Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

84 results about "Recurrent selection" patented technology

Recurrent selection :- Method which involves reselection generation after generation with interbreeding of selects to provide for genetic recombination. Thus it is a cyclic selection that is used to improve the frequency of desirable alleles for a character in a breeding population.

Method for producing breed of black-shin dorking

The invention provides a method for producing breed of a black-skin dorking, which comprises the following steps: (1) building a line taking a Tianfu black-bone chicken with black feathers and black skin as a maternal line, adopting a family method of breeding to perform pure line breeding to obtain a Tianfu balck-bone chicken with black skin; (2) conducting hybridization and backcross by taking a white plymouth rock as a male parent and taking the Tianfu black-bone chicken with black skin a female parent to obtain a group containing more than 75% of Tianfu black-bone chicken (B1 line); (3) conducting hybridization and backcross by taking the Tianfu black-bone chicken with black skin as a male parent and taking a Sichuan mountain black-bone chicken with back feathers and black skin as a female parent and introducing 25% of Sichuan mountain black-bone chicken into the Tianfu black-bone chickens (B2 line); and (4) performing hybridization by taking the B1 line as a male parent and taking the B2 line as a female parent, carrying out crossing fixation, closing and breeding, and adopting the family method of breeding and a positive and negative recurrent selection method to perform the pure line breeding to obtain a new black-skin dorking line. The new line has the advantages of unified appearance, black (dark) carcass skin, high production performance and good mouthfeel, flavor and nourishing effect.
Owner:SICHUAN AGRI UNIV

Breeding method for black and white sweet glutinous hybrid maize

The invention discloses a breeding method for black and white sweet glutinous hybrid maize. The breeding method for black and white sweet glutinous hybrid maize comprises the steps of selecting ultra-sweet maize, glutinous maize, a common high yield multi-resistance maize-inbred line and the like from different regions to be equivalently mixed, openly pollinating the maize, establishing a basic group A, selecting black glutinous maize germplasm from different regions to be equivalently mixed, openly pollinating the maize, and establishing a basic group B; then carrying out recurrent selection to the properties of seeds of the maize to respectively form a white sweet glutinous maize recurrent selection group A and a black sweet glutinous maize recurrent selection group B, obtaining a serious inbred line through multi-generation inbreeding, and screening a white sweet glutinous maize inbred line 4587 and a black sweet glutinous maize inbred line 3303 through combination ability measurement and cross combination quality identification to obtain 4587 X black 3303 hybrid. The breeding method can ensure both the glutinous and sweet genes of a parent inbred line and the hybrid of the parent inbred line, and also ensure the appearance quality, the favorable edible quality, the stability and the consistency of the hybrid. Moreover, the seeds of the maize are black and white.
Owner:NANJING AGRICULTURAL UNIVERSITY

Synthetic method of original colony for corn breeding for reciprocal recurrent selection

The invention discloses a synthetic method of an original colony for corn breeding for reciprocal recurrent selection, belonging to the technical field of corn breeding, which solves the problem that existing gene linkage degree is high and germplasm resources are relatively narrow. The method comprises the following steps: first, selecting a plurality of selfing line materials with relatively wide hereditary basis and high common combining ability in a same class group; carrying out variance analysis and F index inspect among combining abilities of the materials based on an NCII mating designed test of an AMMI (Additive Main effects and Multiplicative Interaction) model to analyze hereditary effects; assembling incomplete diallel cross combination by using the materials; and assembling a top cross specie according to the non-overlapping principle of germplasm complementation, and after equivalently and uniformly mixing seeds of the top cross, continuously and fully mixing pollen twice to pollinate, wherein the seed obtained by the manner is the original colony for corn breeding. The synthetic method disclosed by the invention can break linkage in the same group to create variation, thereby providing an abundant material basis for recurrent selection and selfing line breeding.
Owner:MAIZE RES INST SHANDONG ACAD OF AGRI SCI

Dwarf male-sterile rice cultivation method and DNA (Deoxyribonucleic Acid) used thereby

The invention discloses a cultivation method for obtaining rice plants, which simultaneously show male-sterile and dwarf properties, through genetic engineering. Dwarf male-sterile rice with simultaneous incomplete expression of male-fertile genes and plant height genes is cultivated with an RNAi (Ribonucleic Acid interfere) technology by using a GA20-oxidase gene (OsGA20o*2), which has an effect of stretching rice stems and is used for gibberellin synthesis, and an RTS (Ricetapetum-Specific) gene which plays a key role in development of rice anther tapetum; the male-sterile and dwarf properties of the dwarf male-sterile rice simultaneously occur; and the rice can be normally fertilized to bear fruits after receiving wild type plant pollen. The dwarf male-sterile rice can be widely applied to rice recurrent selection breeding and has great significances to rice genetic breeding and production.
Owner:INST OF CROP SCI CHINESE ACAD OF AGRI SCI +1

Molecular marker of sesame dominant genic male sterility gene and preparation method and application thereof

InactiveCN103993011ADoes not change genetic structureHigh number of tagsMicrobiological testing/measurementDNA/RNA fragmentationForward primerAgricultural science
The invention discloses a molecular marker of sesame dominant genic male sterility gene and a preparation method and application thereof. A forward primer sequence of the marker GB50 is ATGGGTTTATGGCAGGCT, and a reverse primer sequence is GGACTACTCCTCCTCCCCA; a forward primer sequence of SBM298 is CCCCTTTTCACTTACGTACAGCAG, and a reverse primer sequence is CTCTTCCTCCACCATCTCCTCTTC. The preparation method comprises the steps of: A, respectively numbering dominant genic male sterility brother-sister inbreeding segregation population in the seedling stage, collecting tender leaves from each individual plant, treating by liquid nitrogen and storing in a refrigerator for standby; B, conducting biosynthesis by using EST-SSR primers of SBM series; C, amplifying by a PCR procedure; D, conducting PCR amplification and product detection; E, acquiring a polymorphism marker; and F, acquiring a molecular marker associated with male sterility. The method can obtain 100% male sterility population, significantly improve the efficiency of sesame recurrent selection, and avoid the trouble of eradication of 50% fertile plants until the flowering phase by using morphological characteristics. The invention has obvious effect, low cost, no pollution and very broad application prospects.
Owner:INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI

Multi-ecological-area recurrent mixed selection - mixed planting cotton breeding method

The invention relates to the field of breeding and specifically relates to a multi-ecological-area recurrent mixed selection - mixed planting cotton breeding method, which comprises the following steps of: 1) preparing cotton hybridized combinations; 2) reproducing generation F1 hybrid seeds in the south for increasing the generation; 3) respectively sowing generation F2 seeds in cotton regions of the Yellow River Valley, the Yangtze River Valley and the northwest inland; 4) selecting generation F3 seeds of excellent individual plants and reproducing in the south for increasing the generation; 5) respectively sowing generation F4 seeds in the cotton regions of the Yellow River Valley, the Yangtze River Valley and the northwest inland; and 6) selecting generation F6 seeds of excellent individual plants, sowing the seeds in hybrid seed production fields and selecting excellent individual plants according to breeding purposes. The method provided by the invention complements a modified backcrossing and recurrent selection method and improves the yield, the quality and the insect resistance. The method has the advantages of high breeding efficiency, diversified varieties, high adaptability, high purity and good consistency, and lays a foundation for breeding better varieties in future.
Owner:INST OF COTTON RES CHINESE ACAD OF AGRI SCI

Method for carrying out recurrent selection breeding on water-saving and drought-resisting rice by utilizing dominant nuclear male sterile material

The invention relates to a method for carrying out recurrent selection breeding on water-saving and drought-resisting rice by utilizing a dominant nuclear male sterile material. The method comprises the steps of hybridizing by using the dominant nuclear male sterile material as a female parent and the water-saving and drought-resisting rice as a male parent, and backcrossing by five times, thus obtaining a water-saving and drought-resisting rice dominant nuclear male sterile plant; then hybridizing by using the water-saving and drought-resisting rice dominant nuclear male sterile plant as the female parent and 15 to 30 kinds of good parents as the male parent, and equivalently mixing offsprings to form a first round of recurrent selection populations; planting the first round of recurrent selection populations in a dry land, carrying out artificial supplementary pollination during a heading stage, selecting seeds on good sterile plants during a maturing stage, and equivalently mixing the seeds to form a second round of recurrent selection populations; repeating the recurrent selection process; selecting good fertile individual plants from the recurrent selection populations at any time, entering a pedigree method, and breeding a new variety of the water-saving and drought-resisting rice. The method for carrying out the recurrent selection breeding on the water-saving and drought-resisting rice by utilizing the dominant nuclear male sterile material, disclosed by the invention, has the advantages that the dominant nuclear male sterile material is used as a carrier, materials of the water-saving and drought-resisting rice and materials of good rice are in wide hybridization, and the genetic basis of existing water-saving and drought-resisting rice is greatly enriched.
Owner:SHANGHAI AGROBIOLOGICAL GENE CENT

Method for recurrently and selectively breeding non-glutinous rice by using recessive cytoblast sterile material

The invention discloses a method for recurrently and selectively breeding non-glutinous rice by using a recessive cytoblast sterile material, which mainly comprises the following steps: hybridizing a sterile strain with recessive cytoblast sterile gene ms-np serving as a female parent and 20 to 30 rice materials serving as male parents, and backcrossing one generation; then, selecting seeds on excellent sterile strains in the later generations, and equivalently mixing the seeds to form a first recurrent selective population; and repeating the recurrent selection process, selecting the excellent fertile strains to a pedigree method at any time, combining molecular marker-assisted selection, and breeding a new variety. The method has the advantages that: recessive cytoblast sterility is used for performing a large amount of hybridization so as to enrich the hereditary basis of the breeding material; new rice materials can be added at any time so as to continually improve the population; moreover, the method avoids manual castration and pollination so as to save a large amount of manpower; and by utilizing a DNA molecular marker for assisting in selection, the method shortens the breeding progress and time, and reduces the breeding cost.
Owner:SICHUAN AGRI UNIV

Breeding method of complete set line of local characteristic laying hens capable of realizing autosexing based on barred feather

InactiveCN106135132ADisease cleansed completelyExcellent productivityAnimal husbandryDiseaseRecurrent selection
The invention discloses a breeding method for a matching line of layer hens with horizontal spotted feather self-separating sexes and local characteristics. Through direct introduction or hybrid seed production, the male line BH01, HS1, HS2 and the female line LH basic group are constructed, and the family breeding method and positive and negative Repeated selection method was used for purebred breeding to improve the meat production performance of the male line and the egg production of the female line; through the determination of the combining ability of growth and development, egg production performance and slaughter performance, the matching combinations BH01×(HS1×LH) and BH01×(HS2×LH) were determined. ), to produce high-quality roosters and local specialty egg hens. According to the breeding method of the local characteristic laying hens with cross-spotted feather self-sexing of the present invention, it is possible to obtain local characteristic laying hens with native chicken body appearance, complete disease purification, suitable market age, and cross-spotted self-sexing; The invention adopts the method of family breeding and positive and negative repeated selection, which can accurately select new strains of laying hens with local characteristics with consistent appearance and stable performance, reaching the domestic leading level.
Owner:SICHUAN AGRI UNIV

Method for breeding high oil rape variety by polymerising and sporidiole cultivating technology

The process of breeding high oil content rape variety includes the following steps: selecting rape varieties with high oil content, low thioglycoside content, excellent agricultural characteristic and strong disease resistance; hybridization, backcross and recurrent selection to select excellent comprehensive gene and obtain heterozygote; free microspore culturing to obtain great amount of monoploid embryoid; doubling chromosome to obtain inheritable diploid plant with homozygous gene; field agricultural characteristic screening and disease resistance identification; harvesting and seed quality analysis to obtain homozygous diploid line for propagation; and further screening to obtain the new rape variety with very high oil content. The said technology has been used in culturing new rape variety T057-7 with high oil content.
Owner:河南省农业科学院棉花油料作物研究所

Method for electricity meter to realize baud rate adaptive communication

The invention relates to a method for an electricity meter to realize baud rate adaptive communication. The method comprises the following steps: the step S1 in which an electricity meter which is in communication connection with a plurality of master stations and in the internal program of which a communication protocol and a plurality of different baud rates are set is provided; the step S2 in which a frame call is sent by one of the master stations; the step S3 in which the frame call is received by the electricity meter; the step S4 in which decomposition is performed by the internal program of the electricity meter on the received frame call according to the set communication protocol so as to give a selection instruction; and the step S5 in which recurrent selection is performed by the internal program of the electricity meter among the plurality of baud rates according to the selection instruction given in the step S4, and the communication between the selected baud rate and the master station is tried to be established, when communication can be established between the selected baud rate and the master station, the running of the selection instruction is stopped, and when communication cannot be established between the selected baud rate and the master station, the next baud rate is selected, and then the communication between the next baud rate and the master station is tried to be established until the communication between the selected baud rate and the master station is established. According to the method, the electricity meter intelligentization function can be realized, and the advantage of time saving can be realized.
Owner:SUZHOU IND PRAK NEW HONGBO COMM TECH

Brassica napus cytoplasmic male sterile restore line population improvement method

