84 results about "Recurrent selection" patented technology

The invention discloses a network protocol address feedback method and a domain name resolution server. The method comprises the following processing steps: receiving a domain name inquiry request which is sent by a client and carries domain name information, and obtaining one or more network protocol addresses corresponding to the domain name information; checking the health of one more network protocol addresses and obtaining one or more healthy network protocol addresses; and obtaining a final network protocol address from one or more healthy network protocol addresses by adopting load balancing algorithm, and feeding back the final network protocol address to the client. Through the processing, the development amount of heartbeat detection and recurrent selection strategies on a DNS client can be effectively saved and the load balancing of all servers in inquiry records is realized.

The invention provides a method for producing breed of a black-skin dorking, which comprises the following steps: (1) building a line taking a Tianfu black-bone chicken with black feathers and black skin as a maternal line, adopting a family method of breeding to perform pure line breeding to obtain a Tianfu balck-bone chicken with black skin; (2) conducting hybridization and backcross by taking a white plymouth rock as a male parent and taking the Tianfu black-bone chicken with black skin a female parent to obtain a group containing more than 75% of Tianfu black-bone chicken (B1 line); (3) conducting hybridization and backcross by taking the Tianfu black-bone chicken with black skin as a male parent and taking a Sichuan mountain black-bone chicken with back feathers and black skin as a female parent and introducing 25% of Sichuan mountain black-bone chicken into the Tianfu black-bone chickens (B2 line); and (4) performing hybridization by taking the B1 line as a male parent and taking the B2 line as a female parent, carrying out crossing fixation, closing and breeding, and adopting the family method of breeding and a positive and negative recurrent selection method to perform the pure line breeding to obtain a new black-skin dorking line. The new line has the advantages of unified appearance, black (dark) carcass skin, high production performance and good mouthfeel, flavor and nourishing effect.

A method for selectively culturing the new variety of wheat includes such steps as respective crossing between the wheat 'Aibai' as female parent and 15-20 excellent varieties as male parent to obtain F1 generation, respective backcrossing between the dwarf sterile plants as female parent and the said male parent to obtain the backcrossed seeds F1, mixing them together, free pollination between fertile plants and sterile plants to obtain the seeds, mixing, free pollination between dwarf sterile plants and non-dwarf fertile plants to obtain seeds A, controlled pollination between the high-quality dwarf sterile plants as female parent and the specific plants as male one to obtain seeds B, proportionally mixing seed A with B, repeating said steps to obtain improved group, and culturing the excellent fertile plants by genealogical method.

The invention discloses a breeding method for black and white sweet glutinous hybrid maize. The breeding method for black and white sweet glutinous hybrid maize comprises the steps of selecting ultra-sweet maize, glutinous maize, a common high yield multi-resistance maize-inbred line and the like from different regions to be equivalently mixed, openly pollinating the maize, establishing a basic group A, selecting black glutinous maize germplasm from different regions to be equivalently mixed, openly pollinating the maize, and establishing a basic group B; then carrying out recurrent selection to the properties of seeds of the maize to respectively form a white sweet glutinous maize recurrent selection group A and a black sweet glutinous maize recurrent selection group B, obtaining a serious inbred line through multi-generation inbreeding, and screening a white sweet glutinous maize inbred line 4587 and a black sweet glutinous maize inbred line 3303 through combination ability measurement and cross combination quality identification to obtain 4587 X black 3303 hybrid. The breeding method can ensure both the glutinous and sweet genes of a parent inbred line and the hybrid of the parent inbred line, and also ensure the appearance quality, the favorable edible quality, the stability and the consistency of the hybrid. Moreover, the seeds of the maize are black and white.

The invention discloses a synthetic method of an original colony for corn breeding for reciprocal recurrent selection, belonging to the technical field of corn breeding, which solves the problem that existing gene linkage degree is high and germplasm resources are relatively narrow. The method comprises the following steps: first, selecting a plurality of selfing line materials with relatively wide hereditary basis and high common combining ability in a same class group; carrying out variance analysis and F index inspect among combining abilities of the materials based on an NCII mating designed test of an AMMI (Additive Main effects and Multiplicative Interaction) model to analyze hereditary effects; assembling incomplete diallel cross combination by using the materials; and assembling a top cross specie according to the non-overlapping principle of germplasm complementation, and after equivalently and uniformly mixing seeds of the top cross, continuously and fully mixing pollen twice to pollinate, wherein the seed obtained by the manner is the original colony for corn breeding. The synthetic method disclosed by the invention can break linkage in the same group to create variation, thereby providing an abundant material basis for recurrent selection and selfing line breeding.

