Multiplex PCR (polymerase chain reaction) primer, probe and gene chip for detecting bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus
A technology for bovine viral diarrhea and foot-and-mouth disease virus, which is applied in DNA/RNA fragmentation, recombinant DNA technology, microbial determination/inspection, etc. problems such as high-throughput detection methods, to achieve the effect of great application value and saving diagnosis time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The specificity analysis of embodiment 1 gene chip of the present invention
[0039] (1) Design and synthesis of multiplex PCR primers for detection of bluetongue virus, foot-and-mouth disease virus and bovine viral diarrhea virus
[0040] Search the genome sequences of bluetongue virus (BTV), foot-and-mouth disease virus (FMDV), and bovine viral diarrhea virus (BVDV) on NCBI. The target gene sequences of the three viruses are as follows:
[0041] The target gene sequence of BTV:
[0042] ATCCGGGCTGATCCAAAGGTTCGAGGAAGAAAAAATGAAACATAATCAGGATAGAGTTGAGGAATTGAGTTTAGTGCGTGTGGATGATACCATTTCTCAACCCACCAAGATATGCTCCAAGTGCGCCGATGCCATCATCTATGCCGACGGTTGCCCTTGAAATACTGGACAAAGCGATGTCAAACACAACTGGTGCAACGCAAACACAGAAGGCGGAGAAGG
[0043] FMDV target gene sequence:
[0044] TGGGACCATACAGGAGAAGTTGATCTCCGTGGCAGGACTCGCCGTCCATTCTGGACCCGACGAGTACCGGCGTCCTTTGAGCCCTTCCAAGGCCTCTTTGAGATTCCAAGCTACAGATCACTTTACCTGCGTTGG
[0045] The target gene sequence of BVDV:
[0046] GTGGTGAGTTCGTTGGATGGCTGAAGCCCT...
Embodiment 2
[0059] The sensitivity analysis of embodiment 2 gene chip of the present invention
[0060] (1) Construction of plasmids of 3 viruses
[0061] According to the instructions of the viral nucleic acid extraction kit MiniBESTViralRNAExtractionKitVer.4.0, three kinds of viral nucleic acids of BTV, FMDV, and BVDV were extracted respectively, and these three kinds of viral nucleic acids were used as templates, and PCR amplification was performed with reference to the method of Example 1. The target PCR product was recovered, and TA cloned into pMD18-T plasmid. Select positive recombinants, use EcoRI and HindIII to carry out single and double enzyme digestion identification, and carry out sequence determination.
[0062] (2) Gene chip detection
[0063] The concentrations of the recombinant plasmids of the three extracted viruses, including BTV, FMDV, and BVDV, were measured with a micro-nucleic acid protein analyzer, and they were 124.08 ng / μL (1.5×10 11 copies / mL), 78.53ng / μL (1...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap