KASP marker closely linked with wheat stem rust resistance gene and application of KASP marker

Abstract

The invention discloses a KASP marker closely linked with a wheat stem rust resistance gene and application of the KASP marker, and belongs to the technical field of wheat molecular breeding. A new Puccinia graminis resistance site is identified, C / T nucleotide polymorphism exists at the site, the SNP marker related to wheat Puccinia graminis resistance is developed based on the Puccinia graminis resistance site, and heterozygous individuals and homozygous individuals can be distinguished by using the polymorphic SNP marker. The invention further develops and designs a Kasp716.51 marker closely linked with the Puccinia stelleriana resistance gene, simple operation of predicting phenotype through genotype is realized, individuals carrying the resistance gene can be efficiently screened by PCR amplification and fluorescence signal detection, the molecular breeding efficiency is greatly improved, and the application prospect is wide. And a new germplasm material is provided for cultivation of a new disease-resistant variety of wheat.

Description

Technical Field

[0001] The present invention relates to the technical field of wheat molecular breeding, and in particular to a KASP marker tightly linked to a wheat stem rust resistance gene and an application thereof. Background Art

[0002] Wheat rust is one of the major pests and diseases threatening wheat production safety, and is characterized by its explosive and epidemic nature. Based on the distribution of diseased areas, wheat rust is divided into three types: stem rust, leaf rust, and stripe rust. Stem rust poses the greatest threat to wheat due to its high mortality rate and strong infectivity. Wheat stem rust is caused by the wheat-specific form of the stem rust fungus, Puccinia graminis f.sp.tritici (Pgt), a highly specialized, long-range, airborne disease. After stem rust spores infect wheat, the rust spore mass breaks through the host epidermis, forming wounds on the wheat epidermis and destroying chloroplasts, causing the loss of water and nutrients in the wheat, seriously hindering its growth and development.

[0003] One approach to combating wheat stem rust is breeding for resistance. The discovery and screening of resistance genes is crucial for this purpose. Currently, over 80 stem rust-resistance genes have been reported, but only the stem rust-resistance genes have been tagged. This significantly limits the application of marker-assisted breeding and map-based cloning of resistance genes. Continuously identifying molecular markers that are closely linked or co-segregate with superior stem rust-resistance genes is crucial for improving the breeding process and selection efficiency. Summary of the Invention

[0004] In response to the above-mentioned prior art, the present invention aims to provide a KASP marker tightly linked to a wheat stem rust resistance gene and its application. The inventors' team discovered a new wheat stem rust resistance gene within the Chinese spring wheat reference genome version 2.1, 7B: 715.67Mb-718.05Mb, which exhibits immunity to stem rust. The present invention identified a stem rust resistance locus and obtained a single-nucleotide polymorphism (SNP) marker associated with wheat stem rust resistance. Furthermore, a KASP marker tightly linked to the wheat stem rust resistance gene was developed based on this SNP marker, enabling the simple prediction of phenotype from genotype. PCR amplification and fluorescence signal detection can be used to efficiently screen individuals carrying the resistance gene.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect of the present invention, a SNP marker associated with wheat stem rust resistance is provided. The nucleotide sequence of the SNP marker is shown in SEQ ID No. 1. The 21st base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site, and its base is T or C.

[0007] The nucleotide sequences of the SNP markers are as follows:

[0008] CAGCCCTAGATTAAGCACTGT / CAGGAAAGTTCTTTCTCTGTTATCTTACAGTTA CTATGCCAAATAGAAAATGCACTCTCATCCATCCTAGAGTTGACCTGAACAAGTCCTCAACTTTTTCCAAGAGGTTCTCCGATCTGCA. (SEQ ID No.1)

[0009] Note: The nucleotides in bold shade in the sequence are SNP sites, and the nucleotide polymorphism is T / C, which is represented by "y" in the sequence table.

[0010] The above-mentioned SNP marker is associated with wheat stem rust resistance, wherein wheat with CC genotype at the SNP site shows resistance to stem rust.

[0011] The second aspect of the present invention provides the use of the above-mentioned SNP marker in the following (1) or (2):

[0012] (1) Identification of wheat resistance to stem rust;

[0013] (2) Breed wheat varieties resistant to stem rust.

