Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Multiplex PCR (polymerase chain reaction) primer, probe and gene chip for detecting bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus

A technology for bovine viral diarrhea and foot-and-mouth disease virus, which is applied in DNA/RNA fragmentation, recombinant DNA technology, microbial determination/inspection, etc. problems such as high-throughput detection methods, to achieve the effect of great application value and saving diagnosis time

Inactive Publication Date: 2014-04-02
徐超
View PDF1 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The detection method mainly relies on the classic serology and PCR method, lacks a high-throughput detection method for the virus carried by fur, and has been unable to meet the rapid and large-scale detection requirements of imported and exported fur.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiplex PCR (polymerase chain reaction) primer, probe and gene chip for detecting bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus
  • Multiplex PCR (polymerase chain reaction) primer, probe and gene chip for detecting bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus
  • Multiplex PCR (polymerase chain reaction) primer, probe and gene chip for detecting bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The specificity analysis of embodiment 1 gene chip of the present invention

[0039] (1) Design and synthesis of multiplex PCR primers for detection of bluetongue virus, foot-and-mouth disease virus and bovine viral diarrhea virus

[0040] Search the genome sequences of bluetongue virus (BTV), foot-and-mouth disease virus (FMDV), and bovine viral diarrhea virus (BVDV) on NCBI. The target gene sequences of the three viruses are as follows:

[0041] The target gene sequence of BTV:

[0042] ATCCGGGCTGATCCAAAGGTTCGAGGAAGAAAAAATGAAACATAATCAGGATAGAGTTGAGGAATTGAGTTTAGTGCGTGTGGATGATACCATTTCTCAACCCACCAAGATATGCTCCAAGTGCGCCGATGCCATCATCTATGCCGACGGTTGCCCTTGAAATACTGGACAAAGCGATGTCAAACACAACTGGTGCAACGCAAACACAGAAGGCGGAGAAGG

[0043] FMDV target gene sequence:

[0044] TGGGACCATACAGGAGAAGTTGATCTCCGTGGCAGGACTCGCCGTCCATTCTGGACCCGACGAGTACCGGCGTCCTTTGAGCCCTTCCAAGGCCTCTTTGAGATTCCAAGCTACAGATCACTTTACCTGCGTTGG

[0045] The target gene sequence of BVDV:

[0046] GTGGTGAGTTCGTTGGATGGCTGAAGCCCT...

Embodiment 2

[0059] The sensitivity analysis of embodiment 2 gene chip of the present invention

[0060] (1) Construction of plasmids of 3 viruses

[0061] According to the instructions of the viral nucleic acid extraction kit MiniBESTViralRNAExtractionKitVer.4.0, three kinds of viral nucleic acids of BTV, FMDV, and BVDV were extracted respectively, and these three kinds of viral nucleic acids were used as templates, and PCR amplification was performed with reference to the method of Example 1. The target PCR product was recovered, and TA cloned into pMD18-T plasmid. Select positive recombinants, use EcoRI and HindIII to carry out single and double enzyme digestion identification, and carry out sequence determination.

[0062] (2) Gene chip detection

[0063] The concentrations of the recombinant plasmids of the three extracted viruses, including BTV, FMDV, and BVDV, were measured with a micro-nucleic acid protein analyzer, and they were 124.08 ng / μL (1.5×10 11 copies / mL), 78.53ng / μL (1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a multiplex PCR (polymerase chain reaction) primer, a probe and a gene chip for detecting the bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus. The multiplex PCR primer and probe have the nucleotide sequences shown by SEQ ID No.1 to SEQ ID and No.9. The gene chip comprises a solid-phase carrier, a sample application quality control probe, a positive hybrid quality control probe and a multiplex PCR primer for detecting the bluetongue virus, foot and mouth disease virus and bovine viral diarrhea virus and the corresponding probe. In the invention, the forward primers of three viruses are marked with fluorescence, a gene chip detection technology carrying three viruses in animal fur is established based on multiplex RT-PCR (reverse transcription-polymerase chain reaction), and the RNA virus in the fur can be sensitively and specifically detected with high flux; the three viruses are screened at the same time in detection once, and the situation that a specific method is required for each virus before is changed, thereby saving the diagnosis time, meeting the needs for quick detection of mass imported / exported fur samples of the exit-entry inspection and quarantine departments and the fur import and export enterprises, and realizing relatively high application values.

Description

technical field [0001] The invention relates to multiple PCR primers, probes and gene chips for detecting bluetongue virus, foot-and-mouth disease virus and bovine viral diarrhea virus, and belongs to the technical field of animal virus detection. Background technique [0002] my country has become the largest fur importer in the world, and the imported fur comes from a wide range of sources. However, due to the different breeding conditions of fur animals and the prevalence of animal diseases in different countries, imported furs have problems such as various types of viruses and large differences in nature. At present, the RNA viruses carried in imported fur mainly include bluetongue virus (BTV), foot and mouth disease virus (Foot and mouth disease virus, FMDV) and bovine viral diarrhea virus (Bovine viral diarrhea virus, BVDV). These viruses are serious hazards, and the risk of transmission through fur is high. Therefore, rapid and high-throughput detection of BTV, FMDV,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/70C12Q1/6837C12Q1/686C12Q2537/143C12Q2565/501C12Q2531/113
Inventor 徐超张勤杨娜张子宏李珂苗丽
Owner 徐超
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com