The invention discloses a cultivation method for obtaining rice plants, which simultaneously show male-sterile and dwarf properties, through genetic engineering. Dwarf male-sterile rice with simultaneous incomplete expression of male-fertile genes and plant height genes is cultivated with an RNAi (Ribonucleic Acid interfere) technology by using a GA20-oxidase gene (OsGA20o*2), which has an effect of stretching rice stems and is used for gibberellin synthesis, and an RTS (Ricetapetum-Specific) gene which plays a key role in development of rice anther tapetum; the male-sterile and dwarf properties of the dwarf male-sterile rice simultaneously occur; and the rice can be normally fertilized to bear fruits after receiving wild type plant pollen. The dwarf male-sterile rice can be widely applied to rice recurrent selection breeding and has great significances to rice genetic breeding and production.

The invention discloses a construction method for synthesis of warm corn artificial population Suwan-Lancaster. The construction method comprises the following steps: selecting strains respectively from Suwan and Lancaster class groups, carrying out artificial purposeful hybridization for synthesizing the warm corn Suwan-Lancaster population, carrying out open pollination under natural isolation conditions, and continuously carrying out genetic equilibrium for four times to form Suwan-Lancaster original population C0, named Sulan C0. The warm corn artificially synthesized Suwan-Lancaster population has high yield genetic gain and great population structural variation; a half sib recurrent selection method is adopted for improving the Suwan-Lancaster population for three times; and meanwhile, line selection is directly carried out on the improved population, a batch of good inbred lines are bred, and the population has the effect of promoting widening of the existing corn germplasm foundation of China.

The invention discloses a molecular marker of sesame dominant genic male sterility gene and a preparation method and application thereof. A forward primer sequence of the marker GB50 is ATGGGTTTATGGCAGGCT, and a reverse primer sequence is GGACTACTCCTCCTCCCCA; a forward primer sequence of SBM298 is CCCCTTTTCACTTACGTACAGCAG, and a reverse primer sequence is CTCTTCCTCCACCATCTCCTCTTC. The preparation method comprises the steps of: A, respectively numbering dominant genic male sterility brother-sister inbreeding segregation population in the seedling stage, collecting tender leaves from each individual plant, treating by liquid nitrogen and storing in a refrigerator for standby; B, conducting biosynthesis by using EST-SSR primers of SBM series; C, amplifying by a PCR procedure; D, conducting PCR amplification and product detection; E, acquiring a polymorphism marker; and F, acquiring a molecular marker associated with male sterility. The method can obtain 100% male sterility population, significantly improve the efficiency of sesame recurrent selection, and avoid the trouble of eradication of 50% fertile plants until the flowering phase by using morphological characteristics. The invention has obvious effect, low cost, no pollution and very broad application prospects.

The breeding method combines establishment of Taigu nuclear sterile group, constant introduction of excellent parent, auxiliary selection with molecular marker, purification of heterotic genotype descendant through chromosomal elimination technology to obtain genetically stable wheat germ plasm. The present invention utilizes the biological technology in breeding wheat variety fully to from one high efficiency and fast polymerized wheat breeding technology.

The invention relates to the field of breeding and specifically relates to a multi-ecological-area recurrent mixed selection - mixed planting cotton breeding method, which comprises the following steps of: 1) preparing cotton hybridized combinations; 2) reproducing generation F1 hybrid seeds in the south for increasing the generation; 3) respectively sowing generation F2 seeds in cotton regions of the Yellow River Valley, the Yangtze River Valley and the northwest inland; 4) selecting generation F3 seeds of excellent individual plants and reproducing in the south for increasing the generation; 5) respectively sowing generation F4 seeds in the cotton regions of the Yellow River Valley, the Yangtze River Valley and the northwest inland; and 6) selecting generation F6 seeds of excellent individual plants, sowing the seeds in hybrid seed production fields and selecting excellent individual plants according to breeding purposes. The method provided by the invention complements a modified backcrossing and recurrent selection method and improves the yield, the quality and the insect resistance. The method has the advantages of high breeding efficiency, diversified varieties, high adaptability, high purity and good consistency, and lays a foundation for breeding better varieties in future.

