Novel gene editing carrier system and application thereof in cultivation of beany flavor-free soybeans

Abstract

The invention discloses a novel gene editing carrier system and application thereof in cultivation of beany-flavor-free soybeans, and belongs to the technical field of gene engineering. According to the invention, by constructing a single transcript pUBQ3: Bar-P2A-DsRED2, the efficient knockout of five key genes, namely GmLOX1, GmLOX2, GmLOX3, GmFAD2-1A and GmFAD2-1B, in the soybean is successfully realized, the single transcript pUBQ3: Bar-P2A-DsRED2 adopts a soybean endogenous strong promoter pGmUBQ3 which is connected in series with a resistance gene Bar and a fluorescent gene expression cassette DsRED2, and the Bar is separated from the DsRED2 through P2A. The method can significantly reduce the beany flavor of soybeans, and has good application prospects in soybean quality improvement and breeding.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a novel gene editing vector system and its application in cultivating soybeans without beany odor. Background Art

[0002] Soybeans, originating in China, are an important grain, oil, and cash crop in the country. Mature soybeans have a distinctive beany odor, a major factor limiting the market for soy products. This beany odor is primarily caused by the oxidation of polyunsaturated fatty acids such as linoleic acid and linolenic acid, catalyzed by lipoxygenases (LOXs). The resulting conjugated unsaturated fatty acid hydroperoxides are converted into volatile compounds such as hexanal, hexanol, and pentanol. Conventional breeding typically involves crossing LOX1, LOX2, and LOX3 triple-deficient mutants with elite varieties. Several generations of backcrossing or selfing are then required to develop soybean varieties free of this beany odor, a labor-intensive and time-consuming process. Furthermore, conventional breeding methods cannot completely eliminate the beany odor, and triple-deficient mutants still retain a certain beany odor.

[0003] Mature soybean seeds primarily contain three lipoxygenase isoenzymes: LOX1, LOX2, and LOX3. These isoenzymes are involved in the synthesis of beany odor. These isoenzymes are encoded by the GmLOX1, GmLOX2, and GmLOX3 genes, respectively. Fatty acid desaturase (FAD) is a key regulatory enzyme in the fatty acid synthesis pathway that catalyzes the conversion of oleic acid to linoleic acid. Analysis of the soybean genome revealed the presence of two key genes encoding fatty acid desaturases, GmFAD2-1A and GmFAD2-1B, which are key genes regulating the conversion of oleic acid to linoleic acid.

[0004] However, in the field of soybean genetic transformation and gene editing breeding, two major challenges currently exist that seriously hinder research progress and practical applications. First, the high chimera rate in soybean genetic transformation is a particularly prominent problem. During genetic transformation of soybeans, the multicellular nature of the explant makes the transformation process complex and difficult to control. Common methods such as Agrobacterium-mediated transformation or gene gun transformation have difficulty achieving uniform and precise transformation of every cell when acting on soybean explants. Often, only a portion of cells can successfully accept and integrate foreign genes, and these transformed cells participate in the subsequent plant regeneration process together with untransformed cells, ultimately resulting in the obtained transgenic plants exhibiting a chimeric state. Taking the application of CRISPR-Cas9 gene editing technology in soybeans as an example, according to a large amount of experimental data, more than 60% of the regenerated plants are chimeras. This high chimera rate makes the subsequent screening of transgenic soybean plants with stable and consistent target traits like finding a needle in a haystack. Due to the differences in the genetic composition of cells in different parts of the chimera plants, they also show inconsistency in phenotype, which makes the evaluation of their target traits extremely difficult. It consumes a lot of manpower, material resources and time costs, but it is still difficult to obtain ideal experimental results, which greatly slows down the progress of soybean genetic transformation related research.

