BCR-ABL1 fusion gene quantitative genomic RNA standard material and its preparation method

By preparing quantitative genomic RNA standard material for the BCR-ABL1 fusion gene and employing reverse transcription digital PCR, the problems of detection accuracy and traceability in existing technologies have been solved, achieving high-precision and high-accuracy detection of the BCR-ABL1 fusion gene and meeting the diagnostic and prognostic needs of CML patients.

CN116334180BActive Publication Date: 2026-03-10NATIONAL INSTITUTE OF METROLOGY CHINA +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211387155.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-07
Publication Date
2026-03-10
Estimated Expiration
2042-11-07

AI Technical Summary

Technical Problem

Existing technologies lack a highly accurate and traceable quantitative detection method for the BCR-ABL1 fusion gene, leading to significant differences in laboratory procedures and frequent false negatives and false positives, making it difficult to meet the needs of accurate diagnosis and prognosis assessment for CML patients.

Method used

A quantitative genomic RNA standard for the BCR-ABL1 fusion gene was prepared by extracting genomic RNA from cell lines containing the BCR-ABL1 P210 mutation, performing PCR amplification using a reverse transcription kit, designing specific primers and probes, and quantifying using a one-step reverse transcription digital PCR method. Absolute quantification was achieved by combining yeast RNA dilution and balance weighing methods to prepare the solution.

Benefits of technology

It improves the accuracy and traceability of BCR-ABL1 fusion gene detection, ensures the reliability and repeatability of measurement results, is suitable for laboratory quality control and reagent validation, and meets the precision and accuracy requirements of CML detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116334180B_ABST
    Figure CN116334180B_ABST
Patent Text Reader

Abstract

This invention discloses a quantitative genomic RNA standard for the BCR-ABL1 fusion gene and its preparation method. The method involves extracting genomic RNA containing two mutant forms of the BCR-ABL1P210 fusion gene, b2a2 and b3a2. RNA storage buffer and quantitative standard solutions are prepared, and corresponding primers and probes are designed. A one-step reverse transcription digital PCR method is used, with the BCR-ABL1P210 fusion mutant genomic RNA as a template for PCR amplification. Fluorescence signals are collected to detect the expression of the BCR-ABL1P210 fusion genes b2a2 and b3a2, thereby obtaining the copy number content of the BCR-ABL1P210 fusion genes b2a2 and b3a2 and the abundance of the mutant gene in ABL-WT as quantitative values.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and in particular to a quantitative genomic RNA standard material for the BCR-ABL1 fusion gene and its preparation method. Background Technology

[0002] The BCR-ABL1 fusion gene is formed by a balanced reciprocal translocation between the abselson murine leukemia viral oncogene homolog 1 (ABL1) on the long arm of chromosome 9 (9q34) and the break point cluster region (BCR) gene on the long arm of chromosome 22 (22q11), making it a typical Philadelphia chromosome. Studies have found that chromosomal abnormalities carrying the BCR-ABL1 fusion gene are a key factor in chronic myeloid leukemia (CML), and approximately 95% of CML patients have the BCR-ABL1 fusion gene of type P210. Therefore, the BCR-ABL1 P210 fusion gene has become an important indicator for diagnosing CML, and its dynamic changes in transcription level have become a reliable indicator for leukemia prognosis, laying the foundation for leukemia prognosis and prediction.

[0003] In recent years, my country has been gradually establishing and improving its technical methods for detecting leukemia-specific fusion genes. Currently, methods for detecting BCR-ABL1 include immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), PCR-based methods, and next-generation sequencing (NGS).

[0004] Among existing technologies, real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) for molecular monitoring of BCR-ABL1 has become an essential means of assessing patient response, monitoring minimal residual disease (MRD), and detecting relapse. However, the RT-qPCR procedure, from sample collection to internal control selection and result reporting, varies greatly between different laboratories, lacking reproducibility. Furthermore, quality issues with some BCR-ABL1 quantitative PCR reagents are also a significant cause of false negatives and false positives.

[0005] CN108265117A discloses a candidate reference material for the BCR-ABL1 fusion gene e14a2 subtype plasmid, its preparation method, and its applications. This technical solution involves designing primers and constructing a recombinant plasmid candidate reference material containing the BCR-ABL1 fusion gene e14a2 subtype using molecular cloning technology. After verification by enzyme digestion, electrophoresis, and sequencing, homogeneity and stability are evaluated using real-time quantitative PCR, and measurement uncertainty is assessed. While this method provides a candidate reference material for the BCR-ABL1 fusion gene e14a2 subtype plasmid, it cannot be used to quantify the b2a2 and b3a2 subtypes of P210. Furthermore, the plasmid is in DNA form, which differs significantly in size from the genome and cannot participate in the reverse transcription step. Additionally, its quantification method is real-time quantitative PCR, similar to conventional detection methods, lacking high-level traceability. Therefore, it has significant limitations for the quantitative detection and traceability of the BCR-ABL1 fusion gene.

[0006] Therefore, there is an urgent need to develop a highly accurate and traceable quantitative genomic RNA standard for the BCR-ABL1 fusion gene, which can be used to test the sensitivity and accuracy of various analytical methods, validate and evaluate related reagents, and control laboratory quality. Summary of the Invention

[0007] The purpose of this invention is to provide a quantitative genomic RNA standard material for the BCR-ABL1 fusion gene and its preparation method.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] A method for preparing a quantitative genomic RNA standard substance for the BCR-ABL1 fusion gene includes the following steps:

[0010] (1) Extract genomic RNA from cell lines containing the BCR-ABL1 P210 mutation and detect its concentration and purity;

[0011] (2) Using the genomic RNA of the BCR-ABL1 P210 mutant cell line as a template, the gene fragment with the target fusion mutation was obtained by reverse transcription kit and PCR amplification, and the correctness of the target gene sequence was verified by Sanger sequencing PCR products.

[0012] (3) Add a certain amount of yeast RNA solution to the RNA solution to prepare an RNA storage buffer;

[0013] (4) Add the genomic RNA of the cell line to the RNA storage buffer and dilute it into a standard solution of a certain concentration;

[0014] (5) Design and obtain specific primers 1 and 2 and specific probe 1 for the BCR-ABL1 P210 fusion gene b2a2. The nucleotide sequences of primers 1 and 2 are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively, and the nucleotide sequence of probe 1 is shown in SEQ ID No. 3.

[0015] Specific primers 3 and 4 for the BCR-ABL1 P210 fusion gene b3a2 and a specific probe 2 were designed and obtained; the nucleotide sequences of primers 3 and 4 are shown in SEQ ID No. 4 and SEQ ID No. 5, and the nucleotide sequence of probe 2 is shown in SEQ ID No. 6.

[0016] ABL-WT gene-specific primers 5 and 6 and a specific probe 3 were designed and obtained; the nucleotide sequences of primers 5 and 6 are shown in SEQ ID No. 7 and SEQ ID No. 8, and the nucleotide sequence of probe 3 is shown in SEQ ID No. 9.

[0017] (6) A one-step reverse transcription digital PCR method was used to perform PCR amplification with the BCR-ABL1 P210 fusion mutant genomic RNA as a template. Fluorescent signals were collected to detect the expression of BCR-ABL1 P210 fusion genes b2a2 and b3a2, thereby obtaining the copy number content of BCR-ABL1 P210 fusion genes b2a2 and b3a2 and the abundance of mutant genes in ABL-WT as their quantitative values.

[0018] Furthermore, in steps (3) and (4), when preparing RNA storage buffer solutions and standard solutions of a certain concentration, a balance is used for weighing, dilution and mixing.

[0019] Furthermore, in step (3), the concentration of yeast RNA is 5-500 ng / μL.

[0020] Furthermore, in step (5), the 5' end of probe 1, probe 2 and probe 3 is labeled with the FAM fluorescent group, and the 3' end is labeled with the BHQ1 fluorescent group.

