825 results about "Gene Microarray" patented technology

The invention discloses a kit for quickly detecting 15 pneumonia pathogenic bacteria. The kit can detect streptococcus pneumoniae, staphylococcus aureus, haemophilus influenzae, mycoplasma pneumoniae, pseudomonas aeruginosa, baumanii, enterococcus faecalis, enterococcus faecium, klebsiella pneumoniae, escherichia coli, enterobacter cloacae, stenotrophomonas maltophilia, burkholderia cepacia, legionella pneumophila and chlamydia pneumoniae which cover clinically common pneumonia pathogenic bacteria difficult to culture. 16S rDNA and specific gene sequences corresponding to the pneumonia pathogenic bacteria are detected by combining gene chips with multiple asymmetric PCR reactions, and the categories of the bacteria in a to-be-detected sample are identified in genus and species. The kit makes up for the defect that current clinical detection of pneumonia pathogenic bacteria is not in time or comprehensive and a novel detection means for early diagnosis and early treatment of patients suffering from pneumonia is provided.

The invention relates to the technical field of biological gene chips, and particularly relates to a gene chip for screening various ophthalmological hereditary diseases as well as preparation and a usage method of the gene chip. Specific oligonucleotide probes of gene sequences which are related to 261 ophthalmological hereditary diseases are fixed on the surface of a carrier of the gene chip for screening various ophthalmological hereditary diseases; and the gene chip which is related to the 261 ophthalmological hereditary diseases comprises the sequences of all coding region sequences of 954 related virulence genes or disease predisposing genes and introne sequences adjacent to the coding regions. As the specific oligonucleotide probes of the gene sequences which are related to 261 ophthalmological hereditary diseases and the sequences of all the coding region sequences of the related virulence genes or disease predisposing genes and the introne sequences adjacent to the coding regions are fixed on the surface of the carrier of the gene chip, the gene chip provided by the invention is capable of screening a plurality of ophthalmological hereditary diseases at the same time and then the efficiency is greatly improved.

The invention belongs to the field of biological medicines, and relates to a method for screening HRDs disease-causing mutation and a gene chip hybridization probe designing method involved in the same. The method for screening the HRDs disease-causing mutation comprises the steps of (1) establishing an HRDs genetic resource repository; (2) designing and synthesizing a gene chip hybridization probe of an HRDs disease-causing gene, and integrating the gene chip hybridization probe onto a gene chip; (3) capturing a target area by utilizing the prepared gene chip and executing the depth sequencing; (4) analyzing the sequencing data on the aspect of bioinformatics, and screening the candidate disease-causing gene; (5) functionally predicting a newly-discovered splicing gene mutation site. By establishing the high-efficient HRDs target gene capturing technology, adopting the depth sequencing as a means and confirming the efficiency of the HRDs capturing chip, a high-efficient credible biological information analysis model is established.

The invention relates to information security technology, in particular to a virtual genome-based cryptosystem (VGC). The cryptosystem is provided with two matched keys, of which one is a virtual genome database (VGDB) consisting of random deoxyribonucleic acid (DNA) sequences and the other one is a position table that virtual genes of the VGDB are randomly distributed in a two-dimensional microarray, namely a virtual DNA microarray chip (VDMC). Any plaintext information can be freely written on the VDMC, namely points for forming the plaintext information are selected from the VDMC microarray. The selected points correspond to the virtual genes in the VGDB; small segments of DNA sequences are randomly selected from the virtual genes; and the uniqueness of the small segments of DNA sequences in the VGDB is determined by using a common tool of the bioinformatics, namely a basic local alignment search tool (BLAST), or other character string search algorithms such as a Knuth-Morris-Pratt (KMP) algorithm and the like. A cipher text is combined by the small segments of DNA sequences. The small segments of DNA sequences need only to perform BLAST on the VGDB during decryption, namely the points for forming the plaintext information can be discovered, and the plaintext information can be restored according to the VDMC. Any non-VGDB sequence can be randomly inserted into the cipher text and does not have any influence on the encryption. Thus, the VGC is an excellent information hiding system. In addition, the VGC key can be updated automatically so as to realize an indecipherable one-time-pad system. The cryptosystem is used for real-time quick secret information communication, digital signature and identity authentication.

