Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection technology of molecular beacon strand displacement isothermal amplifying gene chip and kit

A molecular beacon and isothermal amplification technology, which is applied in the field of temperature amplification gene chip detection to achieve accurate and reliable results, improve efficiency, and realize real-time detection.

Active Publication Date: 2013-01-23
武汉中科志康生物科技有限公司
View PDF3 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In terms of sample preparation, most companies currently have to amplify the sample to a certain extent before labeling and measurement in order to improve the sensitivity of detection, but there are still many people trying to bypass this problem, including Mosaic Technologies' solid-phase PCR Amplification system and a large number of parallel solid-phase cloning methods proposed by Lynx Therapeutics, both methods have their own advantages and disadvantages, but have not yet been practically applied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection technology of molecular beacon strand displacement isothermal amplifying gene chip and kit
  • Detection technology of molecular beacon strand displacement isothermal amplifying gene chip and kit
  • Detection technology of molecular beacon strand displacement isothermal amplifying gene chip and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] In this example, the detection of hepatitis C virus RNA is taken as an example by taking an aldehyde-based glass slide as a solid support to illustrate the development and application of the present invention.

[0039] (1) Design and synthesis of probes

[0040] The probes involved in the experiment were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0041] A molecular beacon was designed for the detection of hepatitis C virus RNA, the sequence is as follows:

[0042] MB:NH-T 20 - CATCATCATCATCAT TCTTGGACACA ACTAACGCCATGGCTAGACC TGTGTCCAAGA-FAM (SEQ ID NO: 1) (T 20 It is the 20 Ts connecting the molecular beacon and the solid support, the underline is the loop region sequence, the italic is the stem region sequence, and the bold is the 5' stem region extension);

[0043] Universal Quencher Probe: GTAGTAGTAGTA-TAMRA (SEQ ID NO: 2);

[0044] Universal primer: CTTTTCTATCTTTCTATCTTGGAC (SEQ ID NO: 3);

[0045] Among them, the molecular beacon struct...

Embodiment 2

[0059] In this embodiment, the development and application of the present invention are illustrated by taking the aldehyde-based glass slide as a solid support and the detection of HIV virus RNA as an example.

[0060] (1) Design and synthesis of probes

[0061] The probes involved in the experiment were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0062] For the detection of HIV viral RNA, a molecular beacon was designed with the following sequence:

[0063] MB: NH-T 20 - CATCATCATCATCAT TCTTGGACACA GAACCAAGGGGAACTGAC TGTGTCCAAGA-FAM (SEQ ID NO:4) (T 20 It is the 20 Ts connecting the molecular beacon and the solid support, the underline is the loop region sequence, the italic is the stem region sequence, and the bold is the 5' stem region extension);

[0064] Universal Quencher Probe: GTAGTAGTAGTA-TAMRA (SEQ ID NO: 5);

[0065] Universal primer: TCATCAATCAATCTTTCTTGGAC (SEQ ID NO: 6);

[0066] Among them, the relationship between molecular beacon st...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection technology of molecular beacon strand displacement isothermal amplifying gene chip and a kit. The detection technology disclosed by the invention combines the advantages of strand displacement isothermal amplifying technology and molecular beacon technology. According to the detection technology, DNA (Deoxyribose Nucleic Acid) is amplified under the isothermal condition; fluorescence signals of the molecular beacon are continuously released along with the amplification of the DNA, and the released target DNA are combined to new molecular beacon, so that the amplification and releasing of the fluorescence signals are carried out in turn. According to the detection technology, the purpose of amplifying the signals is achieved based on the strand displacement reaction of DNA polymerase; and the purpose of detecting signals is achieved based on open loop and closed loop of the molecular beacon. With the adoption of the detection technology disclosed by the invention, the amplification of the DNA / RNA (Ribose Nucleic Acid) and the detection of signals are integrated, the processes such as additional marketing, hybridizing and washing are saved, so that, the operation steps are simplified, the efficiency is improved; and moreover, the chip can be detected on real time, and accurate and reliable results are obtained.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular beacon strand displacement isothermal amplification gene chip detection technology. Background technique [0002] Gene chips are also called DNA chips, DNA microarrays, and oligonucleotide arrays. This technology refers to immobilizing a large number of probe molecules on a support and then hybridizing with labeled sample molecules. The hybridization signal intensity of each probe molecule is used to obtain the number and sequence information of the sample molecules to achieve rapid, parallel, and efficient detection or medical diagnosis of biological samples. Since silicon chips are commonly used as solid supports and used in the preparation process The preparation technology of the computer chip, so it is called the gene chip technology. [0003] Because gene chip technology immobilizes a large number of probes on the support at the same time, it can detect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68G01N21/64
Inventor 龚桂香
Owner 武汉中科志康生物科技有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More