[0005] Secondly, the time-consuming and labor-intensive isolation of transgenic elements in offspring plants remains a key pain point that needs to be addressed in gene-editing breeding. In soybean gene-editing breeding, precise gene editing often requires the use of vectors carrying multiple transgenic elements, such as the Cas9 nuclease gene, guide RNA expression elements, and selectable marker genes. Once successfully introduced into the soybean genome, these vectors often integrate randomly into diverse locations. In gene-edited offspring, the linkage between the transgenic element and the target edited gene is complex and variable due to genetic recombination during meiosis. To obtain homozygous plants that are free of transgenic elements and stably inherit the edited target gene, researchers must track and screen a large number of offspring plants over multiple generations. Each generation requires tedious molecular biological assays, such as PCR amplification and Southern blotting, to identify transgenic element carriers. Phenotypic observations are also needed to confirm the stability of the target gene editing. Typically, obtaining a homozygous soybean line with stable traits and no transgenic elements requires not only a significant investment in planting and testing, but also extensive experimental land and equipment resources, severely limiting the advancement of soybean gene-editing breeding technology from the laboratory to practical production applications. Therefore, there is an urgent need to develop new methods that can accurately screen for chimeric plants in genetically transformed soybeans and improve the efficiency of transgenic element isolation in the offspring of gene-edited plants. Summary of the Invention

[0006] This invention focuses on the modification and optimization of soybean CRISPR-Cas9 gene-editing vectors, aiming to address the challenges of identifying and screening chimeric plants during soybean genetic transformation, as well as the inefficient separation of transgenic elements in gene-edited offspring. By ingeniously integrating a fluorescent protein tag, the invention enables precise identification and efficient screening of chimeric plants during soybean genetic transformation.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions: An optimized gene editing vector pGES403 integrates a new resistance gene and a fluorescent sticky note expression module, and its expression structure is pUBQ3::Bar-P2A-DsRED2. The pUBQ3::Bar-P2A-DsRED2 uses the soybean endogenous strong promoter pGmUBQ3 on the pGES401 vector to tandemly connect the resistance gene Bar and the fluorescent gene expression cassette DsRED2, wherein Bar and DsRED2 are separated by P2A. The nucleotide sequence of the promoter pGmUBQ3 is shown in SEQ ID No. 1, the nucleotide sequence of the resistance gene Bar is shown in SEQ ID No. 2, the nucleotide sequence of P2A is shown in SEQ ID No. 3, and the nucleotide sequence of DsRED2 is shown in SEQ ID No. 4.

[0008] A sgRNA combination for constructing odorless soybeans includes one sgRNA that simultaneously targets GmFAD2-1A and GmFAD2-1B, whose nucleotide sequence is TGGGTGATTGCTCACGAGTG; one sgRNA that simultaneously targets GmLOX1 and GmLOX2, whose sequence is TGGAAAAGGAAAAGTTGGAA; and one sgRNA that targets GmLOX3, whose sequence is AATCATGCCCGTCCTGTTCT.

[0009] A CRISPR-Cas9-mediated multi-sgRNAs tandem vector, specifically, the above-mentioned sgRNA combination is tandemly connected to the above-mentioned gene editing vector pGES403.

[0010] The present invention also provides the use of the above-mentioned gene editing vector pGES403, sgRNA combination, and multi-sgRNAs tandem vector in cultivating soybeans without beany odor.

[0011] A method for preparing soybeans without beany odor using CRISPR-Cas9 technology, comprising: transforming the above-mentioned multi-sgRNAs concatenated vector into Agrobacterium, and infecting soybeans with Agrobacterium to obtain soybeans with knockout of the GmFAD2-1A (numbered Glyma.10G278000), GmFAD2-1B (numbered Glyma.20G111000), GmLoX1 (numbered Glyma.13G347600), GmLOX2 (numbered Glyma.13G347500), and GmLOX3 (numbered Glyma.15G026300) genes.

[0012] The beneficial effects of the present invention are: (1) Structural characteristics of single transcripts: The present invention carefully designed and systematically tested the expression structures of various fluorescent protein tags. After repeated experiments and verification, a unique single transcript structure was finally found to have significant advantages. This structure uses the soybean endogenous strong promoter pGmUBQ3 to express the resistance tag bar and the fluorescent gene expression frame DsRED2 in series, where bar and DsRED2 are separated by P2A. The use of the soybean endogenous strong promoter provides a strong driving force for the expression of the resistance tag and the fluorescent tag, significantly increasing the expression levels of both. This makes the signals of the relevant tags more obvious and easy to detect in soybean transformed plants. In addition, the resistance tag and the fluorescent tag achieve efficient coordinated expression. The resistance tag provides a basic selection basis for screening, while the fluorescent tag uses intuitive fluorescence intensity as the judgment standard. The two work together to greatly improve the accuracy of screening chimeras by fluorescence intensity. Finally, the design of the single transcript structure further reduces the size of the gene editing vector while ensuring functional integrity. Smaller vectors are easier to introduce into soybean cells, thereby effectively improving the efficiency of genetic transformation.