[0014] In a third aspect, the present invention provides a KASP marker tightly linked to a wheat stem rust resistance gene, designated as Kasp716.51 marker; comprising primers shown in SEQ ID No. 2, SEQ ID No. 3, and SEQ ID No. 4; specifically, as follows:

[0015] Kasp716.51-F1 (FAM signal sequence added):

[0016] 5'-GAAGGTGACCAAGTTCATGCTCAGCCCTAGATTAAGCACTGC-3'; (SEQ IDNo. 2)

[0017] Kasp716.51-F2 (add HEX signal sequence):

[0018] 5'-GAAGGTCGGAGTCAACGGATTCAGCCCTAGATTAAGCACTGT-3'; (SEQ ID No. 3)

[0019] Kasp716.51-CR:

[0020] 5'-TGCAGATCGGAGAACCTCTTG-3'. (SEQ ID No.4)

[0021] Among the above primers, Kasp716.51-F1 and Kasp716.51-F2 are upstream typing primers, and Kasp716.51-CR is a downstream universal primer.

[0022] The fourth aspect of the present invention provides the use of the above-mentioned KASP marker in the following (1) or (2):

[0023] (1) Identification of wheat resistance to stem rust;

[0024] (2) Breed wheat varieties resistant to stem rust.

[0025] A fifth aspect of the present invention provides a method for identifying or assisting in identifying wheat resistance to stem rust, comprising the following steps:

[0026] Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using the KASP marker, and the fluorescent signal of the amplified product is detected; if the FAM fluorescent signal indicates that the wheat to be tested contains the resistance gene, the phenotype is stem rust resistant; if the HEX fluorescent signal indicates that the wheat to be tested does not contain the resistance gene, the phenotype is stem rust susceptible.

[0027] Furthermore, the PCR reaction system was as follows: 1 μL of DNA template, 5 μL of 2×Taq Master Mix, 0.15 μL each of the primers shown in SEQ ID No. 2 and SEQ ID No. 3, 0.4 μL of the primer shown in SEQ ID No. 4, and double-distilled water was added to 10 μL.

[0028] The PCR reaction conditions were as follows: 95°C for 10 min; 95°C for 20 s, 65-57°C for 1 min, with a decrease of 0.8°C per cycle, for 10 cycles; and 95°C for 20 s, 57°C for 1 min, for 30 cycles.

[0029] Beneficial effects of the present invention:

[0030] (1) The present invention identifies a new stem rust resistance locus, at which a C / T nucleotide polymorphism exists. Based on this stem rust resistance locus, the present invention develops a single-nucleotide polymorphism (SNP) marker associated with wheat stem rust resistance. Using polymorphic SNP markers, heterozygous and homozygous individuals can be distinguished. This is particularly important for variety improvement, especially in ensuring the accurate transmission of superior genes in selective breeding.

[0031] (2) The present invention also developed and designed a Kasp716.51 marker that is tightly linked to the stem rust resistance gene, which enables the simple operation of predicting phenotype by genotype. Individuals carrying the resistance gene can be efficiently screened by PCR amplification and fluorescence signal detection, greatly improving the efficiency of molecular breeding and providing new germplasm materials for the cultivation of new disease-resistant wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 : Genotype detection results of KASP marker Kasp716.51 in wheat RIL population; the X-axis coordinate is FAM signal, blue represents CC homozygous genotype; the Y-axis coordinate represents HEX signal, red represents TT homozygous genotype; the green dot in the middle represents C:T heterozygous genotype; the black dot is the non-template control NTC.

[0033] Figure 2 : Results of identification of wheat RIL population and the stem rust resistance phenotype of wheat sdauP29, Chinese Spring and Fielder; 1-26: different lines of RIL population, 27 is the parent sdauP29, 28 and 29 are Chinese Spring and Fielder respectively; genotype CC: 6, 10, 17, 19, 22, 27; genotype TT: 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 16, 18, 20, 21, 23, 24, 25, 26, 28, 29. DETAILED DESCRIPTION

[0034] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0035] As mentioned above, the discovery and screening of resistance genes is extremely important for disease-resistant breeding. Currently, the number of stem rust resistance genes reported is small, and most genes have not been cloned or molecularly marked, which seriously hinders the application of disease-resistant genes in the prevention and control of wheat stem rust.

[0036] In previous studies, the inventors used wheat sdauP29 and Chinese spring wheat to construct an RIL population, and through map-based cloning technology, located the interval of a new wheat stem rust resistance gene in the wheat Chinese spring reference genome 2.1 version 7B: 715.67Mb-718.05Mb, but the resistance gene has not yet been cloned.

[0037] In order to better apply the novel wheat stem rust resistance gene, the present invention identified a new stem rust resistance site and developed and designed a SNP marker based on the site. The nucleotide sequence of the SNP marker is shown in SEQ ID No. 1. The sequence shown in SEQ ID No. 1 has a C / T polymorphism at the 21st base from the 5' end, wherein the CC genotype corresponds to wheat stem rust resistance.