The invention relates to a gene chip used for detecting gene mutation relating to a high blood pressure personalized medicine. The gene chip for detecting the gene mutation relating to high blood pressure personalized medicine comprises a solid phase support, a gene probe (an oligonueleotide probe) fixed in the solid phase support sequentially and a PCR primer used for amplifying the mutated gene fragment in the sample; the gene probe (the oligonueleotide probe) and the PCR primer are designed aiming at one or two points of the gene mutation in ACE (I/D) and CYP3A5*3 and / or two or more points as follows: CYP2C9*3, CYP2C9*13, AGTR1(A1166C), CYP2D6*10, ADRB1(C1165G), TSC(C1784T), ADRB3(T727C), SCNN1G_rs5729, SCNN1G_rs5723, ENOSA_rs1799983 and GNB3(C825T). The invention provides the gene chip and applications thereof for conveniently, quickly and systematically detecting the gene mutation relating to high blood pressure personalized medicine so as to determine drug reactions.

The invention relates to a respiratory tract common pathogen multiple PT-PCR combined gene chip detection kit. The kit detects one or more of 22 respiratory tract common pathogens by the usage of multiple specific conservative degenerate primer combination and probe combination and provided with endogenous control, positive control and negative control at the same time. According to the detection kit, the coverage rate for a high mutant pathogen subject sequence is increased, the problem of nonspecific cross reaction between the multiple primers and the probe is avoided, one single reaction system can detect more than 20 respiratory tract common pathogens simultaneously, and a detection tool which is simple and sensitive, rapid and large in flux and capable of carrying out multi-index parallel detection is provided for respiratory tract common pathogen detection.

The invention discloses a gene for generating related diterpene synthase together with a tanshinone compound as well as an encoding product and an application thereof. The gene is named as the tanshin ent-kaurene synthase gene (SmKSL) and is obtained from tanshin by cloning and adopting a gene chip technology, and as for the sequence, see to SEQ ID No.1. The protein encoded by the SmKSL is the protein provided with an aminoacid residue sequence with SEQ ID No.2 or is the protein derived via the SEQ ID No. 2 by replacement, deletion or addition of one or more aminoacid residues for the aminoacid residue sequence with SEQ ID No.2 and provided with the same activity with the aminoacid residue sequence with SEQ ID No.2. The SmKSL is a key enzyme gene in a tanshin diterpene secondary metabolic pathway, the genetic expression is closely related with the generation of the tanshinone compounds, for example, tanshinone IIA, and the invention has important theoretical and practical significances for adjusting and producing plant diterpenoid compounds and cultivating the excellent medical new plant variety.

The invention relates to a method for identifying gene mutation types in the field of gene analysis as well as a special chip and a kit thereof. The gene mutation detecting method comprises the following steps: taking a genome to be detected from a human tissue as a template, carrying out multiple allele special PCR amplification by a primer group that is designed aiming at special mutant sites and DNA polymerase without 3'-5' end exonclease activity, then hybridizing the obtained PCR product and an oligonucleotide probe (allele special probe) on the gene chip, and confirming mutation types of all gene sites according to the hybridizing result. The allele special probe is designed aiming at special gene types of gene mutant sites to be detected. The invention can detect gene mutations in comprehensive, systemic and high-flux ways and has light environmental pollution as well as simple and rapid operation compared with PCR-RFLP and a sequencing method.

The present invention provides a gene chip for quickly detecting pathogens from food source, discloses the preparation method of said gene chip and provides 26 oligonucleotide probe sequences for detection. Said gene chip can quickly, accurately and high-effectively detect and identify the class of the pathogens in food, and its detection range includes staphylococcus aureus, Shiga's bacillus, salmonella, colibacillus 0157, bacillus proteus, mononuclear hyperplastic listerella, enterocolitis yersinia, aeruginous pseudomonads, vibrio parahaemolyticus, vibrio cholerae, bacillus cereus, beta hemolytic streptococcus, coconut fermentation pseudomonads, boticin, vibrio jejuni and bacillus perfringens, etc.

The invention discloses a method of detecting 26311 Mutation of COL7A1 gene and a usage thereof. The method adopts primers of p87F (TGGGCCTGAAATATGAGGAG) and P87R (TAGGCCACTGGAGAGACAGG) to PCR-amplify COL7A1 gene including the section of 26251-26350, implements the sequence after the purification of products, or uses BslI for the endonuclease detection after using p87Fa (TCCCACGGGGGCCCCTGGACAG) and P87Ra (TCCCCCGCCCCCACCCT GCCA) for the nest amplification of the PCR products. The usage is the application in preparations or gene chips for detecting the diagnosis of dominant dystrophic epidemolysis bullosa genealogy. The invention provides a novel way for the prenatal diagnosis of the bullosa and provides a basis for the gene therapy.

