Construction method of RUNX1 gene conditional knockout chronic myelogenous leukemia mouse model

By specifically knocking out the RUNX1 gene in myeloid cells and combining it with the SCL-tTA/BCR-ABL model, a RUNX1 conditionally knocked-out chronic myeloid leukemia mouse model was constructed. This solves the problem of the lack of a model that integrates RUNX1 loss of function with Bcr-abl-driven leukemia phenotype in existing technologies, and enables in vivo research on RUNX1 in chronic myeloid leukemia and supports drug development.

CN121986755APending Publication Date: 2026-05-08GUANGDONG PHARMA UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGDONG PHARMA UNIV
Filing Date
2026-02-12
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

The existing technology lacks a stable genetic animal model that simultaneously integrates RUNX1 loss of function and Bcr-abl-driven leukemia phenotype at the in vivo level, making it difficult to systematically evaluate the role of RUNX1 in the occurrence, development and progression of chronic myeloid leukemia.

Method used

A conditionally knocked-out chronic myeloid leukemia mouse model was constructed by specifically and inducibly knocking out the RUNX1 gene in myeloid cells using the hybrid LYZ2-CreERT2 system and combining it with SCL-tTA/BCR-ABL double transgenic mice.

Benefits of technology

This study provides a genetic model that simultaneously exhibits RUNX1 loss of function and BCR-ABL-driven leukemia phenotype, enabling the investigation of the in vivo mechanism of RUNX1 in chronic myeloid leukemia and providing a tool for drug screening and efficacy evaluation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121986755A_ABST
    Figure CN121986755A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of mouse model construction, and particularly relates to a construction method of a chronic myelogenous leukemia mouse model with RUNX1 gene conditional knockout. The method comprises the following steps: hybridizing a RUNX1 gene conditional knockout mouse and an LYZ2-CreERT2 mouse to obtain an F1 generation, and carrying out DNA (Deoxyribose Nucleic Acid) identification and screening to obtain a double-transgenic mouse with the genotype of LYZ2-CreERT2 / RUNX1; then hybridizing the LYZ2-CreERT2 / RUNX1 double-transgenic mouse of the F1 generation with the SCL-tTA / Bcr-abl double-transgenic mouse to obtain an F2 generation, and carrying out DNA (Deoxyribose Nucleic Acid) identification and screening to obtain a four-transgenic mouse of which the genotype is SCL-tTA / Bcr-abl / LYZ2-CreERT2 / RUNX1. The invention provides a solid research basis for deep research of the effect of the RUNX1 gene in chronic myelogenous leukemia and research and development of LSCs targeted drugs aiming at the RUNX1 gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of mouse model construction technology, specifically relating to a method for constructing a chronic myeloid leukemia mouse model with conditional knockout of the RUNX1 gene. Background Technology

[0002] The RUNX1 gene, or Acute Myeloid Leukemia 1 (AmL1), was initially discovered at a breakpoint on chromosome 21 in the t(8;21)(q22;q22) chromosomal translocation. It contains a 138-amino acid Runt homologous functional region. RUNX1 belongs to the RUNX protein family, specifically the Runt-associated transcription factor (RUNX) protein family. The RUNX protein family is a family of transcription factors with highly conserved protein sequences that regulate the expression of genes involved in cell differentiation and proliferation, playing a crucial role in many developmental and immunophysiological processes. Therefore, the loss of any RUNX family member can adversely affect survival. RUNX1 is commonly found in Acute Myeloid Leukemia (AML1) and plays a vital role in the development of various malignant diseases caused by tumor cells due to its association with the growth and differentiation of hematologic malignant cells and solid tumor cells.