[0021] Furthermore, in step (5), the reaction concentration of primer 1 and primer 2 is 500 nM, the reaction concentration of probe 1 is 400 nM; the reaction concentration of primer 3 and primer 4 is 400 nM, the reaction concentration of probe 2 is 300 nM; the reaction concentration of primer 5 and primer 6 is 500 nM, and the reaction concentration of probe 3 is 400 nM.

[0022] Furthermore, the one-step reverse transcription digital PCR method comprises the following reaction system: genomic DNA: 0–100 ng, 2×One-step SuperMix (Bio-Rad) 5 μL, reverse transcriptase 2 μL, 300 mM DTT 1 μL, primers 1 and 2: 1.0 μL, probe 1: 0.8 μL; or primers 3 and 4: 0.8 μL, probe 2: 0.6 μL; or primers 5 and 6: 1.0 μL, probe 3: 0.8 μL.

[0023] Furthermore, the PCR reaction conditions were as follows: reverse transcription at 45℃ for 60 min, denaturation at 95℃ for 10 min; followed by denaturation at 94℃ for 30 sec, annealing at 58℃ / 60℃ for 60 sec, for 40 cycles; finally, extension at 98℃ for 10 min, and storage at 4℃.

[0024] Furthermore, the formula for calculating the abundance of the mutant gene is as follows:

[0025]

[0026] Furthermore, the cell line is the K562 cell line.

[0027] The BCR-ABL1 fusion gene quantitative genomic RNA standard material was prepared using the preparation method described above in this invention.

[0028] Compared with the prior art, the outstanding effect of the present invention is as follows:

[0029] (1) The BCR-ABL1 fusion gene quantitative genomic RNA standard material obtained by the method of the present invention has high accuracy and the determination method has good precision and high accuracy, which ensures the reliability and traceability of the measurement results.

[0030] (2) The method of the present invention extracts genomic RNA containing two mutant forms of the BCR-ABL1 P210 fusion gene b2a2 and b3a2 respectively. The RNA storage buffer and quantitative standard solution are prepared by weighing yeast RNA and RNA solution using a balance method.

[0031] (3) The one-step reverse transcription digital PCR method established by the present invention has good precision and high accuracy, and does not depend on the standard curve and CT value. It can directly calculate absolute quantification based on the Poisson distribution. This traceability approach has been approved by the Nucleic Acid Analysis Working Group (NAWG) of the International Committee on Quality of Materials (CCQM), thus ensuring the reliability and traceability of the measurement results.

[0032] (4) The BCR-ABL1 fusion gene quantitative genomic RNA standard of the present invention can be used as a quantitative standard. The BCR-ABL1 fusion gene detection quantitative standard of the present invention includes two common mutation forms, b2a2 and b3a2, and can be used for the development of BCR-ABL1 fusion gene detection methods, the validation and evaluation of related reagents, and laboratory quality control.

[0033] The following description, in conjunction with the accompanying drawings and specific embodiments, further illustrates the quantitative genomic RNA standard material of the BCR-ABL1 fusion gene and its preparation method described in this invention. Attached Figure Description

[0034] Figure 1 Results of quantitative genomic RNA standard material microarray electrophoresis for BCR-ABL1 fusion gene detection.

[0035] Figure 2 Quantitative genomic RNA standard material sequencing results for BCR-ABL1 fusion gene detection.

[0036] Figure 3 Optimization of annealing temperature for digital PCR reaction of genomic RNA standard material for BCR-ABL1 fusion gene detection.

[0037] Figure 4 Optimization of digital PCR reaction system for quantitative genomic RNA standard material for BCR-ABL1 fusion gene detection.

[0038] Figure 5 Results of the stability of the copy number concentration of the genomic RNA standard b2a2 for the detection of the BCR-ABL1 fusion gene.

[0039] Figure 6 Results of the stability of the copy number concentration of the genomic RNA standard b3a2 for the detection of the BCR-ABL1 fusion gene.

[0040] Figure 7 Results of the stability of the copy number concentration of the genomic RNA standard ABL1-WT for the detection and quantification of the BCR-ABL1 fusion gene.

