Double-probe gene mutation detecting method based on allele special amplification as well as special chip and kit thereof

An allele-specific and allele-based technology, applied in the field of gene analysis, can solve problems such as high cost, inability to be widely used, and difficult operation

Active Publication Date: 2010-01-06
CENT SOUTH UNIV
View PDF1 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods are limited to the laboratory stage due to the difficulty of actual operation and high cost, and cannot be used for large-scale promotion.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-probe gene mutation detecting method based on allele special amplification as well as special chip and kit thereof
  • Double-probe gene mutation detecting method based on allele special amplification as well as special chip and kit thereof
  • Double-probe gene mutation detecting method based on allele special amplification as well as special chip and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] [Example 1] Preparation of a dual-probe gene mutation chip detection system based on allele-specific amplification.

[0079] The design and synthesis of probes and primers, chip preparation, etc. in this example are all skills mastered by those skilled in the art. For detailed operation steps, please refer to "Molecular Cloning Test Guide" (([US] J. Sambrook Author, Science Press)

[0080] 1. Preparation process

[0081] See attached Figure 11 .

[0082] 2. The main raw and auxiliary materials and equipment required for preparation

[0083] Table 6

[0084] Reagents and equipment

place of origin

Reagent purity / concentration

Blank Ultraflat

Shanghai Baiao Technology Co., Ltd.

/

Aminosilane reagent

Acros (United States)

99wt.%

glutaraldehyde

Acros (United States)

25wt.%

95% ethanol

Shanghai Chemical Plant

Analytical pure

Glacial acetic acid

Shanghai Chemical Plant

Analytica...

Embodiment 3

[0126] [Example 3] Comparison between the gene chip detection system of the present invention and the conventional SSOP gene chip detection system.

[0127] The method described in Example 1 is used to prepare a dual-probe gene chip detection system for detecting rs1057910 (CYP2C9*3), rs4986893 (CYP2C19*3) and rs1065852 (CYP2D6*10), and the probe arrangement array is

[0128] Rows

site

1-5 points

6-10 o'clock

11-15 o'clock

16-20 o'clock

1

rs1057910

SP-W

LP-W

SP-M

LP-M

2

rs3758581

SP-W

LP-W

SP-M

LP-M

3

rs17878459

SP-W

LP-W

SP-M

LP-M

[0129] According to the method disclosed in CN 101054601A invention patent (an oligonucleotide probe and a gene chip for detecting mutation sites of cytochrome P450 enzymes), it was prepared for detecting rs1057910 (CYP2C9*3), rs4986893 (CYP2C19 *3) and rs1065852 (CYP2D6*10) conventional SSOP gene chip detection system,...

Embodiment 4

[0133] [Example 4] The influence of the introduction of artificial mismatched bases at the 3' end of the allele-specific inner primer on the detection results of the gene chip.

[0134] Select SEQ ID NO: 19 and SEQ ID NO: 20 as alternative sequences of primers in the wild-type and mutant alleles of rs2231142 (BCRP 421C>A), and prepare the primers for detecting the mutation according to the method described in Example 1. Chip A and Chip B.

[0135] The primer sequence (Inner P-W_A) and mutant allele inner primer sequence (Inner P-M_A) of chip A are respectively:

[0136] Inner P-W_A: GACGGTGAGAGAAAACTTAC (no base mismatch)

[0137] Inner P-M_A: AAGAGCTGCTGAGAACT T (no mismatched bases)

[0138] The primer sequence (Inner P-W_B) and mutant allele inner primer sequence (Inner P-M_B) of chip B are respectively:

[0139] Inner P-W_B: GACGGTGAGAGAAAACT A C (The penultimate position introduces a mismatched base)

[0140] Inner P-M_B: AAGAGCTGCTGAGAA T T (The penultimate po...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for identifying gene mutation types in the field of gene analysis as well as a special chip and a kit thereof. The gene mutation detecting method comprises the following steps: taking a genome to be detected from a human tissue as a template, carrying out multiple allele special PCR amplification by a primer group that is designed aiming at special mutant sites and DNA polymerase without 3'-5' end exonclease activity, then hybridizing the obtained PCR product and an oligonucleotide probe (allele special probe) on the gene chip, and confirming mutation types of all gene sites according to the hybridizing result. The allele special probe is designed aiming at special gene types of gene mutant sites to be detected. The invention can detect gene mutations in comprehensive, systemic and high-flux ways and has light environmental pollution as well as simple and rapid operation compared with PCR-RFLP and a sequencing method.

Description

technical field [0001] The invention relates to a method for identifying gene mutation types in the field of gene analysis, as well as a dedicated chip and a kit. Background technique [0002] With the completion of the Human Genome Project and the advent of the post-genome era, more and more human disease-causing genes and drug-related genes have been identified and described. Gene mutations, as heritable variations of genes, can often lead to changes in gene functions Therefore, by detecting gene mutations with significant functional significance, the prevention, diagnosis and treatment of clinical diseases can be promoted, which has become one of the hotspots in life science research today, and large-scale and rapid gene mutation detection methods have also been favored by people. of great importance. [0003] At present, there are mainly the following methods for detecting gene mutations at home and abroad: [0004] Direct sequencing method: PCR amplification is perfor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor冀玮周宏灏
OwnerCENT SOUTH UNIV