Tobacco disease-resistant gene NbPRRK90 and application thereof in regulation and control of plant immunity

Abstract

The invention discloses a tobacco disease-resistant gene NbPRRK90 and an application of the tobacco disease-resistant gene NbPRRK90 in regulation and control of plant immunity. Transcription mode analysis and plant expression analysis find that the NbPRRK90 can improve the disease resistance of plants to phytophthora, so that the tobacco disease-resistant gene NbPRRK90 can be applied to synthesis of new disease-resistant genes in plant disease-resistant breeding and the like, and is a disease-resistant material with high application value. The tobacco disease resistance related gene NbPRRK90 is transiently expressed in tobacco, phytophthora capsici is inoculated 2 days later, it can be observed that after NbPRRK90 expression, the number of disease spots is remarkably reduced compared with that of negative control, and biostatistical analysis shows that the areas of the two treated disease spots are remarkably different.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to a tobacco disease resistance gene NbPRRK90 and its application in regulating plant immunity. Background Technology

[0002] Plant diseases are one of the most significant limiting factors in agricultural production, severely impacting crop yield and quality. With global climate change and adjustments in planting structures, the frequency and severity of plant diseases are continuously increasing. Traditional disease control methods primarily rely on chemical pesticides, but long-term use not only leads to environmental pollution but may also cause pesticide resistance in pathogens. Therefore, developing green and efficient disease control strategies has become an important direction in modern agricultural research.

[0003] In recent years, with the rapid development of molecular biology and genomics, significant progress has been made in the research of plant disease resistance genes. Plants recognize pathogen invasion through their complex immune system and activate a series of defense responses. At the heart of these defense mechanisms are plant disease resistance genes, whose encoded proteins play a crucial role in pathogen recognition, signal transduction activation, and initiation of defense responses. By identifying and utilizing these disease resistance genes, crop varieties with durable resistance can be developed, thereby reducing pesticide use and improving agricultural sustainability.

[0004] In the study of plant disease resistance genes, tobacco, as a model plant, has significant research value. The tobacco genome is relatively simple, and its genetic transformation and gene expression technologies are mature, facilitating functional research and application development. Furthermore, tobacco plays a vital role in agricultural production; research on its disease resistance not only helps improve tobacco yield and quality but also provides a theoretical basis and technical support for disease resistance breeding in other crops. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a protein encoded by the tobacco disease resistance gene NbPRRK90 and its application in regulating plant immunity.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] An NBPRRK90 protein is at least one of the following:

[0008] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.1;

[0009] (b) Analogs of the amino acid sequence shown in SEQ ID NO: 1, which still have the function of enhancing plant immunity and disease resistance by substitution, insertion or deletion of one or more amino acids.

[0010] The aforementioned NBPRRK90 protein can enhance plant immunity and disease resistance; preferably, it can enhance tobacco's immunity to Phytophthora capsici.

[0011] The nucleotide sequence of the gene encoding the aforementioned NBPRRK90 protein was obtained according to the codon coding rules.

[0012] An NBPRRK90 gene, the nucleotide sequence of which is at least one of the following:

[0013] (a) The nucleotide sequence shown in SEQ ID NO.2;

[0014] (b) Analogs of the nucleotide sequences in (a) above, obtained by base insertion, deletion, or substitution, that still have the function of enhancing plant immunity and disease resistance.

[0015] An NBPRRK90 expression vector comprising the nucleotide sequence shown in SEQ ID NO.2.

[0016] The vector backbone of the NBPRRK90 expression vector is pBin.

[0017] The above-mentioned NBPRRK90 protein, NBPRRK90 gene and / or NBPRRK90 expression vector are used to improve the disease resistance of tobacco.

[0018] The application of the aforementioned NBPRRK90 protein, NBPRRK90 gene, and / or NBPRRK90 expression vector in the preparation of tobacco immune inducers.