[0041] Figure 8 Results of the abundance and stability of the b2a2 mutant gene, a genomic RNA standard, for the detection of the BCR-ABL1 fusion gene.

[0042] Figure 9 Results of the abundance and stability of the b3a2 mutant gene, a genomic RNA standard, for the detection of the BCR-ABL1 fusion gene. Detailed Implementation

[0043] I. The purity and concentration of the extracted cell line genomic RNA were confirmed.

[0044] Using German Qiagen The Mini Kit was used to extract and purify genomic RNA from a large-scale cultured K562 cell line containing the BCR-ABL1 P210 mutation, yielding candidate BCR-ABL1 genomic RNA standard materials. The specific steps are as follows:

[0045] 1. For suspended cells, the cell density reaches 10. 7 Cells / mL, transferred to centrifuge tubes and centrifuged at 300×g for 5 min, carefully aspirating all supernatant; for adherent cells, after the cells have completely spread, digest and count (cell density reaches 102). 7 (cells / mL), transfer to a centrifuge tube and centrifuge at 300×g for 5 min, then carefully aspirate all supernatant.

[0046] 2. Add 600 μL of Buffer RLT to lyse the cells, then vortex or pipette to mix thoroughly.

[0047] 3. Add an equal amount of 70% ethanol to the cell lysis buffer and mix thoroughly.

[0048] 4. Add 700 μL of cell lysis buffer to the RNeasy spin column, centrifuge at ≥8000×g (≥10000rpm) for 15s, and discard the waste liquid.

[0049] 5. Repeat the previous step with the remaining solution.

[0050] 6. Add 700 μL of Buffer RW1 to the RNeasy spin column, centrifuge at ≥8000×g (≥10000rpm) for 15s, and discard the waste liquid.

[0051] 7. Add 500 μL of Buffer RPE to the RNeasy spin column. Gently cap the column and centrifuge at ≥8000×g (≥10000rpm) for 2 min. Discard the waste liquid.

[0052] 8. Place the RNeasy spin column into a new 2mL collection tube, discarding the old collection tube along with the waste liquid. Gently cap the tube and centrifuge at full speed for 1 minute.

[0053] 9. Place the RNeasy spin column into a new 1.5 mL collection tube and add 30-50 μL of enzyme-free water to the column. Gently cap the tube and centrifuge at ≥8000×g (≥10000 rpm) for 1 min.

[0054] 10. To increase RNA yield, repeat the elution with the elution buffer (enzyme-free water) from step 9 to obtain a higher concentration of RNA.

[0055] 11. Collect high-concentration RNA solutions.

[0056] The purity and concentration of the genomic RNA obtained above were determined, with five repeated measurements. The results are shown in Table 1. Simultaneously, its integrity was assessed using microfluidic chip electrophoresis; the results from the Agilent 2100 are as follows. Figure 1 As shown.

[0057] Table 1. Results of BCR-ABL1 P210 genomic RNA concentration and purity.

[0058]

[0059] II. Confirmation of the target mutant gene sequence of the extracted cell line genomic RNA.

[0060] Genomic RNA was reverse transcribed into cDNA using a reverse transcription kit. The target fusion mutation gene fragment was then amplified by conventional PCR, and the PCR product was sequenced using Sanger sequencing. The sequencing results are shown below. Figure 2 .

[0061] III. Design three pairs of primers and probes for specific amplification of BCR-ABL1 P210 type b2a2 and b3a2, as well as the ABL-WT gene.

[0062] Based on the NCBI database and information on the b2a2 and b3a2 fusion mutations of BCR-ABL1 P210, three pairs of specific primers and probes were designed using PrimerExpress 3.0. Blast analysis revealed high specificity and the absence of potential non-specific amplification regions. The specific primers and probes include specific primers 1 and 2 and specific probe 1 for specific amplification of BCR-ABL1 P210 type b2a2; specific primers 3 and 4 and specific probe 2 for specific amplification of BCR-ABL1 P210 type b3a2; and specific primers 5 and 6 and specific probe 3 for amplification of ABL-WT. The nucleotide sequences of primers 1 and 2 are shown in SEQ ID No. 1 and SEQ ID No. 2, the nucleotide sequence of probe 1 is shown in SEQ ID No. 3, the nucleotide sequences of primers 3 and 4 are shown in SEQ ID No. 4 and SEQ ID No. 5, the nucleotide sequence of probe 2 is shown in SEQ ID No. 6, the nucleotide sequences of primers 5 and 6 are shown in SEQ ID No. 7 and SEQ ID No. 8, and the nucleotide sequence of probe 3 is shown in SEQ ID No. 9, as shown in Table 2.