The invention discloses a method for breeding wheat cultivar, comprising the following steps: a. taking a dominant sterility gene Ta1 material as a female parent, and carrying out single cross or multiple cross on a breeding parent material containing required genetic components for combined hybridization to obtain a recurrent selection group CO; b. carrying out mutual hybridization recurrent selection on the descendant of the recurrent selection group CO to obtain a recurrent descendant Cn; and c. breeding the recurrent descendant Cn, building different adverse-situation or non adverse-situation seed selection environments on the same site, and carrying out adverse-situation or non adverse-situation alternate selection and a yield ratio qualification test among generations to cultivate the excellent cultivar of wheat. The wheat cultivar cultivated with the method provided by the invention has the advantages of stress resistance, water saving property, yielding ability and wide adaptability.

The invention relates to a method for carrying out recurrent selection breeding on water-saving and drought-resisting rice by utilizing a dominant nuclear male sterile material. The method comprises the steps of hybridizing by using the dominant nuclear male sterile material as a female parent and the water-saving and drought-resisting rice as a male parent, and backcrossing by five times, thus obtaining a water-saving and drought-resisting rice dominant nuclear male sterile plant; then hybridizing by using the water-saving and drought-resisting rice dominant nuclear male sterile plant as the female parent and 15 to 30 kinds of good parents as the male parent, and equivalently mixing offsprings to form a first round of recurrent selection populations; planting the first round of recurrent selection populations in a dry land, carrying out artificial supplementary pollination during a heading stage, selecting seeds on good sterile plants during a maturing stage, and equivalently mixing the seeds to form a second round of recurrent selection populations; repeating the recurrent selection process; selecting good fertile individual plants from the recurrent selection populations at any time, entering a pedigree method, and breeding a new variety of the water-saving and drought-resisting rice. The method for carrying out the recurrent selection breeding on the water-saving and drought-resisting rice by utilizing the dominant nuclear male sterile material, disclosed by the invention, has the advantages that the dominant nuclear male sterile material is used as a carrier, materials of the water-saving and drought-resisting rice and materials of good rice are in wide hybridization, and the genetic basis of existing water-saving and drought-resisting rice is greatly enriched.

The invention discloses a method for recurrently and selectively breeding non-glutinous rice by using a recessive cytoblast sterile material, which mainly comprises the following steps: hybridizing a sterile strain with recessive cytoblast sterile gene ms-np serving as a female parent and 20 to 30 rice materials serving as male parents, and backcrossing one generation; then, selecting seeds on excellent sterile strains in the later generations, and equivalently mixing the seeds to form a first recurrent selective population; and repeating the recurrent selection process, selecting the excellent fertile strains to a pedigree method at any time, combining molecular marker-assisted selection, and breeding a new variety. The method has the advantages that: recessive cytoblast sterility is used for performing a large amount of hybridization so as to enrich the hereditary basis of the breeding material; new rice materials can be added at any time so as to continually improve the population; moreover, the method avoids manual castration and pollination so as to save a large amount of manpower; and by utilizing a DNA molecular marker for assisting in selection, the method shortens the breeding progress and time, and reduces the breeding cost.

The invention discloses a molecular marker of a male nucleus-sterile gene ms39 in maize, and belongs to the field of auxiliary selection of maize molecular marker. The molecular marker consists of a nucleotide sequence shown in SEQ ID NO.1. The invention also discloses a primer for amplifying the molecular marker. According to the molecular marker disclosed by the invention, interlocking of the molecular marker and the male nucleus-sterile gene ms39 is tight, and an identification result is accurate and reliable, so that a good tool is provided for application of the nucleus-sterile gene ms39in seed breeding; secondly, an identification method of the molecular marker disclosed by the invention is simple, and can be carried out in a seedling period; moreover, a large quantity of hybridization seed breeding requirements required by recurrent selection and the like can be met, the labor cost is reduced, the seed breeding efficiency is improved, and a great promotion effect on a seed quality basis for expanding seed breeding of the maize is achieved.

The invention relates to a method for synchronously improving the parents of hybrid rape, based on present advanced parents and two selected parents to be transferred hidden corn sterility system and dominant sterility system, while the invention uses two sterility systems to process alternative selection that selecting parental sample, building base group, and selecting. The invention can hold the genetic heterogeneity of parents, and collect more useful gene points and alleles in two groups, to improve the advantages of parents. The invention provides a method based on gene heterogeneity molecule check and special match force analysis based on present advanced parents to build two turned selected base groups of parental samples, to improve the selection effect.