[0003] Studies have shown that the RUNX1 gene plays a crucial role in regulating the development and precise maintenance of hematopoietic function in mammals, and is essential for maintaining hematopoietic stem cell (HSC) and progenitor cell homeostasis. The proliferation of hematopoietic stem cells and progenitor cells due to RUNX1 gene deletion may be a significant cause of human leukemia. Researchers have also discovered that genes regulating cell cycle and apoptosis among RUNX1 target genes may lead to abnormal cell proliferation due to RUNX1 dysfunction. To study RUNX1 function, existing literature and experimental models have employed the Cre-LoxP conditional knockout system to knock out the RUNX1 gene in specific cell types or developmental stages. For example, using LysM-Cre or other myeloid-related Cre systems, conditional knockout of RUNX1 in myeloid cells can be achieved to study its role in normal hematopoiesis or abnormal myeloid proliferation. However, existing RUNX1 conditional knockout models are mainly used for basic hematopoietic function studies and have not been systematically integrated with typical leukemia driver gene models.

[0004] Chronic myeloid leukemia (CmL) is a malignant clonal hematopoietic system disease based on the Bcr-abl fusion gene. To investigate its pathogenesis and drug intervention, various CmL mouse models have been established, including animal models expressing the Bcr-abl fusion gene via retroviruses or transgenic methods. Some literature has reported at the molecular or cellular level that RUNX1 dysfunction may affect the progression of Bcr-abl-related leukemia; for example, RUNX1 mutations or dysfunction are associated with disease exacerbation during the blast crisis. However, these studies are mostly in vitro experiments or single genetic background analyses, or use mutation / interference methods, rather than a systematic integration of conditional knockout and classic CML transgenic models.

[0005] In existing technologies, RUNX1 conditional knockout models and Bcr-abl-driven chronic myeloid leukemia (CML) models are typically constructed and used independently, lacking a stable genetic animal model that simultaneously integrates RUNX1 loss of function and Bcr-abl-driven leukemia phenotype at the in vivo level. Existing models struggle to systematically assess the role of RUNX1 in the occurrence, development, and progression of CML. Therefore, it is necessary to provide a novel method for constructing mouse models to overcome these shortcomings. Exploring the construction of a conditionally knockout RUNX1-based CML mouse model (SCL-tTA / Bcr-abl mice) is crucial for clarifying the role of the RUNX1 gene in CML disease and for the development of LSC-targeting drugs against the RUNX1 gene. Summary of the Invention

[0006] The purpose of this invention is to provide a method for constructing a mouse model of chronic myeloid leukemia with conditional knockout of the RUNX1 gene.

[0007] The technical solution adopted by this invention to solve the technical problem is as follows: The method for constructing a chronic myeloid leukemia mouse model with conditional knockout of the RUNX1 gene of the present invention includes the following steps: S1: RUNX1 gene conditional knockout mice and LYZ2-CreERT2 mice were crossed and identified. The F1 generation mice were identified as carrying LYZ2-CreERT2 / RUNX1. S2: F1 generation LYZ2-CreERT2 / RUNX1 double transgenic mice and SCL-tTA / Bcr-abl double transgenic mice were crossed and identified. The F2 generation mice obtained by identification carried the SCL-tTA / Bcr-abl / LYZ2-CreERT2 / RUNX1 gene, that is, a chronic myeloid leukemia mouse model with conditional knockout of the RUNX1 gene. As a preferred implementation scheme, the genotype identification of F1 and F2 generation mice in S1 and S2 is as follows: (1) PCR Genotyping of RUNX1 transgenic mice: The upstream primer sequence RUNX1F is shown in SEQ ID NO. 1, and the downstream primer sequence RUNX1R is shown in SEQ ID NO. 2. RUNX1F:TCCACCGTTTTCCTAAACTGAGATA (SEQ ID NO.1) RUNX1R:TATTGATGTGACCAACTGAAACCC (SEQ ID NO.2) The amplification reaction system consisted of 25 μL, including 12.5 μL of PCR premix containing Tap DNA polymerase, 1.5 μL of mouse DNA sample, 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), and 9 μL of ultrapure water. Reaction conditions: 95℃ for 3 min, 95℃ for 15 s, 60℃ for 15 s, 72℃ for 5 min, 72℃ for 5 min, repeat 5 steps for 35 cycles, hold at 16℃; The primer sequences for genotyping identification of LYZ2-CreERT2 transgenic mice are shown in SEQ ID NO. 3~SEQ ID NO. 7 below: LYZ-F1(P1):TGAGGAAAAACAGAAGCCATTATT (SEQ ID NO.3) LYZ-R2(P2):CCATCTCTTCTCAGCCCCCTTAC (SEQ ID NO.4) LYZ-F3(P3):CTTTCGCTTCCCCCTCCCTATTG (SEQ ID NO.5) LYZ-R4(P4):ACTGCTCCCCTGTCCCTGTTCTGA (SEQ ID NO.6) The amplification reaction system consisted of 25 μL, containing 0.1 μL of Tap DNA polymerase, 1 μL of mouse DNA sample, 0.5 μL of primers, 14.9 μL of ultrapure water, 2 μL of 10x Taq PCR buffer, and 1 μL of 2.5 mM dNTP. Reaction conditions: 94℃ for 3 min, 94℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 72℃ for 5 min, repeat 5 steps for 35 cycles, hold at 16℃; (2) Agarose gel electrophoresis The PCR amplification products were subjected to 1.2% agarose gel electrophoresis; Indicators for determining RUNX1 gene knockout results: mice with a band of approximately 165 bp are wild-type mice, mice with a band of approximately 233 bp are homozygous mice, and mice with both bands of approximately 233 bp and approximately 165 bp are heterozygous mice. The criteria for determining the LYZ2-CreERT2 gene knockout results are as follows: mice that do not show a 753bp band but show a 655bp band are homozygous mice; mice that show a 753bp band and show a 655bp band are heterozygous mice; and mice that show a 753bp band but do not show a 655bp band are wild-type mice. (3) The results of RUNX1 genotyping were as follows: some F1 mice showed a band of about 233 bp, which were homozygous mice; other F1 mice showed double bands of about 233 bp and about 165 bp, which were heterozygous mice.