[0063] Table 2. Primer and probe sequences for digital PCR

[0064] Serial Number name nucleotide sequence SEQ ID No.1 b2a2-F CAGATGCTGACCAACTCGTGT SEQ ID No.2 b2a2-R TCCTTGGAGTTCCAACGAGC SEQ ID No. 3 b2a2-P FAM-TGAGCCTCAGGGTCTGAGTGAAGCC-BHQ1 SEQ ID No. 4 b3a2-F CACTCAGCCACTGGATTTAA SEQ ID No. 5 b3a2-R TCCTTGGAGTTCCAACGAGC SEQ ID No. 6 b3a2-P FAM-TGAGCCTCAGGGTCTGAGTGAAGCC-BHQ1 SEQ ID No.7 ABL-WT-F CCTTCAGCGGCCAGTAGC SEQ ID No. 8 ABL-WT-R GGACACAGGCCCATGGTAC SEQ ID No. 9 ABL-WT-P FAM-TGAGCCTCAGGGTCTGAGTGAAGCC-BHQ1

[0065] IV. Optimize the amplification conditions of primers and probes for three pairs of specific amplification of BCR-ABL1 P210 type b2a2 and b3a2 and ABL-WT genes.

[0066] The final concentrations of primers BCR-ABL1 P210 type b2a2 and b3a2 were fixed at 500 nM, and the probe concentration was fixed at 250 nM. Figure 3 a) and 3b) respectively set the annealing temperatures to 55℃, 56℃, 57℃, 58℃, 59℃ and 60℃.

[0067] The primer concentration for ABL-WT was fixed at 500 nM, and the probe concentration was fixed at 250 nM. Figure 3 c) Set the annealing temperatures to 55℃, 56℃, 57℃, 58℃, 59℃, and 60℃ respectively.

[0068] From the one-dimensional scatter plot of the amplification results, BCR-ABL1 P210 type b2a2 and b3a2 were amplified well at all six annealing temperatures. However, in terms of the repeatability of the quantitative results, the repeatability at 60℃ was the best. Therefore, the optimal annealing temperature for BCR-ABL1 P210 type b2a2 and b3a2 was determined to be 60℃. ABL-WT was amplified well at all four annealing temperatures. At 58℃, the dispersion of the two clusters of positive and negative droplets was the best, and the repeatability of the quantitative results was also high. Therefore, the optimal annealing temperature for ABL-WT was determined to be 58℃.

[0069] The primer and probe concentrations were set to 200-500 nM. Based on the criteria of clear separation between negative and positive amplification signals and high droplet and copy numbers, the optimal conditions were determined as follows: b2a2 primer and probe concentrations of 500 nM and 400 nM, b3a2 primer and probe concentrations of 400 nM and 300 nM, and ABL-WT primer and probe concentrations of 500 nM and 400 nM.

[0070] The droplet digital PCR reaction system was as follows: Genomic DNA: 0–100 ng, 2X One-step SuperMix (Bio-Rad Laboratories) 5 μL, reverse transcriptase 2 μL, 300 mM DTT 1 μL, V1 upstream and downstream primers: 0.8 μL, probe: 0.4 μL, V3 upstream and downstream primers: 1.0 μL, probe: 0.6 μL, ABL-WT upstream and downstream primers: 1.0 μL, probe: 0.8 μL, RNA template 2 μL, and ddH2O to make up to 20 μL.