The invention relates to wheat male sterility genes WMS and an application of an anther specific promoter thereof. The anther transcriptomes of the wheat near-isogenic line 'Lu wheat 15' and 'Lu wheat 15+Ms2' ('Lu wheat 15Ms2' for short) during the meiosis early period are compared by means of the RNA sequencing technique, and the genes WMS only expressed in 'Lu wheat 15Ms2' anther tissue are found. The full-length cDNA sequence of the WMS genes is shown in SEQ ID NO:1. The amino acid sequence of WMS gene coding protein, namely WMS protein, is shown in SEQ ID NO:2. The WMS gene promoter has the activity of triggering anther tissue specificities, the fertility of the stamen of wheat and slender false brome grass can be changed by manually operating the WMS genes. Therefore, the wheat male sterility genes WMS and the application of the anther specific promoter thereof can be used for realizing anther specificity expression of target genes, establishment of plant male sterility, establishment of a plant recurrent selection system and development of the plant hybrid seed production technique.

The invention discloses a breeding method for a matching line of layer hens with horizontal spotted feather self-separating sexes and local characteristics. Through direct introduction or hybrid seed production, the male line BH01, HS1, HS2 and the female line LH basic group are constructed, and the family breeding method and positive and negative Repeated selection method was used for purebred breeding to improve the meat production performance of the male line and the egg production of the female line; through the determination of the combining ability of growth and development, egg production performance and slaughter performance, the matching combinations BH01×(HS1×LH) and BH01×(HS2×LH) were determined. ), to produce high-quality roosters and local specialty egg hens. According to the breeding method of the local characteristic laying hens with cross-spotted feather self-sexing of the present invention, it is possible to obtain local characteristic laying hens with native chicken body appearance, complete disease purification, suitable market age, and cross-spotted self-sexing; The invention adopts the method of family breeding and positive and negative repeated selection, which can accurately select new strains of laying hens with local characteristics with consistent appearance and stable performance, reaching the domestic leading level.

The process of breeding high oil content rape variety includes the following steps: selecting rape varieties with high oil content, low thioglycoside content, excellent agricultural characteristic and strong disease resistance; hybridization, backcross and recurrent selection to select excellent comprehensive gene and obtain heterozygote; free microspore culturing to obtain great amount of monoploid embryoid; doubling chromosome to obtain inheritable diploid plant with homozygous gene; field agricultural characteristic screening and disease resistance identification; harvesting and seed quality analysis to obtain homozygous diploid line for propagation; and further screening to obtain the new rape variety with very high oil content. The said technology has been used in culturing new rape variety T057-7 with high oil content.

The invention discloses a fresh maize heterosis group step-by-step classification germplasm improvement and breeding technology system. The system comprises the steps of selecting of the high-quality germplasm and coeno-species of a three-group combination recurrent selection initial group, resistance selection, double haploid breeding, DH system testing, combining ability measurement, application of a DH system in breeding, combination of a second recurrent initial group, and the like. The system provided by the invention advocates to widely perform recurrent selection in respects of various pest and disease damage resistance, lodging resistance, quality, yield and the like in a multi-ecological condition, and performing group interchanging and mutual combination to polymerize valuable genes with high quality, high yield, multiple resistances, wide applicability and the like, so that excellent characteristics of a group are accumulated step by step, and the breeding performance is gradually increased.

The invention discloses a molecular marker which is used for corn tripsacum monosome addition line nucleic male sterility genes and belongs to the field of crop molecular markers. The molecular marker is composed of nucleotide sequences shown by SEQ ID No:1. The invention further discloses an SCAR primer pair used for amplifying the molecular marker and composed of SEQ ID No:2 and SEQ ID No:3. In addition, the invention further discloses a method of using the molecular marker for backcross and recurrent selection breeding. The molecular marker is not limited by time and environment conditions, can identify and screen the corn tripsacum monosome addition line nucleic male sterility genes at the seedling stage, selects and weeds out the nucleic male sterility genes easily, saves manpower and material resources in large quantities, improves the breeding efficiency, shortens the breeding process and time, and substantially reduces breeding cost. In addition, the molecular marker can serve as a tool for large-scale recurrent selection for corns and continuously extend the corn heredity basis and is beneficial for selecting out a breakthrough corn variety.