The invention provides a brassica napus cytoplasmic male sterile restore line population improvement method. The method comprises the following steps: a restore line is taken as a female parent and is hybridized with a plurality of inbred lines, a first filial generation selects a fertile plant as a female parent for backcross and inbred for a generation, restore gene locus homozygous single plants are selected through identification, equivalent seeds are taken from each single plant and mixed to form an S0 population, the S0 population is sown, a chemical inducer is sprayed to the female parent, open pollination is carried out in the population to harvest chemically-induced sterile plant seeds to form a recurrent selection population S1, then recurrent selection is carried out for at least 6 times, and a DH single plant obtained by carrying out field planting and microspore culture on a screened target single plant is a brassica napus cytoplasmic male sterile restore line. According to the method, a chemical induction method is initiatively adopted to acquire a sterile plant, so that the time and the labor are saved, and finally, the genetic basis of the restore line is wide; and more importantly, in the process of applying a chemically-induced sterile plant to carry out recurrent selection, the ratio of restore genes in the recurrent population is stable to be 100 percent.
Owner:江西省农业科学院作物研究所

Recurrent selection method for dominant germplasm population of hybrid wheat

The invention relates to a recurrent selection method for a dominant germplasm population of hybrid wheat. The recurrent selection method comprises the following steps: respectively carrying out half-sibling ear line phenotype recurrent selection on a CMS sterile line population and an R restoring line population; carrying out clustering analysis of genetic difference and heterotic group on diallel cross F1 combinations and parents thereof, wherein the parents comprise maintainer lines and restoring lines of male sterile lines CMS of wheat cells; carrying out CMS line half-slib recurrent selection by taking CMS sterile lines as female parents and B lines as male parents, selecting excellent sterile lines subjected to recurrent selection, and carrying out double haploid induction to obtainmale sterile DH lines; carrying out R line half-slib recurrent selection by taking dominant genic sterile Tal ear lines as female parents and R lines as male parents, selecting excellent sterile plants subjected to recurrent selection, and carrying out the double haploid induction to obtain fertile DH lines with restoring genes; carrying out test cross on the sterile DH lines and the fertile DH lines, selecting heterosis crosses of the lines according to the test cross result, and cultivating wheat hybrid varieties.
Owner:XINJIANG ACADEMY OF AGRI & RECLAMATION SCI

Crop genetic breeding method for high-efficient utilization of heterosis

The invention relates to a crop genetic breeding method for high-efficient utilization of heterosis. Utilization of heterosis currently is that breeding of hybrid parents and extensive testcross are mainly used; reciprocal recurrent selection is also applied to hybrid breeding of crops, in particular corns, recently; with the development of a high-throughput labelling technology, whole genome selection is rapidly applied in crop heterosis utilization; effective prediction on complex quantitative traits is realized by utilization of a molecular marker covering the whole genome; but, genomic selection and reciprocal recurrent selection are not applied to crop genetic breeding at the same time currently. The invention provides that a genomic selection method and a reciprocal recurrent selection technology are applied to crop heterosis utilization at the same time, so that a heterosis utilization method, which is high-efficiency to select, easy to implement and low in material cost and manpower use cost, is provided; furthermore, the invention innovatively provides that a genomic selection technology is applied to selection of basic parents of reciprocal recurrent selection population;simultaneously, the breeding efficiency is increased by utilization of a chemical emasculation technology; and thus, the breeding accuracy and high efficiency are greatly increased.
Owner:江西省农业科学院作物研究所

Breeding method for repairing and improving natural doubling rate of maize haploid male flower by utilizing recurrent selection

The invention discloses a breeding method for repairing and improving a natural doubling rate of maize haploid male flower by utilizing recurrent selection, belonging to the field of maize breeding methods. The breeding method disclosed by the invention comprises the following steps: constructing an excellent base population, then generating a haploid by utilizing an inducing line, and carrying out doubling so as to obtain a double haploid (DH) line; and selecting a double haploid (DH) line hybridization group with complementary characters and strong pollinating ability so as to form a new round of a population, and carrying out recurrent selection so as to continuously improve the natural doubling rate of the haploid male flower. The method provided by the invention can significantly improve the natural doubling rate of the maize haploid male flower, wherein the natural doubling rate of the fourth round can maximally reach to 90% or above; moreover, the method provided by the invention overcomes the technical bottleneck of haploid breeding, and can increase the breeding efficiency of the double haploid (DH) line by a hundred times or above compared with the prior art; the method provided by the invention also has the advantages of no toxicity, rapidness, high efficiency, environmental protection, etc., and completely gets rid of a conventional highly-toxic, complicated and inefficient artificial doubling method; in addition, the excellent double haploid (DH) line selected from every round in the method provided by the invention can directly enter a commercial breeding procedure.
Owner:JILIN ACAD OF AGRI SCI +1
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products