, and amplified fragments were recovered. The amplified product was double digested with BamH1 and KpnI, and the digested product was inserted into the vector pBI220 (JeffersonRA, KavanaghTA, BevanMW.GUSfusions:beta-glucuronidaseassensitiveandversatilegenefusionmarkerinhigherplants.EMBOJ.1987,6:3901- 3907.), put TaRab18 at the multiple cloning site behind the 35S promoter, and replace the GUS gene contained in the vector itself. Thus, the targ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of gene engineering, and discloses a small GTP binding protein gene TaRab18 and an expression vector and application thereof. The cDNA sequence of the small GTP binding protein gene TaRab18 is SEQ ID NO.1, and the sequence amino acid coded by the small GTP binding protein gene TaRab18 is SEQ IDNO.2. The gene comes from ordinary wheat (Triticum asetivum L.)92R137. The puccinia striiformis induction expression of TaRab18 in the stripe rust prevention wheat variety 92R137 is enhanced, the expression level of TaRab18 is far higher than the expression level in susceptible wheat variety Yangmai 158. An over-expression vector is obtained by inserting the gene in pBI220, susceptible wheat variety Yangmai 158 is converted, the result of substituting T1 of positive transformation plants to the stripe rust identification shows that the resistance of the susceptible wheat variety to the stripe rust can be improved through the over-expression of TaRab18.

Description

technical field [0001] The invention belongs to the field of genetic engineering and discloses a small GTP-binding protein gene TaRab18 and its expression vector and application. Background technique [0002] Wheat (Triticum aestivum L.) stripe rust is a serious wheat disease caused by wheat stripe rust (Pucciniastriiformisf.sp.tritici), which commonly occurs in more than 60 countries and regions in the world. Wheat stripe rust mainly occurs on wheat leaves, but can also occur on leaf sheaths and stems, ear awns and glumes. Wheat stripe rust has the characteristics of strong explosiveness, high epidemic frequency, fast transmission speed, difficult prevention, wide occurrence range and serious damage. In general epidemic years, wheat stripe rust can reduce wheat yield by 20%-30%, while in pandemic years, the yield loss can reach 50%-60%, or even no harvest. my country is not only the largest endemic area of ​​wheat stripe rust in the world, but also a relatively independen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00
Inventor 蒋正宁曹爱忠张伯桥高德荣别同德赵仁慧吴旭江
Owner JIANGSU LIXIAHE REGION AGRI RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap