Application of ubiquitin-binding enzyme UBE2L6 in the prevention and treatment of porcine reproductive and respiratory syndrome and identification of porcine reproductive and respiratory syndrome-resistant pigs

Abstract

The present invention discloses the application of ubiquitin-binding enzyme UBE2L6 in preventing and treating blue ear disease in pigs and identifying blue ear disease-resistant pigs. The present invention first discovered that after pigs are infected with PRRSV virus, the expression of ubiquitin-binding enzyme E2L6 will be promoted, and the expression level of UBE2L6 will increase significantly with the increase of infection time. At the same time, UBE2L6 gene knockdown promotes PRRSV replication, and UBE2L6 overexpression significantly inhibits virus replication; when the expression level of UBE2L6 in pigs is high, the pigs are resistant to PRRSV, and vice versa. Therefore, promoting UBE2L6 expression can improve pigs' resistance to blue ear virus, and UBE2L6 can be used as a standard for determining PRRSV susceptibility or resistance. The present invention lays a solid foundation for identifying pigs susceptible to PRRSV and resistant pigs by discovering new disease resistance / susceptibility genes of PRRSV hosts, which is conducive to the breeding of excellent strains of pigs and has important significance for the prevention and control of blue ear disease in pigs.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and more specifically, relates to the application of ubiquitin-binding enzyme UBE2L6 in preventing and treating blue ear disease in pigs and identifying blue ear disease-resistant pigs. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS), commonly known as blue ear disease, is one of the most important infectious diseases in the pig industry, and its pathogenic mechanism and pathogen-host interaction mechanism are still unclear. Its pathogen is porcine reproductive and respiratory syndrome virus (PRRSV), which mainly infects porcine alveolar macrophages, destroys the immune system, and causes immunosuppression, similar to HIV. The virus has the following characteristics: extremely easy mutation and recombination, immunosuppression, long viremia, and antibody-dependent enhancement (ADE). At present, the vaccines developed from the perspective of the pathogen (PRRSV) have the following problems: low or no level of induced neutralizing antibodies, poor cross-protection against different strains, long vaccine virus carrying time, and recombination with field strains to produce recombinant viruses with stronger pathogenicity. Therefore, the vaccines currently developed cannot control the occurrence and spread of the disease, and there are no effective antiviral drugs.

[0003] Based on the problems of the vaccines currently developed for PRRSV, it is urgent to explore and study from a new perspective and idea. Since the genetic background is closely related to biological disease resistance, therefore, research is carried out from the perspective of host genetics, the host's resistance to PRRS is improved at the genetic level, and the work of screening blue ear disease-resistant pigs by genetic means is used to find genes related to PRRSV host resistance or susceptibility. It has incomparable advantages for the prevention and control of blue ear disease in pigs. It can not only study the infection mechanism of blue ear disease in pigs, but also provide new methods for the treatment and prevention of blue ear disease in pigs. For example, Chinese patent CN106191320A discloses the application of HPSE gene in screening blue ear disease-resistant pigs, and patent CN109207577A discloses the application of MARCO in screening blue ear disease-resistant pigs. By discovering PRRSV host disease resistance / susceptibility genes, and then cultivating and screening new varieties (lines) of disease-resistant (PRRS) pigs, exploring more related genes is of great significance for molecular resistance to blue ear disease in pigs. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the defects and shortcomings of the prior art in preventing and treating blue ear disease in pigs, and to provide the application of ubiquitin-binding enzyme UBE2L6 in preventing and treating blue ear disease in pigs and identifying blue ear disease-resistant pigs.

[0005] The purpose of the present invention is to provide a new application of ubiquitin-binding enzyme UBE2L6.

[0006] Another object of the present invention is to provide a preparation for improving pigs' resistance to blue ear virus.

[0007] Another object of the present invention is to provide a method for identifying pigs' resistance or susceptibility to blue ear virus.

[0008] Another object of the present invention is to provide a method for breeding a blue ear disease-resistant pig variety.

[0009] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0010] The present invention discovered for the first time that the expression of ubiquitin conjugating enzyme E2 L6 (UBE2L6) is promoted after pigs are infected with PRRSV virus, and the expression of UBE2L6 increases significantly with the increase of infection time. The UBE2L6 mRNA sequence number studied by the present invention is: NM_001246215.1, and the UBE2L6 protein sequence number is: NP_001233144.1. Studies have shown that knocking down UBE2L6 promotes PRRSV replication, and overexpressing UBE2L6 can inhibit PRRSV replication, and UBE2L6 inhibits PRRSV replication in a dose-dependent manner, indicating that the expression of UBE2L6 is closely related to PRRSV replication. At the same time, the expression level of UBE2L6 in pigs can be used to identify the resistance and susceptibility of pigs to blue ear disease. Therefore, UBE2L6 can be used as a biomarker to identify the resistance and susceptibility of pigs to blue ear virus, and can be used to cultivate blue ear disease-resistant pig varieties. It has great clinical application value for the screening and breeding of PRRSV-resistant pigs.

[0011] Therefore, the present invention provides the following uses of the ubiquitin-binding enzyme UBE2L6:

[0012] Application as a biomarker in identifying resistance or susceptibility of pigs to blue ear virus.

[0013] Application in breeding blue ear disease resistant pig breeds.

[0014] Application of an expression promoter or expression activator of UBE2L6 gene or protein in the preparation of a preparation for improving pig resistance to blue ear virus.

[0015] The "expression promoter or expression activator" mentioned herein includes but is not limited to enzyme activators, compound promoters, plasmids, etc.

[0016] The present invention provides the use of an agent for promoting the expression of ubiquitin-binding enzyme UBE2L6 gene or protein in preventing and treating blue ear disease, in preparing anti-blue ear disease therapeutic drugs or in preparing blue ear virus antiviral drugs.

[0017] Furthermore, pigs with higher UBE2L6 expression levels are more resistant to blue ear virus and less susceptible; conversely, they are more susceptible.

[0018] The present invention provides a reagent for detecting ubiquitin-binding enzyme UBE2L6 gene or protein for use in diagnosing blue ear disease in pigs or in preparing products for detecting and diagnosing blue ear disease in pigs, in screening blue ear disease-resistant pigs, or in preparing products for identifying pigs' susceptibility to blue ear virus.

[0019] In addition, as a preferred embodiment, the present invention provides a primer for detecting the expression of porcine UBE2L6, the sequences of which are shown in SEQ ID NO. 1 to 2. Specifically, upstream primer-F (SEQ ID NO. 1): 5′-GCGAAGGAGCTGGAGGATC-3′; downstream primer UBE2L6-R (SEQ ID NO. 2): 5′-TTCGGCCTTCCTGTTGAACA-3′.

[0020] In practical applications, the diagnostic criteria are: abnormal increase in UBE2L6 expression indicates infection with blue ear virus or blue ear disease. The "abnormal increase" mentioned here is based on the general level of UBE2L6 expression in pigs in the art.

[0021] The present invention also provides a preparation for improving pig's resistance to blue ear virus, which contains an expression promoter or expression activator of the ubiquitin-binding enzyme UBE2L6 gene or protein.

[0022] The present invention also provides a method for identifying the resistance and susceptibility of pigs to blue ear virus, and the resistance or susceptibility of pigs to blue ear virus is identified by detecting the expression level of UBE2L6 in pigs.

[0023] Furthermore, the identification criteria are: pigs with high UBE2L6 expression levels are resistant to blue ear virus; otherwise, they are susceptible.

[0024] In specific operations, the level of UBE2L6 expression is based on the general level of UBE2L6 expression in pigs in the art. The level mentioned here is relative, and the level of UBE2L6 expression is abnormally high or low, so as to determine whether the pig may be resistant to PRRSV and the degree of susceptibility to PRRSV.

[0025] More specifically, based on the results of the experiments of the present invention, the specific data standard for identification is roughly as follows: when the expression level of UBE2L6 is higher than 8.3±0.5×10 -2(relative to the internal reference HPRT1), the pigs were resistant to the virus; the expression level was lower than 8.3±0.5×10 -2 (relative to the internal reference HPRT1), susceptible.

[0026] In particular, the present invention does not impose strict restrictions on the method for detecting the expression level of UBE2L6, which can be an existing gene expression level detection method in the art.

[0027] In addition, the present invention also provides a method for breeding a blue ear disease-resistant pig variety by overexpressing the UBE2L6 gene of pigs.

[0028] The present invention has the following beneficial effects:

[0029] The present invention first discovered that after pigs are infected with PRRSV virus, the expression of ubiquitin-binding enzyme UBE2L6 will be promoted, and the expression level of UBE2L6 will increase significantly with the increase of infection time. By knocking down the UBE2L6 gene and inoculating PRRSV for 24 hours, the expression level of PRRSV-N protein increased significantly, indicating that knocking down UBE2L6 promotes PRRSV replication; after further overexpressing UBE2L6, it was shown that the UBE2L6 protein level increased significantly, while the PRRSV-N protein expression level decreased significantly, and with the increase of UBE2L6 concentration, the degree of inhibition of PRRSV-N protein was more obvious, indicating that UBE2L6 inhibits PRRSV replication in a dose-dependent manner, and overexpression of UBE2L6 can inhibit PRRSV replication. Therefore, promoting UBE2L6 expression can improve pigs' resistance to blue ear virus, and UBE2L6 can be used as a standard for determining PRRSV susceptibility or resistance. Pigs with abnormally high UBE2L6 expression are resistant to PRRSV, and vice versa. The present invention provides a new application of UBE2L6. By discovering new disease resistance / susceptibility genes of PRRSV hosts, it is beneficial to the breeding and screening of more new disease-resistant pig breeds (lines), laying a solid foundation for identifying the susceptibility of pigs to PRRSV and the screening, identification and breeding of PRRSV-resistant pigs, which is beneficial to the breeding of excellent strains of pigs and is of great significance for the prevention and control of porcine blue ear disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The expression levels of UBE2L6 protein in PAMs cells infected with PRRSV at different time points.

[0031] Figure 2 The expression levels of UBE2L6 mRNA in PAMs cells at different time points after PRRSV infection.

[0032] Figure 3 is the UBE2L6 mRNA expression level after UBE2L6 knockdown.

[0033] Figure 4 The expression levels of UBE2L6 and PRRSV-N proteins after UBE2L6 knockdown.

[0034] Figure 5 The expression levels of UBE2L6 and PRRSV-N proteins after UBE2L6 overexpression (dose-dependent).

[0035] Figure 6 The expression levels of UBE2L6 and PRRSV-N proteins at different time points after virus infection after UBE2L6 overexpression.

[0036] Figure 7 This is a statistical graph of the fluorescence intensity of PRRSV-N protein after UBE2L6 overexpression.

[0037] Figure 8 The expression levels of UBE2L6 and PRRSV-N proteins after UBE2L6 overexpression (immunofluorescence detection). DETAILED DESCRIPTION

[0038] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0039] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0040] Example 1 Expression of UBE2L6 gene

[0041] In this example, after PRRSV infected PAMs cells, the expression of ubiquitin conjugating enzyme E2 L6 (UBE2L6) was further studied to explore the relationship between UBE2L6 and PRRSV. The UBE2L6 mRNA sequence number is: NM_001246215.1, and the UBE2L6 protein sequence number is: NP_001233144.1.

[0042] Porcine alveolar macrophages (PAMs) (isolated by this laboratory through bronchoalveolar lavage fluid of PRRSV-negative piglets) were cultured in 1640 culture medium containing 10% fetal bovine serum, and the highly pathogenic PRRSV strain Li11 (the strain was stored in this laboratory) was inoculated at MOI=0.1, and continued to be cultured at 37°C in 1640 culture medium containing 2% fetal bovine serum. The cells were collected after culturing at different time points of 0, 6, 12, 24, and 36h (where 0h means no virus infection); subsequently, real-time PCR amplification and Western-blot detection were performed using primers of the UBE2L6 gene: upstream primer-F (SEQ ID NO.1): 5′-GCGAAGGAGCTGGAGGATC-3′; downstream primer UBE2L6-R (SEQ ID NO.2): 5′-TTCGGCCTTCCTGTTGAACA-3′.

[0043] The key steps of RNA extraction in the real-time PCR experiment are as follows: ① Add 0.2 ml of chloroform to each 1 ml of TRIZOL reagent-lysed sample, shake vigorously for 15 seconds, and incubate at 25°C for 2 minutes. Centrifuge at 4°C and 12,000 rpm for 15 minutes. After centrifugation, it will be divided into three layers: the lower red phenol chloroform phase, the middle layer, and the colorless upper aqueous phase. All RNA is distributed in the aqueous phase; ② Transfer the upper aqueous phase to a clean RNase-free centrifuge tube, add an equal volume of isopropanol to precipitate RNA, mix well, incubate at 25°C for 10 minutes, and centrifuge at 4°C and 12,000 rpm for 10 minutes. At this time, the RNA precipitate that was invisible before centrifugation will form a gelatinous precipitate on the bottom and side walls of the tube.

[0044] The key to Western-blot detection lies in protein sample preparation. Principles of protein sample preparation: ① Extract as completely as possible or reduce sample complexity to focus on extracting the target protein; ② Ensure that the protein is in a soluble state; ③ Prevent protein degradation, aggregation, precipitation, modification, etc. during the extraction process; ④ Try to remove interfering molecules such as nucleic acids, polysaccharides, and lipids; ⑤ Samples are packaged and stored at -80℃ to avoid repeated freezing and thawing.

[0045] The results of UBE2L6 protein detection after PRRSV infection of PAMs cells are as follows Figure 1 , showing that the expression of UBE2L6 protein increased significantly after PRRSV infected PAMs cells. Figure 2 As shown in the figure, the mRNA expression level increased significantly, and the increase became more obvious as the infection time prolonged.

[0046] Example 2 Knockdown of UBE2L6

[0047] UBE2L6 shRNA primers were designed: shUBE2L6-sense (SEQ ID NO.3): 5′-CCGGT CAGGCCTCCCACGATCAAATCTCGAGATTTGATCGTGGGAGGCCTGATTTTT G-3′; shUBE2L6-antisense (SEQ ID NO.4): 5′-AATTCAAAAATCAGGCCTCC CACGATCAAATCTCGAGATTTGATCGTGGGAGGCCTGA-3′, and a pair of Negative Control primers (sh-Control negative control): shCtrl-sense (SEQ ID NO.5): 5′-CCGG CCCGCGAACGACATTTATAATCTCGAGATTATAAATGTCGTTCGCGGGTTTT TG-3′; shCtrl-antisense (SEQ ID NO.6): 5′-AATTCAAAAACCCGCGAACGAC ATTTATAATCTCGAGATTATAAATGTCGTTCGCGGG-3′), and sent to Thermo Synthesized by Fisher Scientific.

[0048] Then use Lipofectamine TM PAMs cells were cultured in two 6-well plates with 1640 culture medium containing 10% fetal bovine serum to 80% density. shRNA, shCtrl and Lipofectamine TM 2000 with Opti- The cells were diluted with Reduced Serum Medium; after dilution, they were mixed in a 1:1 ratio and cultured at room temperature for 5 min, then added to PAMs cells replaced with fresh 1640 culture medium and cultured in a 37°C, 5% CO2 incubator for 6 h, the supernatant was discarded, the cells were washed once with PBS, and then cultured for another 48 h with 1640 culture medium containing 10% fetal bovine serum, and the cells were collected.

[0049] The knockdown effect of UBE2L6 was then verified by qRT-PCR. The precautions for qRT-PCR are as follows: ① All steps should be completed on a clean bench, and the clean bench should be exposed to ultraviolet light for at least 15 minutes; ② Use 75% alcohol to wipe the bench to avoid surface contamination; ③ After entering the fluorescence quantitative PCR operation laboratory, you must wear a mask and sterile latex gloves, avoid talking during the experiment, and prevent PCR template contamination and aerosol contamination; ④ Various centrifuge tubes, gun tips, and water used for preparing reagents and dissolving precipitation should be treated with DEPC before use to prevent RN A enzyme contamination; ⑤ Prepare the qPCR reaction mixture first to reduce errors. The operation process includes RNA extraction, reverse transcription, primer design, fluorescence quantitative PCR, data processing and analysis.

[0050] Test results such as Figure 3 As shown, after UBE2L6 was knocked down by shRNA, shRNA significantly inhibited the expression of UBE2L6 mRNA and protein compared with the control group.

[0051] After culturing in another 6-well plate for 48 h, PRRSV was added to the culture medium and cultured for another 24 h. The cells were collected and the effect of UBE2L6 knockdown on PRRSV replication was verified by Western-blot experiment (the method and steps are the same as those in Example 1).

[0052] Test results such as Figure 4 As shown, 24 hours after PRRSV infection, the expression level of PRRSV-N protein increased significantly, indicating that knockdown of the UBE2L6 gene promoted PRRSV replication.

[0053] Example 3 Overexpression of UBE2L6

[0054] The pCAGGS-UBE2L6 overexpression vector was constructed by enzyme ligation technology. PAMs cells were cultured to 80% density in 1640 medium containing 10% fetal bovine serum in two 6-well plates. Lipofectamine TM 3000 (purchased from Thermo Fisher Scientific) were used to transfer pCAGGS-UBE2L6 and pCAGGS empty vectors into PAMs cells, respectively, and cultured in a 37°C, 5% CO2 incubator for 6 h. The supernatant was discarded, the cells were washed once with PBS, and cultured for another 24 h with 1640 culture medium containing 10% fetal bovine serum. The cells were collected to detect the overexpression effect.

[0055] After culturing in another 6-well plate for 24 h, PRRSV was added to the culture medium and cultured for another 12, 24, and 36 h. The cells were collected to detect the effect of UBE2L6 overexpression on PRRSV replication.