[0019] The application of the aforementioned NBPRRK90 protein, NBPRRK90 gene, and / or NBPRRK90 expression vector in screening disease-resistant varieties.

[0020] A method for activating plant immune disease resistance includes the following steps:

[0021] (1) The nucleotide sequence of the NBPRRK90 gene was integrated into the expression vector and transformed into Agrobacterium to obtain Agrobacterium expressing the NBPRRK90 gene;

[0022] (2) Apply Agrobacterium expressing the NBPRRK90 gene to plants to activate plant immune disease resistance.

[0023] The application to plants refers to the application to plant leaves.

[0024] The plant in question is Nicotiana benthamiana.

[0025] A biological agent for enhancing plant immunity and disease resistance includes Agrobacterium, which has been transformed with an expression vector containing the NBPRRK90 gene.

[0026] The present invention has the following advantages and effects compared with the prior art:

[0027] (1) The tobacco disease resistance-related gene NbPRRK90 in this invention was isolated from tobacco. The full-length cDNA of this gene is 3516 bp. The protein encoded by this gene is a transmembrane protein composed of 1172 amino acids. Through transcriptional pattern analysis and plant expression analysis, it was found that NbPRRK90 can improve the plant's resistance to Phytophthora infestans. Therefore, the tobacco disease resistance gene NbPRRK90 can be applied to plant disease resistance breeding and the synthesis of new disease resistance genes, and is a disease resistance material with great application value.

[0028] (2) In this invention, the tobacco disease resistance-related gene NbPRRK90 was transiently expressed in tobacco. Two days later, it was inoculated with Phytophthora capsici. It was observed that the lesions after NbPRRK90 expression were significantly smaller than those in the negative control. Furthermore, biostatistical analysis showed that the lesion area of ​​the two treatments was significantly different. Attached Figure Description

[0029] Figure 1 This is a graph showing the effects of NbPRRK90 and RFP on tobacco infected by Phytophthora capsici; the left graph shows the effect of NbPRRK90 on tobacco infected by Phytophthora capsici; the right graph is a statistical analysis of the area of ​​lesions in tobacco infected by Phytophthora capsici.

[0030] Figure 2 It utilizes VIGS technology to improve the silencing efficiency of Benedict's tobacco NBPRRK90.

[0031] Figure 3 This is a diagram showing the results of an experiment on Phytophthora capsici infection after NbPRRK90 silencing.

[0032] Figure 4 This is a statistical analysis chart of lesion area in the *Phytophthora capsici* infection experiment after NbPRRK90 silencing. Detailed Implementation

[0033] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0034] Unless otherwise specified in the following implementation plan, the test conditions are generally as per standard test conditions or the test conditions recommended by the reagent company. Unless otherwise specified, all materials and reagents used are commercially available.

[0035] The *Phytophthora capsici* involved in the embodiments of this invention is a conventional *Phytophthora*, which can be obtained through commercial means or isolated from nature.

[0036] The Pbin vector and Agrobacterium GV3101 involved in the embodiments of the present invention can be obtained through conventional commercial means.

[0037] Example 1: Cloning and Acquisition of the NBPRRK90 Gene

[0038] Analysis of the tobacco genome predicted a potential functional gene, NbPRRK90. Primers (upstream primer NbPRRK90-F and downstream primer NbPRRK90-R) were designed. Total RNA (ribonucleic acid) was extracted from tobacco leaves using a Sangon Biotech kit. The mRNA was then transcribed into cDNA using a 5*Prime ScriptRT MaterMix amplification reagent. The cDNA was then amplified by PCR using primers. The PCR product was purified and separated by electrophoresis on a 1% agarose gel. The agarose gel containing the target fragment was excised and collected in 2 ml centrifuge tubes, and recovered using an Omega Gel Extraction Kit. Sequencing confirmed the NbPRRK90 gene fragment, whose nucleotide sequence is shown in SEQ ID NO:2, and the corresponding encoded amino acid sequence is shown in SEQ ID NO:1.