[0071] PCR reaction program: reverse transcription at 45℃ for 60 min, denaturation at 95℃ for 10 min, denaturation at 94℃ for 30 s, annealing at 58℃ / 60℃ for 60 s, 40 cycles, extension at 98℃ for 10 min, storage at 4℃. The digital PCR reaction system was optimized as follows: Figure 4 As shown.

[0072] V. Preparation and Value Determination of BCR-ABL1 Fusion Gene Genomic RNA Standard Material

[0073] After the above steps (I) and (II), an RNA solution containing 5 ng / μL yeast RNA was prepared as an RNA storage buffer by weighing according to a balance. Then, the obtained BCR-ABL1 fusion gene cell line genomic RNA, which was used as a standard, was added to the RNA storage buffer by weight. After mixing evenly, the solution was aliquoted and frozen. Then, the values ​​were determined according to the established one-step reverse transcription digital PCR.

[0074] Using the one-step reverse transcription digital PCR method, PCR amplification is carried out with the genomic RNA of the BCR-ABL1 P210 fusion mutant as the template, and fluorescence signals are collected to detect the expression of the BCR-ABL1 P210 fusion genes b2a2 and b3a2, so as to obtain the copy number contents of the BCR-ABL1 P210 fusion genes b2a2, b3a2 and ABL-WT and the abundance of mutant genes as their quantity values.

[0075] The calculation formula for the abundance of the target mutant gene is as follows:

[0076] Examine the homogeneity of the BCR-ABL1 fusion gene quantitative genomic RNA reference material

[0077] To ensure that the reference material providing quality control reference during the detection process has sufficient homogeneity and stability, so as to accurately transfer the accuracy of quantity values. According to the technical requirements for the evaluation of the homogeneity of reference materials in the national metrological technical specification JJF 1343-2012 "General Principles and Statistical Principles for the Certification of Reference Materials", 11 packaging units are randomly selected for each reference material, and the established one-step reverse transcription digital PCR method is used for certification testing. Each unit is measured 3 times repeatedly, and the data obtained are shown in Tables 3 and 4. Conduct an F-test on the obtained data, and compare the calculated F value with the critical F obtained by looking up the table α If F < F α It is considered that there is no obvious difference between within-group and between-group, and the homogeneity of the sample is good.

[0078] Apply the established one-step reverse transcription digital PCR method to determine the homogeneity of the BCR-ABL1 fusion gene detection quantitative reference material. For the measurement results, first use the Shapiro-Wilk method to test the normality of the data, and the homogeneity data of all reference materials meet the normal distribution. Then use Dixon's and Grubbs's tests to eliminate suspicious values, and no suspicious values are found. After the F-test, the results show that F < F0.05(10,22) for all reference materials, that is, there is no significant difference in the internal homogeneity of the reference material solution.

[0079] Table 3 Results of the homogeneity test of the BCR-ABL1 b2a2 fusion gene in genomic RNA

[0080]

[0081] Table 4 Results of the homogeneity test of the BCR-ABL1 b3a2 fusion gene in genomic RNA

[0082]

[0083]

[0084] VII. Monitoring the stability of quantitative genomic RNA standard material for the BCR-ABL1 fusion gene

[0085] To ensure the stability of the reference material under transport conditions, short-term stability tests were conducted at -20℃ and 4℃. Three samples were randomly selected at 3, 7, and 14 days, with each sample measured three times. The copy numbers of the two BCR-ABL1 fusion gene mutants, the copy number of the ABL-WT gene, and the abundance of the mutant gene were determined. The reference material stored at -80℃ was used as the reference temperature. (See attached text.) Figure 5-9 .

[0086] This demonstrates that under storage conditions of -20℃ and 4℃, the copy number concentration and mutation abundance of the standard substance did not change significantly within 14 days. Therefore, by adding dry ice during transportation or controlling the temperature to not exceed 4℃ during transportation, as long as the transportation time does not exceed 14 days, the value of the standard substance can remain stable, which lays an important foundation for the application of standard substances.