[0013] (2) Based on this new gene editing vector pGES403, the present invention successfully achieved efficient knockout of five key genes in soybeans: GmLOX1, GmLOX2, GmLOX3, GmFAD2-1A, and GmFAD2-1B. These genes are closely related to the formation of the beany smell of soybeans. By precisely knocking out these genes, the pathway for the production of beany smell is effectively blocked. At the same time, the new vector also achieves efficient separation of transgenic elements, avoiding the tedious separation process in traditional methods and saving a lot of time and resources. Ultimately, a new super beany-free soybean germplasm resource was successfully created, providing strong technical support for soybean quality improvement and industrial development. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Schematic diagram of the STU multi-gene editing vector structure that integrates different fluorescent expression elements.

[0015] Figure 2 This is a diagram of the pGES403 vector structure.

[0016] Figure 3 (a) The red fluorescence expression effects of pGES401 and pGES401-R1~R7 in the soybean in vitro hairy root transformation system; (b) the fluorescence expression of pGES401-R5 in soybean T0 generation stably transformed plants; (c) the fluorescence expression of pGES401-R5 in the pods of soybean T0 generation stably transformed plants; (d) the fluorescence expression of pGES401-R5 in the seeds of soybean T0 generation stably transformed plants.

[0017] Figure 4 This is a sequence comparison diagram of gene editing.

[0018] Figure 5 This is the structure of a multi-sgRNA tandem vector.

[0019] Figure 6 This is a diagram for detecting the content of beany odor substances. DETAILED DESCRIPTION

[0020] In order to better understand the technical solution of the present invention, the following is further described in detail with reference to specific embodiments and drawings, but this does not limit the scope of protection of the present invention.

[0021] Unless otherwise specified, the methods used in the present invention are all conventional technical means.

[0022] Example 1 Screening and testing of fluorescent protein tag expression structures of gene editing vectors in soybeans Due to the low efficiency of stable genetic transformation in soybean and the high proportion of transgenic mosaics, the screening efficiency of stable transgenic plants is low. To improve the efficiency of screening for homozygous mutant plants after gene editing, the present invention integrates three different red fluorescent gene expression cassettes: tdTomato, DsRed2, and DsRed1-E (DsRed1-express), into the pGES401 vector. These cassettes are driven by the strong endogenous soybean promoter, pGmUBQ3 (pUBQ3). These cassettes are designated pGES401-R1, pGES401-R2, and pGES401-R3, respectively. To reduce the size of the gene editing vector, facilitate vector construction, and improve genetic transformation efficiency, a single-transcript vector construct was constructed in which the resistance gene and the fluorescent screening gene are expressed from a single promoter. The resistance gene Bar and the fluorescent screening gene are fused via P2A to enhance the expression intensity of this single transcript. Among them, pGES401-R4, pGES401-R5, and pGES401-R7 express the Bar gene in fusion with tdTomato, DsRed2, and DsRed1-E, respectively. To further test the fusion expression structure of resistance genes / fluorescence screening genes based on single transcripts, a CP4-EPSPS and DsRed2 fusion expression structure was constructed and named pGES401-R6. It uses the soybean endogenous strong expression promoter pGmUBQ3 to drive the expression of Cas9 and sgRNA simultaneously. The structural diagram of the specific gene editing vector is shown in the figure. Figure 1 The nucleotide sequence of the pGmUBQ3 is shown in SEQ ID No. 1, the nucleotide sequence of the Bar resistance gene is shown in SEQ ID No. 2, the nucleotide sequence of P2A is shown in SEQ ID No. 3, the nucleotide sequence of DsRED2 is shown in SEQ ID No. 4, the nucleotide sequence of tdTomato is shown in SEQ ID No. 5, and the nucleotide sequence of DsRed1-E is shown in SEQ ID No. 6.

