Detection technology of molecular beacon strand displacement isothermal amplifying gene chip and kit
A molecular beacon and isothermal amplification technology, which is applied in the field of temperature amplification gene chip detection to achieve accurate and reliable results, improve efficiency, and realize real-time detection.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] In this example, the detection of hepatitis C virus RNA is taken as an example by taking an aldehyde-based glass slide as a solid support to illustrate the development and application of the present invention.
[0039] (1) Design and synthesis of probes
[0040] The probes involved in the experiment were synthesized by Shanghai Sangon Biotechnology Co., Ltd.
[0041] A molecular beacon was designed for the detection of hepatitis C virus RNA, the sequence is as follows:
[0042] MB:NH-T 20 - CATCATCATCATCAT TCTTGGACACA ACTAACGCCATGGCTAGACC TGTGTCCAAGA-FAM (SEQ ID NO: 1) (T 20 It is the 20 Ts connecting the molecular beacon and the solid support, the underline is the loop region sequence, the italic is the stem region sequence, and the bold is the 5' stem region extension);
[0043] Universal Quencher Probe: GTAGTAGTAGTA-TAMRA (SEQ ID NO: 2);
[0044] Universal primer: CTTTTCTATCTTTCTATCTTGGAC (SEQ ID NO: 3);
[0045] Among them, the molecular beacon struct...
Embodiment 2
[0059] In this embodiment, the development and application of the present invention are illustrated by taking the aldehyde-based glass slide as a solid support and the detection of HIV virus RNA as an example.
[0060] (1) Design and synthesis of probes
[0061] The probes involved in the experiment were synthesized by Shanghai Sangon Biotechnology Co., Ltd.
[0062] For the detection of HIV viral RNA, a molecular beacon was designed with the following sequence:
[0063] MB: NH-T 20 - CATCATCATCATCAT TCTTGGACACA GAACCAAGGGGAACTGAC TGTGTCCAAGA-FAM (SEQ ID NO:4) (T 20 It is the 20 Ts connecting the molecular beacon and the solid support, the underline is the loop region sequence, the italic is the stem region sequence, and the bold is the 5' stem region extension);
[0064] Universal Quencher Probe: GTAGTAGTAGTA-TAMRA (SEQ ID NO: 5);
[0065] Universal primer: TCATCAATCAATCTTTCTTGGAC (SEQ ID NO: 6);
[0066] Among them, the relationship between molecular beacon st...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com