[0056] The results of the detection of UBE2L6 and PRRSV-N protein expression levels after UBE2L6 overexpression are as follows Figure 5 As shown in Figure 2, after UBE2L6 was overexpressed, the UBE2L6 protein level was significantly increased. Figure 6 As shown in the figure, the expression level of PRRSV-N protein was significantly reduced. And with the increase of pCAGGS-UBE2L6 plasmid concentration, the degree of inhibition of PRRSV-N protein was more obvious, indicating that UBE2L6 inhibited PRRSV replication in a dose-dependent manner.

[0057] Further immunofluorescence experiments were performed to show the fluorescence intensity and protein expression level of UBE2L6 and PRRSV-N proteins after UBE2L6 overexpression. Figure 7 As shown in the figure, it can be seen that as the concentration of UBE2L6 overexpression plasmid increases, the fluorescence of PRRSV-N protein decreases ( Figure 8 The above results further prove that UBE2L6 overexpression inhibits PRRSV replication.

[0058] Example 4 Application of UBE2L6 in Identifying Pigs Resistant to Blue Ear Disease

[0059] The sample sources of this embodiment are: the local breeds of Tongcheng pigs and Meishan pigs in my country and the foreign breeds of Landrace pigs and Large White pigs as the research objects. Among them, it is known that Tongcheng pigs and Meishan pigs are not susceptible to blue ear virus and have resistance; while Landrace pigs and Large White pigs are more susceptible to blue ear virus and have susceptibility.

[0060] Fifteen Tongcheng pigs, Meishan pigs, Landrace pigs and Large White pigs were selected and divided into three groups of five: PRRSV challenge group (nasal drops + intramuscular injection, challenge dose: 3 × 10 5 TCID 50 / head), DMEM control group (negative control, nasal drops + intramuscular injection of DMEM), and no treatment group (blank control). Blood was collected 3 days before the challenge and on the 7th, 14th, 21st, and 28th days after the challenge. The control group was blood-collected simultaneously. The animals were killed on the 28th day and blood, lung, lymph node, and tonsil tissues were collected. A portion of the serum was taken for virus TCID50 determination (tissue half infection dose), and RNA was extracted from the remaining serum and lung, lymph node, and tonsil tissues, and reversed. UBE2L6 and PRRSVN proteins were detected by qRT-PCR, and pathological sections were made for the lungs and lymph nodes.

[0061] The infectivity of local Tongcheng pigs, Meishan pigs, and foreign Landrace pigs and Large White pigs to PRRSV was determined based on TCID50, PRRSV N protein expression levels, and lung and lymph node tissue pathological sections. The relationship between the expression level of UBE2L6 in pigs and its resistance to PRRSV in the above four pig breeds was studied.

[0062] According to the results, Tongcheng pigs and Meishan pigs are not susceptible to PRRS virus (are resistant), while Landrace pigs and Large White pigs are more susceptible to PRRS virus (are susceptible).

[0063] At the same time, the results of the UBE2L6 expression level (gene background expression level) in pigs before the virus attack (unchallenged pigs) showed that the expression of UBE2L6 in Tongcheng pigs and Meishan pigs was significantly higher than that in Landrace pigs and Large White pigs, further proving that Tongcheng pigs and Meishan pigs are resistant compared to Landrace pigs and Large White pigs, indicating that the susceptibility of pigs to blue ear virus can be identified by detecting the expression level of UBE2L6. After the virus attack, the expression of UBE2L6 in pigs increased significantly, which is consistent with the experimental results at the cell level.

[0064] In addition, based on a large number of experimental results of the present invention, the specific data standard for identifying the susceptibility of pigs to blue ear virus is roughly as follows: when the expression level of UBE2L6 is higher than 8.3±0.5×10 -2 (relative to the internal reference HPRT1 gene), the pigs were resistant to the virus; the expression level was lower than 8.3±0.5×10 -2 (relative to the internal reference HPRT1 gene), susceptible. And in pigs, compared with other pathogens, after pigs were infected with PRRSV, the expression of UBE2L6 increased significantly, that is, the change in the expression of this gene in pigs was specifically caused by PRRSV (not related to other pathogens). It suggests that the expression of UBE2L6 is closely related to PRRSV infection.

[0065] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Use of a reagent for promoting the expression of ubiquitin-binding enzyme UBE2L6 gene or protein in the preparation of a drug for preventing porcine blue ear disease, wherein the reagent is a UBE2L6 overexpression vector, the mRNA sequence number of the UBE2L6 gene is: NM_001246215.1, and the sequence number of the protein is: NP_001233144.

1.

2. Use of an overexpression vector of the ubiquitin-binding enzyme UBE2L6 gene or protein in the preparation of a preparation for improving pig resistance to blue ear virus. The mRNA sequence number of the UBE2L6 gene is: NM_001246215.1, and the sequence number of the protein is: NP_001233144.1.

Images