[0023] This study further validated the red fluorescence expression of different fluorescent screening gene expression constructs in a soybean in vitro hairy root transformation system. Red fluorescence was observed in all seven different constructs, with the fluorescence intensity ranking in the order of dTomato, DsRed2, and DsRed1-E under the same expression construct. Furthermore, it was observed that the expression intensity of the dual-transcript construct was higher than that of the single-transcript construct, with clear fluorescence observed in all dual-transcript constructs. In the single-transcript construct, expression of the DsRed1-E fluorescent protein was weak (pGES401-R7), while clear fluorescence was observed for both DsRed2 and tdTomato (pGES401-R4 and pGES401-R5). Since the single transcript structure can reduce the vector size while allowing the coordinated expression of resistance genes and fluorescent screening genes, and since the gene length of DsRed2 is shorter than that of tdTomato, and clear red fluorescence can be observed under the single transcript structure, the pGES401-R5 vector (named pGES403) was selected for stable transformation of soybean to observe the expression of red fluorescent protein in positive plants. Figure 2 Clear red fluorescence was observed in T0-generation stably transgenic plants derived from pGES401-R5 (pGES403), as well as in pods and seeds. Therefore, fusion expression of the Bar resistance gene with the DsRed2 fluorescent screening gene via P2A based on a single transcript structure can greatly improve the efficiency of screening for transgenic-positive plants and facilitate the isolation of transgenic elements.

[0024] Example 2 Design and Screening of sgRNAs for Creating Super Non-Beany Smell Soybean Mutants First, five genes closely associated with beany odor were identified through screening using the NCBI online database and bioinformatics analysis: GmLOX1 (Glyma.13G347600), GmLOX2 (Glyma.13G347500), GmLOX3 (Glyma.15G026300), GmFAD2-1A (Glyma.10G278000), and GmFAD2-1B (Glyma.20G111000). Based on this information and following the principles of sgRNA design, 75 sgRNAs were designed for each of the five target genes. The sgRNA sequences are shown in Table 1.

[0025] Table 1 List of targeted sgRNAs designed

[0026]

[0027]

[0028] Note: GmLOX1&2 targets both GmLOX1 and GmLOX2 genes; FAD2A2B targets both GmFAD2-1A and GmFAD2-1B genes.

[0029] Example 3 CRISPR-Cas9 multi-sgRNA tandem vector construction strategy Vector construction was performed using a highly efficient CRISPR-Cas9-mediated multi-sgRNA tandem vector from soybean. A strong endogenous soybean promoter, pUBQ3, drives expression of Cas9 and multiple sgRNA expression cassettes. The multi-sgRNA tandem vector construction strategy involved tandemly assembling three sgRNAs, one targeting each of GmLOX1, GmLOX2, GmLOX3, GmFAD2-1A, and GmFAD2-1B, for a total of 75 vectors.

[0030] Construction of multiple sgRNA tandem vectors (1) Design of sgRNA amplification primers: Multiple sgRNAs can be connected in series by using a tRNA-spaced structure of multiple sgRNAs + sgRNA Scaffold. The vector structure is shown in the figure below. Figure 5 shown.

[0031] 75 sgRNAs were connected to pGES403 as an empty vector to construct pGES-403-1~pGES-403-75 vectors, thereby screening the target GmLOX1 、 GmLOX2, GmLOX3, GmFAD2-1A and GmFAD2-1B The steps for constructing a highly efficient sgRNA vector are as follows: The following primers were designed for PCR amplification using pGES-403 as a template: Xx-crF1:5'- gagaagtggagaggagtgaactc- 3'; Xx-crR1:5'-TGTTGTGTGGAATTGTGAGCG -3'; Prepare the PCR amplification system as follows:

[0032] Repeat the mixing of the prepared reaction buffer, centrifuge briefly, place on the PCR instrument, and run the following program:

[0033] The DNA fragments were purified according to the instructions of the DNA purification kit and the vector was constructed using the Golden Gate one-step method.

[0034] Golden Gate reaction system (10 μL):

[0035] Mix the above system and run the following PCR program:

[0036] After the above ligation product is transformed into E. coli, colony or bacterial liquid PCR identification is performed using the designed primers.

[0037] Infection After dry surface sterilization, twelve sterilized seeds were placed hilum-side down in a 120×25 mm Petri dish containing 1 / 2 MS medium and incubated at 28°C in the light for 5-7 days. During the infection process, germinated seeds were excised from the root system with a scalpel, making an incision in the hypocotyl region approximately 0.5 cm from the cytoplasmic node. The seeds were split vertically along the hypocotyl of the cotyledon, and the epicotyl (young shoot) and stem / bud on the axis were removed. Using a scalpel, seven to eight incisions were made near the cotyledonary node. The explants were placed in a Petri dish covered with a double layer of filter paper moistened with sterile water. The explants were incubated at 25°C in the light for 4-5 days, then transferred to root induction medium containing the antibacterial agent carbenicillin and the selective herbicide glufosinate-ammonium and incubated in the dark at 25°C for 7-13 days. After the beans had grown for 2-3 weeks, DNA was extracted from soybean hairy roots for further verification.

