The invention discloses a
molecular marker of sesame dominant genic male
sterility gene and a preparation method and application thereof. A
forward primer sequence of the marker GB50 is ATGGGTTTATGGCAGGCT, and a
reverse primer sequence is GGACTACTCCTCCTCCCCA; a
forward primer sequence of SBM298 is CCCCTTTTCACTTACGTACAGCAG, and a
reverse primer sequence is CTCTTCCTCCACCATCTCCTCTTC. The preparation method comprises the steps of: A, respectively
numbering dominant genic male
sterility brother-sister
inbreeding segregation
population in the
seedling stage, collecting tender leaves from each individual
plant, treating by
liquid nitrogen and storing in a refrigerator for standby; B, conducting
biosynthesis by using EST-SSR primers of SBM series; C, amplifying by a PCR procedure; D, conducting PCR amplification and product detection; E, acquiring a polymorphism marker; and F, acquiring a
molecular marker associated with male
sterility. The method can obtain 100% male sterility
population, significantly improve the efficiency of sesame
recurrent selection, and avoid the trouble of eradication of 50% fertile plants until the flowering phase by using morphological characteristics. The invention has obvious effect, low cost, no
pollution and very broad application prospects.