The invention discloses a high-oil routine rape variety recurrent selection method. The method comprises the following steps: 1, classifying materials, and establishing a base recurrent selection colony; 2, selecting a recurrent selection colony; and 3, establishing a high-oil recurrent selection colony, and breeding a high-oil routine variety. A new variety of double-low routine oil rape, with the advantages of high oil content, good yielding ability, strong stress resistance and wide adaptability is cultivated through fusing genes controlling the oil content, the yield and the stress resistance, and a new feasible high-oil routine rape breeding approach is provided.

The invention relates to a method for an electricity meter to realize baud rate adaptive communication. The method comprises the following steps: the step S1 in which an electricity meter which is in communication connection with a plurality of master stations and in the internal program of which a communication protocol and a plurality of different baud rates are set is provided; the step S2 in which a frame call is sent by one of the master stations; the step S3 in which the frame call is received by the electricity meter; the step S4 in which decomposition is performed by the internal program of the electricity meter on the received frame call according to the set communication protocol so as to give a selection instruction; and the step S5 in which recurrent selection is performed by the internal program of the electricity meter among the plurality of baud rates according to the selection instruction given in the step S4, and the communication between the selected baud rate and the master station is tried to be established, when communication can be established between the selected baud rate and the master station, the running of the selection instruction is stopped, and when communication cannot be established between the selected baud rate and the master station, the next baud rate is selected, and then the communication between the next baud rate and the master station is tried to be established until the communication between the selected baud rate and the master station is established. According to the method, the electricity meter intelligentization function can be realized, and the advantage of time saving can be realized.

The invention provides a brassica napus cytoplasmic male sterile restore line population improvement method. The method comprises the following steps: a restore line is taken as a female parent and is hybridized with a plurality of inbred lines, a first filial generation selects a fertile plant as a female parent for backcross and inbred for a generation, restore gene locus homozygous single plants are selected through identification, equivalent seeds are taken from each single plant and mixed to form an S0 population, the S0 population is sown, a chemical inducer is sprayed to the female parent, open pollination is carried out in the population to harvest chemically-induced sterile plant seeds to form a recurrent selection population S1, then recurrent selection is carried out for at least 6 times, and a DH single plant obtained by carrying out field planting and microspore culture on a screened target single plant is a brassica napus cytoplasmic male sterile restore line. According to the method, a chemical induction method is initiatively adopted to acquire a sterile plant, so that the time and the labor are saved, and finally, the genetic basis of the restore line is wide; and more importantly, in the process of applying a chemically-induced sterile plant to carry out recurrent selection, the ratio of restore genes in the recurrent population is stable to be 100 percent.

The invention provides a method for efficiently developing a sorghum sterile line. Seeds of a sorghum maintainer line are mutagenized through EMS with different concentrations, and M0 generation seedsare obtained; as for later generations, individual-plant head progeny rows which accord with breeding objectives and are consistent in character performance are obtained as a new maintainer line through bagging selfing selection; the new maintainer line and the sterile line are pollinated and cross-fertilized, and BC1 generation seeds are obtained; and through recurrent selection of several generations, individual plants with consistent objective character performance of the head progeny rows are selected as a new sterile line.

The invention relates to a recurrent selection method for a dominant germplasm population of hybrid wheat. The recurrent selection method comprises the following steps: respectively carrying out half-sibling ear line phenotype recurrent selection on a CMS sterile line population and an R restoring line population; carrying out clustering analysis of genetic difference and heterotic group on diallel cross F1 combinations and parents thereof, wherein the parents comprise maintainer lines and restoring lines of male sterile lines CMS of wheat cells; carrying out CMS line half-slib recurrent selection by taking CMS sterile lines as female parents and B lines as male parents, selecting excellent sterile lines subjected to recurrent selection, and carrying out double haploid induction to obtainmale sterile DH lines; carrying out R line half-slib recurrent selection by taking dominant genic sterile Tal ear lines as female parents and R lines as male parents, selecting excellent sterile plants subjected to recurrent selection, and carrying out the double haploid induction to obtain fertile DH lines with restoring genes; carrying out test cross on the sterile DH lines and the fertile DH lines, selecting heterosis crosses of the lines according to the test cross result, and cultivating wheat hybrid varieties.