[0039] The PCR program was as follows: 95℃, 3 min; 95℃, 15 sec; 57℃, 15 sec; 72℃, 90 sec; 34 cycles; 72℃, 5 min.

[0040] Upstream primer NbPRRK90-F:

[0041] TACGAACGATAGCCGGTACCCCCGGGATGTCAAAGACAGTTTTATATGC;

[0042] Downstream primer NbPRRK90-R:

[0043] TCCTCGGAGGAGGCCATCCCGGGAATTGCATCTTTACCAAACA.

[0044] Example 2: Transient expression of NbPRRK90 in tobacco

[0045] 2.1 Experimental Materials (Test Strains, Plants, and Vectors)

[0046] Test strain: The wild-type strain of Phytophthora capsici (Wild Type, abbreviated as WT) is a common Phytophthora fungus that can be obtained through commercial means or isolated in nature;

[0047] Agrobacterium tumefaciens strain GV3101 is commercially available;

[0048] The test grafting plant material was Nicotiana benthamiana, which was self-propagated in the laboratory. It was cultivated in greenhouse conditions (25℃, 16h light / 8h dark) for 4-6 weeks after sowing seeds and then used for inoculation experiments.

[0049] Vector: Pbin::RFP, kindly provided by the Laboratory of Oomycetes and Fungal Molecular Biology, College of Plant Protection, Nanjing Agricultural University.

[0050] 2.2 Construction of Tobacco Transient Expression Vector:

[0051] The NbPRRK90 target fragment amplified in Example 1 was ligated to the Pbin vector using homologous recombinase (linkage site: SmaI) to obtain the Pbin::NbPRRK90 recombinant plasmid; the RFP sequence was ligated to the Pbin vector using homologous recombinase (linkage site: SmaI) to obtain the recombinant plasmid Pbin::RFP containing RFP red fluorescent protein. After propagation in Escherichia coli JM109 strain, the plasmids were extracted, and the recombinant plasmids Pbin::RFP and Pbin::NbPRRK90 were transformed into Agrobacterium GV3101, respectively.

[0052] 2.3 Transient expression of tobacco

[0053] Single colonies of Agrobacterium containing recombinant plasmids Pbin::NbPRRK90 and Pbin::RFP were picked and placed in 2 ml of LB broth containing kanamycin (50 μg / ml) and incubated at 28°C and 180 rpm for 1–2 days. The bacterial cells were collected by centrifugation at 4000 rpm for 4 min, and the precipitate was gently aerated with pre-cooled MgCl2 before centrifugation at 4000 rpm for 4 min. This process was repeated three times. After adjusting the OD value of the bacterial culture to 0.4–0.6 with MgCl2, the culture was injected into tobacco leaves, with each type of Agrobacterium injected into half of a tobacco leaf.

[0054] 2.4 Inoculation with Phytophthora capsici

[0055] Two days later, cut off the injected tobacco leaves, punch out Phytophthora capsulatum cakes with a punch, inoculate the underside of the tobacco leaves with the mycelial side down, inoculate one cake on each side of the leaf at the same location, and place them in a plastic box to keep them moist.

[0056] 2.5 Results and Discussion

[0057] Two days later, the size of the lesions infected with Phytophthora capsici was observed under ultraviolet light. The results were as follows: Figure 1As shown, when NbPRRK90-RFP and RFP were transiently expressed in tobacco, and then inoculated with Phytophthora capsici two days later, it was observed that the lesions after NbPRRK90 expression were significantly smaller than those of the control. Furthermore, biostatistical analysis showed that there was a significant difference in lesion area between the two treatments, indicating that NbPRRK90 expression enhanced the plant's resistance to Phytophthora capsici.

[0058] Example 3: VIGS-mediated silencing of the Tobacco Benedict gene

[0059] 3.1 Experimental Materials (Test Strains, Plants, and Vectors)

[0060] Test strains and plants: Refer to step (1) of Example 2.