[0087] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for preparing a BCR-ABL1 fusion gene quantitative genomic RNA reference material, characterized in that, It comprises the following steps: (1) Extracting the cell line genomic RNA containing BCR-ABL1 P210 type mutation, detecting its concentration and purity; (2) Using the cell line genomic RNA containing BCR-ABL1 P210 type mutation as a template, obtaining a gene fragment with a target fusion mutation by using a reverse transcription kit and PCR amplification, and verifying the correctness of the target gene sequence by Sanger sequencing PCR product; (3) Adding a certain yeast RNA solution to the RNA solution to prepare an RNA storage buffer; (4) Adding the cell line genomic RNA to the RNA storage buffer to dilute it into a standard solution with a certain concentration; (5) Designing and obtaining BCR-ABL1 P210 type fusion gene b2a2 specific primers 1 and 2 and specific probe 1, the nucleotide sequences of the primers 1 and 2 are shown in SEQ ID No. 1, SEQ ID No. 2, and the nucleotide sequence of the probe 1 is shown in SEQ ID No. 3; The reaction concentration of primers 1 and 2 is 500nM, and the reaction concentration of probe 1 is 400nM; Design and obtain BCR-ABL1 P210 type fusion gene b3a2 specific primers 3 and 4 and specific probe 2; the nucleotide sequences of the primers 3 and 4 are shown in SEQ ID No. 4, SEQ ID No. 5, and the nucleotide sequence of the probe 2 is shown in SEQ ID No. 6; the reaction concentration of the primers 3 and 4 is 400nM, and the reaction concentration of the probe 2 is 300nM; Design and obtain ABL-WT gene specific primers 5 and 6 and specific probe 3; the nucleotide sequences of the primers 5 and 6 are shown in SEQ ID No. 7, SEQ ID No. 8, and the nucleotide sequence of the probe 3 is shown in SEQ ID No. 9; the reaction concentration of the primers 5 and 6 is 500nM, and the reaction concentration of the probe 3 is 400nM; (6) Using one-step reverse transcription digital PCR method, using BCR-ABL1 P210 type mutation cell line genomic RNA as a template for PCR amplification, collecting fluorescence signal to detect the expression of BCR-ABL1 P210 type fusion gene b2a2 and b3a2, thereby obtaining the copy number content and mutant gene abundance of BCR-ABL1 P210 type fusion gene b2a2, b3a2 and ABL-WT as its value, the calculation formula of the mutant gene abundance is 。 2. The method of preparing a BCR-ABL1 fusion gene quantitative genomic RNA reference material according to claim 1, characterized in that: In steps (3) and (4), when configuring a certain concentration of RNA storage buffer solution and standard solution, a balance weighing method is used for dilution and mixing.

3. The method for preparing the quantitative genomic RNA standard material of the BCR-ABL1 fusion gene according to claim 1, characterized in that: In step (3), the concentration of yeast RNA is 5-500 ng / μL.

4. The method for preparing the quantitative genomic RNA standard material of the BCR-ABL1 fusion gene according to claim 1, characterized in that: In step (5), the 5' end of the probe 1, the probe 2 and the probe 3 is labeled with FAM fluorescent group, and the 3' end is labeled with BHQ1 fluorescent group.

5. The method for preparing the quantitative genomic RNA standard material of the BCR-ABL1 fusion gene according to claim 1, characterized in that: PCR reaction conditions: 45℃ reverse transcription for 60 min, 95℃ denaturation for 10 min; then 40 cycles of 94℃ denaturation for 30 sec, 60℃ annealing for 60 sec for BCR-ABL1 P210 type b2a2 and b3a2, 58℃ annealing for 60 sec for ABL-WT, and 98℃ extension for 10 min, 4℃ storage.

6. The BCR-ABL1 fusion gene quantitative genomic RNA standard substance prepared by the method of any one of claims 1-5.

Citation Information

Patent Citations

  • BCR-ABL1 fusion gene e14a2 subtype plasmid candidate reference substance and preparation method and purpose thereof

    CN108265117A

  • RT-PCR (reverse transcription-polymerase chain reaction) kit for quantitatively detecting BCR-ABL1P210 type fusion gene expression level

    CN107794296A

  • NTRK fusion mutation standard substance, and preparation method and application thereof

    CN110438230A