The invention relates to a breeding method for fresh-eating red waxy hybrid maize belonging to the hybrid maize breeding field, comprising the procedures as follows: black pearl waxy corn with perfect plasmid and modena grain chosen as male parent and Darfur waxy corn with perfect plasmid and silvery white grain chosen as female parent are hybridized to establish an underlying group; recurrent selection is carried through in the underlying group in the aspects of red grain, waxy property, sweet taste, single plant production capacity, the ability of anti tan disease and lodging resistance, and repeated anisotropic hybridization and self-pollination are carried through to establish a hybridization group; the self-fertilization of parent strain and retrogression choiceness of the hybridization group are completed, vermeil hard grain is produced after 4-6 generations. The breeding method of the invention can breed the fresh-eating and eatable red waxy corn with high officinal value, good mouthfeel, high contents of natural haematochrome and rich nutrition which can be used in industry and as feed and has the advantages of strong ability to resist disease, drought resistance, flood resistance, high yield and fertility.

The invention relates to a crop genetic breeding method for high-efficient utilization of heterosis. Utilization of heterosis currently is that breeding of hybrid parents and extensive testcross are mainly used; reciprocal recurrent selection is also applied to hybrid breeding of crops, in particular corns, recently; with the development of a high-throughput labelling technology, whole genome selection is rapidly applied in crop heterosis utilization; effective prediction on complex quantitative traits is realized by utilization of a molecular marker covering the whole genome; but, genomic selection and reciprocal recurrent selection are not applied to crop genetic breeding at the same time currently. The invention provides that a genomic selection method and a reciprocal recurrent selection technology are applied to crop heterosis utilization at the same time, so that a heterosis utilization method, which is high-efficiency to select, easy to implement and low in material cost and manpower use cost, is provided; furthermore, the invention innovatively provides that a genomic selection technology is applied to selection of basic parents of reciprocal recurrent selection population;simultaneously, the breeding efficiency is increased by utilization of a chemical emasculation technology; and thus, the breeding accuracy and high efficiency are greatly increased.

The invention relates to the technical field of rice breeding, in particular to a DNA sequence capable of regulating and controlling the fertility of rice and an application thereof. The combination of a male sterile rice mitochondrial specific open reading frame and a mitochondrial leading peptide converts rice varieties and leads to sterility of a product without pollen nucleus. The method can quickly and efficiently obtain dominant genic male sterile materials of different rice varieties according to a transgenic method, and the sterile materials have pollen-free type abortion, are stable in sterility, and are not affected by temperature and environment. The DNA sequence provided by the invention can be widely used in rice genetic breeding, especially in directionally created pollen-free dominant genic male sterile materials, and can be widely used in dominant genic male sterile recurrent selection breeding.

The invention discloses a breeding method for repairing and improving a natural doubling rate of maize haploid male flower by utilizing recurrent selection, belonging to the field of maize breeding methods. The breeding method disclosed by the invention comprises the following steps: constructing an excellent base population, then generating a haploid by utilizing an inducing line, and carrying out doubling so as to obtain a double haploid (DH) line; and selecting a double haploid (DH) line hybridization group with complementary characters and strong pollinating ability so as to form a new round of a population, and carrying out recurrent selection so as to continuously improve the natural doubling rate of the haploid male flower. The method provided by the invention can significantly improve the natural doubling rate of the maize haploid male flower, wherein the natural doubling rate of the fourth round can maximally reach to 90% or above; moreover, the method provided by the invention overcomes the technical bottleneck of haploid breeding, and can increase the breeding efficiency of the double haploid (DH) line by a hundred times or above compared with the prior art; the method provided by the invention also has the advantages of no toxicity, rapidness, high efficiency, environmental protection, etc., and completely gets rid of a conventional highly-toxic, complicated and inefficient artificial doubling method; in addition, the excellent double haploid (DH) line selected from every round in the method provided by the invention can directly enter a commercial breeding procedure.

This is the coding sequence of degradable protein which can control rice tapetum. This invention belongs to the gene engineering field. The extracted DNA molecule includes: nucleotide sequence that it's coding has the peptides with the rice OsTDR protein activity. The above sequence has the peptides which with the amino acid sequence indicated by the SEQ ID NO. 2, as well as the Nucleotide sequence of 1-1659 of nucleotide indicated by the SEQ ID NO.1. By the degradable protein which can control rice tapetum, what can be filtered through the normal filtration is the substance that interactioned with degradable protein which control rice tapetum or receptor, inhibitor or anatognist etc. This invention can obviously control the degradation of rice tapetum, produce new male sterile rice sterile line, generate hiberdization seeds, perform recurrent selection and create gene pool, so it is very important in agriculture.