The invention discloses an influenza/human and avian influenza virus detection gene chip and a preparation method and an application thereof, 102 probes used for detecting A type, B type, H1N1 hipotype, H3N2 hipotype, H5N1 hipotype and H9N2 hipotype influenza viruses and 4 highly pathogenic differential diagnosis probes, as well as a process of sample treatment, hybridization, elution and chip identification which can carry out detection, typing or identification over the 6 types of viruses simultaneously and can identify the high pathogenicity of viruses. The invention not only greatly shortens the detection time of influenza viruses, but also improves the detection accuracy and provides a feasible technique support for the early warning mechanism of influenza epidemic situation in fields of clinical diagnosis, inspection quarantine, and the like.

The invention relates to a multiplex PCR (polymerase chain reaction) primer, a probe and a gene chip for detecting the bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus. The multiplex PCR primer and probe have the nucleotide sequences shown by SEQ ID No.1 to SEQ ID and No.9. The gene chip comprises a solid-phase carrier, a sample application quality control probe, a positive hybrid quality control probe and a multiplex PCR primer for detecting the bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus and the corresponding probe. In the invention, the forward primers of three viruses are marked with fluorescence, a gene chip detection technology carrying three viruses in animal fur is established based on multiplex RT-PCR (reverse transcription-polymerase chain reaction), and the RNA virus in the fur can be sensitively and specifically detected with high flux; the three viruses are screened at the same time in detection once, and the situation that a specific method is required for each virus before is changed, thereby saving the diagnosis time, meeting the needs for quick detection of mass imported/exported fur samples of the exit-entry inspection and quarantine departments and the fur import and export enterprises, and realizing relatively high application values.

The invention relates to a method for analyzing the correlation between CT imaging genomics characteristics and gene expression in lung cancer. The method includes: using a semi-automatic segmentationmethod to extract CT imaging genomics characteristics of a segmented tumor were; performing clustering analysis on the basis of preprocessed gene data, and taking a first principal component as a representative of a gene clustering result with a similar expression profile; and finally, using a gene chip saliency analysis algorithm to find the correlation between CT imaging genomics characteristics and gene expression in lung cancer, and verifying and analyzing the result. The invention provides a novel scheme for exploring the relationship between the image characteristics and the gene data,and attempts to find an imaging substitute of the gene, interprets the image characteristics from the gene level, and assists the personalized treatment of the tumor well.

The invention discloses a method related to DNA folded paper and a structure and an application thereof. The method comprises the following steps of: (1) preparing a DNA folded paper staple chain of a tail end modification reactant I, and arranging a connector between the tail end of the staple chain and the reactant I; (2) performing self-assembly on the staple chain obtained in the step (1) and a scaffold chain; (3) adding a reactant II which is specifically combined with the reactant I; and (4) detecting information on the combination of the reactant I and the reactant II. The connector is arranged between the reactant I and a staple short chain, so that the reaction locus of the reactant I which is effective to the reactant II on the DNA folded paper can be accurately controlled in particular to the DNA folded paper absorbed on a solid-liquid interface. The method can be taken as a detection method for a gene chip, and be used for specifically distributing reactants. The method can be used for detecting monomolecular reactions, and has extremely high sensitivity and specificity.

The invention relates to a gene chip, and discloses an integrated detection gene chip of an mtDNA mutation site related to Leber genetic optic neuropathy, as well as the preparation and the application thereof. A specific oligonucleotide detecting probe of the mtDNA mutational site related to the Leber genetic optic neuropathy and a specific oligonucleotide detecting probe of a mononucleotide polymorphyism site mtDNA 11719G>A are fixed on the carrier surface lattice of the gene chip. The gene chip has the advantages of time saving, low cost, simple operation and the like, has 32 mutation sites related to the Leber genetic optic neuropathy in a specific detecting clinical sample only through one-time PCR amplification and one-time crossing reaction, and is suitable for the gene diagnosis of the Leber genetic optic neuropathy.

The invention belongs to the field of the detection of molecular biological information, in particular to a correction method for improving the accuracy of deoxyribonucleic acid (DNA) high-pass sequencing gene expression detection data. The correction method comprises the steps as follows: (1) gene expression DNA sequencing detection data are collected, and a gene expression DNA high-pass sequencing detection data correction model is established; (2) gene expression values measured by gene chips are collected; (3) model parameters in the gene expression high-pass sequencing correction model are determined by adopting correlation analysis; and (4) corrected gene expression values are generated by the gene expression DNA high-pass sequencing detection data correction model of which the model parameters are determined. The correction method has the advantages that sequence alignment mapping errors caused when DNA sequencing values are corrected by utilizing the correction model are estimated and compensated, so that the detection errors are reduced, and the detection efficiency is effectively improved on the basis that high resolution and high accuracy of the DNA high-pass sequencing detection data are fully played.