[0038] The DNA of positive hair roots was extracted by CTAB method, and the gene editing efficiency of each target was determined by first-generation sequencing (Table 2). The three sgRNAs with the highest gene editing efficiency were screened out, namely, GmFAD2-1A and GmFAD2-1B sgFAD2A2B-17:TGGGTGATTGCTCACGAGTG, while targeting GmLOX1 and GmLOX2 sgLOX1&2-1:TGGAAAAGGAAAAGTTGGAA, targeting GmLOX3 sgLOX3-23: AATCATGCCCGTCCTGTTCT.

[0039] Table 2 Gene editing efficiency of each target

[0040]

[0041]

[0042] Example 4 Stable genetic transformation of soybean using high-efficiency vectors and screening of homozygous mutants Use simultaneous targeting GmFAD2-1A and GmFAD2-1B FAD2A2B-17:TGGGTGATTGCTCACGAGTG, while targeting GmLOX1 and GmLOX2 GmLOX1&2-1:TGGAAAAGGAAAAGTTGGAA, targeting GmLOX3 The GmLOX3-23 of Example 3 was AATCATGCCCGTCCTGTTCT, and three sgRNAs were combined with the pUBQ3-Bar-DsRED2 structure to form pGES403-R. The transformation process in Example 3 was repeated to finally obtain the pGES403-R plasmid and Agrobacterium vector.

[0043] (1) Agrobacterium-mediated stable transformation of soybean plants: Agrobacterium tumefaciens K599 with high editing efficiency and inserted gene editing vector was selected for stable transformation of soybean.

[0044] (2) Soybean plant transformation: The transformed Agrobacterium is used to infect soybean plants. Appropriate transformation methods such as the cotyledonary node infection method can be used. Select soybean seedlings in good growth condition and process them according to the corresponding infection operation procedures, such as making wounds at the cotyledonary nodes and inoculating the Agrobacterium liquid containing the vector to promote Agrobacterium transformation of soybean cells.

[0045] (3) Screening for transformed plants: The infected soybean plants are cultured on a medium containing a selection agent (Bar resistance gene). This step utilizes the special structural element Bar resistance gene to quickly screen for transformed plants that can grow under the selection pressure. Regularly observe the growth of the plants and remove plants that have not been successfully transformed.

[0046] (4) Obtaining T0 generation plants: Cultivate the transformed plants obtained by screening, grow them to maturity, and harvest T0 generation seeds.

[0047] (5) Screening of T1 generation plants: Sow T0 generation seeds to obtain T1 generation plants. Perform molecular tests on T1 generation plants, such as PCR detection and sequencing, and screen out heterozygous mutant plants. Use SnapGene software to identify whether gene editing occurs at the set sgRNA position, and the type of gene editing is as follows: Figure 4 As shown, GmFAD2-1B Glyma.20G111000: homozygous insertion of 1 bp base, GmFAD2-1AGlyma.10G278000: homozygous deletion of 279 bp base, GmLOX1Glyma.13G347600: homozygous deletion of 4 bp base, GmLOX2 Glyma.13G347500: homozygous deletion of 2 bp base, GmLOX3 Glyma.15G026300: homozygous insertion of 1 bp base.

[0048] Screening for homozygous mutants: Plants with fully targeted gene editing (i.e., simultaneous deletion of all five soybean genes, GmFAD2-1A, GmFAD2-1B, GmLox1, GmLox2, and GmLox3) are screened. After pods mature, T1 seeds are harvested. The T1 seeds are then replanted and the above process repeated to harvest T2 seeds. T2 seeds are sown and molecular testing is performed again to screen for homozygous mutants. Through multiple generations of replanting and testing, mutants are continuously purified to ensure stable, inherited homozygous mutants, which are the super-beany-free soybeans created using this technology.