[0061] The carriers are pTRV1 (NCBI database access number: AF406990.1) and pTRV2 (NCBI database access number: AF406991.1). Both carriers can be obtained through commercial channels.

[0062] 3.2 Construction of expression vector for tobacco-targeted silent genes:

[0063] The optimal target sequence for the target silence gene NbPRRK90 was predicted using the online tool SGN VIGS Tool (SEQ ID NO. 5). The amplified NbPRRK90 target fragment was ligated to the pTRV2 vector using homologous recombinase (linkage site: EcoRI) to obtain the pTRV2::NbPRRK90 recombinant plasmid. Similarly, a silence target sequence (SEQ ID NO. 6) was designed with the GUS gene as the target as a control. It was ligated to the pTRV2 vector using homologous recombinase (linkage site: EcoRI) to obtain the pTRV2::GUS recombinant plasmid. After propagation in Escherichia coli JM109 strain, the plasmids were extracted, and the recombinant plasmids pTRV2::NbPRRK90 and pTRV2::GUS were transformed into Agrobacterium GV3101, respectively.

[0064] 3.3 Transient expression of tobacco

[0065] Single colonies of Agrobacterium containing recombinant plasmids pTRV2::NbPRRK90, pTRV2::GUS, and pTRV1 were picked and cultured in 2 ml of LB liquid medium containing kanamycin (50 μg / ml) at 28°C and 180 rpm for 1–2 days. Referring to step (3) of Example 2, the method for transient expression of Agrobacterium-mediated Nicotiana benthamiana was used. Agrobacterium containing pTRV2::NbPRRK90 or pTRV2::GUS recombinant plasmids was mixed 1:1 with Agrobacterium containing pTRV1 and injected into the leaves of 3–4 leaf stage Nicotiana benthamiana seedlings. The tobacco was used for subsequent experiments 3 weeks later.

[0066] 3.4 Verifying the efficiency of silence

[0067] (1) Sample preparation

[0068] Tobacco leaves injected in step 3.3 were sampled, ground into powder with liquid nitrogen, and used for subsequent RNA extraction.

[0069] (2) RNA extraction

[0070] RNA extraction was performed using the BBI All-In-One DNA / RNA Mini-Preps Kit, following the kit's instructions. The concentration, OD260 / 280, and OD260 / 230 of the RNA samples were measured using a Thermo Fisher Scientific micro-spectrophotometer.

[0071] (3) cDNA synthesis

[0072] Quality-compliant RNA was used for genomic DNA elimination and reverse transcription cDNA synthesis using the FastKing cDNA First-Strand Synthesis Kit (Tiangen). The gDNA removal reaction system was prepared as follows and incubated at 42℃ for 3 min: 2 μL 5×gDNA Buffer, 1000 ng Total RNA, and up to 10 μL RNase-Free ddH2O.

[0073] Prepare the following reverse transcription reaction mixture and add it to the gDNA removal reaction system, mixing thoroughly by pipetting: 10×KingRT Buffer 2 μL, FastKing RT Enzyme Mix 1 μL, FQ-RT Primer Mix 2 μL, RNase-FreeddH2O 5 μL. The reaction conditions are: 42℃ for 15 min; 95℃ for 3 min, to obtain reverse transcribed cDNA.

[0074] Using the Primer 3 online primer design website (http: / / bioinfo.ut.ee / primer3-0.4.0 / ), NbPRRK90 gene-specific primers, NbPRRK90-qRTF and NbPRRK90-qRTR, were designed. Using the tobacco NbEF1α gene as an internal control, quantitative primers NbEF1α-qRTF and NbEF1α-qRTR were designed, and silencing efficiency was determined using qPCR. The above cDNA was used as a template for qRT-PCR analysis. The SYBR Premix Ex Taq™ kit from Takara was used for qRT-PCR, and the following reaction system was prepared:

[0075] SYBR Premix Ex TaqTM 10μL, Template 2μL, Forward primer 0.8μL, Reverseprimer 0.8μL, RNase-Free ddH2O 6.4μL.