[0038] Furthermore, the present invention has also developed and designed a Kasp716.51 marker that is tightly linked to the stem rust resistance gene, which can detect the genotype of wheat materials at the stem rust resistance site. By detecting the genotype of this site, the stem rust resistance phenotype can be predicted, thereby efficiently screening individuals carrying the new wheat stem rust resistance gene, accelerating the breeding process, and thus proposing the present invention.

[0039] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below with reference to specific embodiments.

[0040] The test materials used in the examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Experimental methods without detailed conditions were carried out in accordance with conventional test methods or the operating instructions recommended by the supplier.

[0041] Wheat sdauP29 is derived from the 7Ei (7D) material in the reference (J. Guo et al., Molecular and cytological comparisons of chromosomes 7el1, 7el2, 7Ee, and 7Ei derived from Thinopyrum. Cytogenet. Genome Res. 145, 68–74 (2015). doi: 10.1159 / 000381838; pmid: 25968454), and is referred to as sdauP29 in this patent.

[0042] The wheat stem rust fungus sprayed for stem rust resistance phenotype identification was 21C3CTTTM, which is recorded in the literature "Sun, H., Wang, Z., Wang, R., Chen, S., Ni, X., Gao, F., Zhang, Y., Xu, Y., Wu, X., & Li, T. (2023). Identification of wheat stem rust resistance genes in wheat cultivars from Hebei Province, China. Frontiers in Plant Science, 14. https: / / doi.org / 10.3389 / fpls.2023.1156936 "middle.

[0043] Example 1: Development of KASP markers tightly linked to wheat stem rust resistance genes

[0044] Previous studies found that wheat sdauP29 showed an immune phenotype to the physiological race of stem rust and exhibited good resistance. By constructing an RIL population and using map-based cloning technology, a new wheat stem rust resistance gene was located within the range of 715.67Mb-718.05Mb in the wheat Chinese Spring reference genome 2.1 version 7B.

[0045] To better utilize this disease-resistance gene, the present invention resequenced the stem rust-resistant wheat sdauP29 and compared the sequencing results with the wheat Chinese Spring reference genome. This identified a new stem rust-resistance locus. A SNP marker was designed based on this stem rust-resistance locus, the nucleotide sequence of which is shown in SEQ ID No. 1. The 21st base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site. The base at the corresponding position in the Chinese Spring reference sequence is T, while the base at the corresponding position in wheat sdauP29 is C.

[0046] Based on the above SNP markers, the present invention further developed and designed a KASP marker that is tightly linked to the wheat stem rust resistance gene and named it Kasp716.51 marker; specifically:

[0047] Kasp716.51-F1 (FAM signal sequence added):

[0048] 5'-GAAGGTGACCAAGTTCATGCTCAGCCCTAGATTAAGCACTGC-3'; (SEQ IDNo. 2)

[0049] Kasp716.51-F2 (add HEX signal sequence):

[0050] 5'-GAAGGTCGGAGTCAACGGATTCAGCCCTAGATTAAGCACTGT-3'; (SEQ ID No. 3)

[0051] Kasp716.51-CR:

[0052] 5'-TGCAGATCGGAGAACCTCTTG-3'. (SEQ ID No.4)

[0053] Example 2: Genotypic and phenotypic characterization of stem rust resistance in RIL populations

[0054] 1. Construction of RIL group:

[0055] In September 2020, at the National Key Laboratory of Wheat Breeding of Shandong Agricultural University, an artificial climate chamber was used to conduct additional generations. The wheat sdauP29 carrying the resistance gene was used as the male parent, and the wheat variety Chinese Spring susceptible to stem rust was used as the female parent for hybridization. The single-grain transmission method was used to increase generations to the F7 generation, and an RIL population was constructed.

[0056] 2. Genotype detection:

[0057] The genotype of wheat materials in the RIL population was detected using the Kasp716.51 marker of Example 1. The specific steps are as follows:

[0058] (1) Extract genomic DNA from samples using the CTAB method;

[0059] Wheat leaves of 2.0-3.0 cm in diameter were cut and placed in a 2 mL centrifuge tube containing two small steel balls. The leaves were frozen in liquid nitrogen and then rapidly ground into a powder using a plant cell disruptor set to 41 Hz for 40 seconds. 800 μL of CTAB extraction buffer (preheated to 65°C in a water bath) was added and the tubes were incubated at 65°C for 30 minutes. Then, an equal volume of a three-mix solution (phenol:chloroform:isoamyl alcohol = 25:24:1, volume ratio) was added, mixed, and allowed to stand for 3 minutes. The tubes were centrifuged at 12,000 rpm for 10 minutes, and 700 μL of the supernatant was aspirated. 700 μL of isopropanol and 70 μL of sodium acetate were added, mixed, and allowed to stand for 15 minutes. The tubes were then centrifuged at 12,000 rpm for 10 minutes, and the supernatant was discarded. The white precipitate was DNA. After washing twice with 600 μL of 70% ethanol, the DNA precipitate was dissolved in ddH2O and stored at low temperatures.