[0049] Example 5: Testing the content of beany odor substances in new germplasm using headspace solid phase microextraction-gas chromatography-mass spectrometry (1) Sample preparation: Ordinary soybeans, conventional soybeans without beany smell (refer to patent CN110684796B), and the new super soybean germplasm created using this technology were selected as samples. The samples were crushed for subsequent testing.

[0050] (2) Headspace solid-phase microextraction: Accurately weigh a certain amount of the treated sample and place it in a headspace vial. Seal the vial. Insert the extraction head of the solid-phase microextraction device into the headspace vial and equilibrate at a certain temperature for a period of time to allow the beany odor substances to evaporate from the sample and adsorb onto the extraction head. After the equilibrium time is reached, remove the extraction head.

[0051] (3) Gas chromatography-mass spectrometry detection: The extraction head containing the beany-flavored substances is inserted into the inlet of the gas chromatography-mass spectrometry instrument for thermal desorption, allowing the beany-flavored substances to enter the gas chromatography column for separation. Different beany-flavored substances are separated in the gas chromatography column according to their different physical and chemical properties, and then enter the mass spectrometer for detection in sequence. The separated substances are qualitatively and quantitatively analyzed by the mass spectrometer to obtain the content data of various beany-flavored substances.

[0052] (4) Data recording and analysis: Record the content data of beany odor substances such as hexanal, hexanol, 1-octen-3-ol, (E,E)-2,4-nonadienal, and amyl alcohol in ordinary soybeans, conventional beany-free soybeans, and super beany-free soybeans. The results are shown in Figure 6 By comparing the differences in the content of beany odor substances between different types of soybeans, the contents of hexanal, hexanol, 1-octen-3-ol, (E,E)-2,4-nonadienal, and pentanol in the super beany-free soybeans obtained by the present invention are significantly lower than those of ordinary soybeans and conventional beany-free soybeans.

[0053] Obviously, those skilled in the art may, based on the core spirit of this invention and without departing from its basic framework, make various adjustments and extensions to this invention. If such modifications and variations remain within the scope of the claims or meet the standards of equivalent technologies, the present invention expressly intends to include them within the scope of protection.

Claims

1. An optimized gene editing vector pGES403, characterized by: The resistance protein and fluorescent protein expression structure of the gene editing vector pGES403 is pUBQ3::Bar-P2A-DsRED2. The pUBQ3::Bar-P2A-DsRED2 uses the soybean endogenous strong promoter pGmUBQ3 to tandemly connect the resistance gene Bar and the fluorescent gene expression frame DsRED2 on the pGES401 vector, wherein Bar and DsRED2 are separated by P2A. The nucleotide sequence of the promoter pGmUBQ3 is shown in SEQ ID No. 1, the nucleotide sequence of the resistance gene Bar is shown in SEQ ID No. 2, the nucleotide sequence of P2A is shown in SEQ ID No. 3, and the nucleotide sequence of DsRED2 is shown in SEQ ID No.

4.

2. A sgRNA combination for constructing odorless soybeans, characterized by: It includes 1 sgRNA that simultaneously targets GmFAD2-1A and GmFAD2-1B, whose nucleotide sequence is TGGGTGATTGCTCACGAGTG; 1 sgRNA that simultaneously targets GmLOX1 and GmLOX2, whose sequence is TGGAAAAGGAAAAGTTGGAA; and 1 sgRNA that targets GmLOX3, whose sequence is AATCATGCCCGTCCTGTTCT.

3. A CRISPR-Cas9-mediated multi-sgRNAs tandem vector, characterized by: The sgRNA combination of claim 2 is serially connected to the gene editing vector pGES403 of claim 1.

4. Use of the gene editing vector pGES403 according to claim 1, the sgRNA combination according to claim 2, and the multi-sgRNAs tandem vector according to claim 3 in cultivating soybeans without beany odor.

5. A method for producing soybeans without beany odor using CRISPR-Cas9 technology, characterized by: The multi-sgRNAs tandem vector according to claim 3 is transformed into Agrobacterium, and after Agrobacterium infects soybeans, soybeans with GmFAD2-1A, GmFAD2-1B, GmLOX1, GmLOX2, and GmLOX3 gene knockouts are screened.

6. The method according to claim 5, characterized in that: The beany smell substances are derived from hexanal, hexanol, 1-octen-3-ol, (E,E)-2,4-nonadienal, pentanol or a combination thereof.

Images