[0076] After preparing the reaction mixture, run the qTOWER3 Real-Time PCR thermal cyclers (AnalytikJena) program. Amplification program: pre-denaturation 95℃ 30s; PCR reaction 95℃ 5s, 60℃ 30s, 40 cycles.

[0077] Upstream primer NbEFla-qRTF:

[0078] 5-'TTGCTTGCTTTCACCCTTGG-3'

[0079] Downstream primer NbEFla-qRTR:

[0080] 5-'TCGAAACCAGAGATGGGGAC-3'

[0081] Upstream primer NbPRRK90-qRTF:

[0082] 5-'AGCCAACTCAGACACAGGAA-3'

[0083] Downstream primer NbPRRK90-qRTR:

[0084] 5-'GCAGGTATGACAAACCACTAGC-3'

[0085] 3.5 Inoculation with Phytophthora capsici

[0086] Refer to step (4) of Example 2 for the method of inoculating with Phytophthora capsici.

[0087] 3.6 Results and Discussion

[0088] qRT-PCR results are as follows Figure 2 As shown, the experimental results demonstrate that NbPRRK90 in *Tobacco Benzoenta* was successfully silenced using VIGS technology, with a silencing efficiency of 74%. Two days later, the inoculated leaves were observed under ultraviolet light to assess the size of *Phytophthora capsici* lesions. The results are as follows... Figure 3 and Figure 4 As shown, lesions were significantly larger after NbPRRK90 silencing compared to the negative control GUS, and biostatistical analysis showed a significant difference in lesion area between the two treatments, indicating that PRRK90 expression enhances plant resistance to Phytophthora capsici.

[0089] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. An NBPRRK90 protein, characterized in that it comprises at least one of the following: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.1; (b) Analogs of the amino acid sequence shown in SEQ ID NO: 1, which still have the function of enhancing plant immunity and disease resistance by substitution, insertion or deletion of one or more amino acids.

2. The NBPRRK90 protein according to claim 1, characterized in that: The NBPRRK90 protein described above can enhance plant immunity and disease resistance.

3. An NBPRRK90 gene, characterized in that its nucleotide sequence comprises at least one of the following: (a) The nucleotide sequence shown in SEQ ID NO.2; (b) Analogs of the nucleotide sequences in (a) above, obtained by base insertion, deletion, or substitution, that still have the function of enhancing plant immunity and disease resistance.

4. An NBPRRK90 expression vector, characterized in that: Includes the nucleotide sequence shown in SEQ ID NO.

2.

5. The application of the NBPRRK90 protein of claim 1 or 2, the NBPRRK90 gene of claim 3, and / or the NBPRRK90 expression vector of claim 4 in improving the disease resistance of tobacco.

6. The use of the NBPRRK90 protein of claim 1 or 2, the NBPRRK90 gene of claim 3, and / or the NBPRRK90 expression vector of claim 4 in the preparation of tobacco immune inducers.

7. The use of the NBPRRK90 protein of claim 1 or 2, the NBPRRK90 gene of claim 3, and / or the NBPRRK90 expression vector of claim 4 in screening disease-resistant tobacco varieties.

8. A method for activating plant immune disease resistance, characterized in that... Includes the following steps: (1) The nucleotide sequence of the NBPRRK90 gene was integrated into the expression vector and transformed into Agrobacterium to obtain Agrobacterium expressing the NBPRRK90 gene; (2) Apply Agrobacterium expressing the NBPRRK90 gene to plants to activate plant immune disease resistance.

9. The method for activating plant immune disease resistance according to claim 8, characterized in that: The application to plants refers to the application to plant leaves; The plant in question is Nicotiana benthamiana.

10. A biological agent for enhancing plant immunity and disease resistance, characterized in that: This includes Agrobacterium that has been transformed into an expression vector containing the NBPRRK90 gene.

Images