[0060] (2) PCR amplification;

[0061] The PCR reaction system was as follows: 1 μL DNA template, 5 μL 2× Taq Master Mix, 0.15 μL each of primers Kasp716.51-F1 and Kasp716.51-F2 at a concentration of 10 μmol / L, 0.4 μL of universal reverse primer Kasp716.51-CR at a concentration of 10 μmol / L, and double-distilled water to 10 μL.

[0062] The PCR reaction conditions were as follows: 95°C for 10 min; 95°C for 20 s, 65-57°C for 1 min, with a decrease of 0.8°C per cycle, for 10 cycles; and 95°C for 20 s, 57°C for 1 min, for 30 cycles.

[0063] (3) Analysis of KASP labeling results.

[0064] After centrifugation of the PCR products, fluorescence data were collected using a FLUOstar Omega microplate reader, and Klustercaller software was used for data analysis, genotyping, and visualization.

[0065] If the FAM signal is detected (close to the X-axis, blue), the genotype of the wheat material is CC homozygous, indicating that the wheat to be tested contains the resistance gene and is resistant to stem rust; if the HEX signal is detected (close to the Y-axis, red), the genotype of the wheat material is TT homozygous, indicating that the wheat to be tested does not contain the resistance gene and is susceptible to stem rust; if both FAM and HEX signals are detected (green), the genotype of the wheat material is C:T heterozygous.

[0066] The genotype detection results of some samples in the RIL population are as follows Figure 1 shown.

[0067] 3. Phenotypic identification:

[0068] RIL population samples identified as CC homozygous and TT homozygous genotypes, as well as wheat sdauP29, Chinese Spring and Fielder, were selected and their stem rust resistance phenotypes were identified by spraying spores of wheat stem rust fungus.

[0069] The phenotypic identification results were Figure 2 and as shown in Table 1.

[0070] Table 1: Phenotypic identification results of wheat stem rust resistance of different genotypes

[0071]

[0072]

[0073] The results showed that the genotype detection results of the Kasp716.51 marker were completely consistent with the identification results of the stem rust resistance phenotype, proving that the Kasp716.51 marker was closely linked to a novel disease resistance gene located in the wheat Chinese Spring reference genome 2.1 version 7B: 715.67Mb-718.05Mb.

[0074] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. A SNP marker associated with wheat stem rust resistance, characterized in that: The nucleotide sequence of the SNP marker is shown in SEQ ID No.

1. The 21st base from the 5' end of the sequence shown in SEQ ID No. 1 is a polymorphic site, and the base is T or C.

2. The SNP marker according to claim 1, wherein Wheat with CC genotype at the SNP site showed resistance to stem rust.

3. Use of the SNP marker according to claim 1 in the following (1) or (2): (1) Identification of wheat resistance to stem rust; (2) Breed wheat varieties resistant to stem rust.

4. A KASP marker tightly linked to a wheat stem rust resistance gene, characterized in that: include: Primers shown as SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No.

4.

5. Use of the KASP marker according to claim 4 in the following (1) or (2): (1) Identification of wheat resistance to stem rust; (2) Breed wheat varieties resistant to stem rust.

6. A method for identifying or assisting in identifying wheat resistance to stem rust, characterized in that: The following steps are involved: The genomic DNA of the wheat to be tested is used as a template, PCR amplification is performed using the KASP marker described in claim 4, and the fluorescence signal of the amplified product is detected; if the FAM fluorescence signal represents that the wheat to be tested contains a resistance gene, the phenotype is stem rust resistant; if the HEX fluorescence signal represents that the wheat to be tested does not contain a resistance gene, the phenotype is stem rust susceptible.

7. The method according to claim 6, characterized in that The PCR reaction system was as follows: 1 μL DNA template, 5 μL 2× TaqMaster Mix, 0.15 μL each of the primers shown in SEQ ID No. 2 and SEQ ID No. 3, 0.4 μL of the primer shown in SEQ ID No. 4, and double-distilled water to 10 μL.

8. The method according to claim 6, characterized in that The PCR reaction conditions were as follows: 95°C for 10 min; 95°C for 20 s, 65-57°C for 1 min, with a decrease of 0.8°C per cycle, for 10 cycles; and 95°C for 20 s, 57°C for 1 min, for 30 cycles.

Images