[0008] As a preferred implementation scheme, the genotype identification results of the F2 generation mice in S2 are as follows: (1) PCR The primer sequences for genotyping Bcr-abl / SCL-tTA transgenic mice are as follows: Bcr-ablF:GAGCGTGCAGAGTGGAGGGAGAACA (SEQ ID NO.7) Bcr-ablR:GGTACCAGGAGTGTTCTCCAGACTG (SEQ ID NO.8) ControlF: CTAGGCCACAGAATTGAAAGATCT (SEQ ID NO.9) ControlR: GTAGGTGGAAATTCTAGCATCATCC (SEQ ID NO.10) SCL-tTAF: CGCTGTGGGGCATTTTACTTTAG (SEQ ID NO.11) SCL-tTAR: CAGTCCAGATCGAAATCGTC (SEQ ID NO.12) The amplification reaction system was 20 μL, which included 10 μL of PCR premix containing Tap DNA polymerase, 2 μL of mouse DNA sample, 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), and 6 μL of ultrapure water. Reaction conditions: 94℃ for 5 min, 94℃ for 30 s, 61℃ for 30 s, 72℃ for 1 min, 72℃ for 5 min, repeat 5 steps for 34 cycles, hold at 16℃; (2) Agarose gel electrophoresis The PCR amplification products were subjected to 1.2% agarose gel electrophoresis; The criteria for determining the Bcr-abl gene identification result are: whether a band of approximately 550 bp appears, and whether an internal control with a band of approximately 324 bp is amplified simultaneously; The criteria for determining the SCL-tTA gene identification result is whether a band of approximately 750 bp appears.

[0009] (3) The identification results are: SCL-tTA / Bcr-abl / LYZ2-CreERT2 / RUNX1 mice exist in the F2 generation.

[0010] The present invention provides a method for constructing a chronic myeloid leukemia mouse model with conditional knockout of the RUNX1 gene, thereby obtaining a chronic myeloid leukemia mouse model with conditional knockout of the RUNX1 gene.

[0011] The beneficial effects of this invention are: Compared with the prior art, the present invention has at least the following beneficial effects: (1) The mouse model constructed in this invention simultaneously possesses RUNX1 loss of function and BCR-ABL-driven leukemia phenotype at the genetic level; (2) RUNX1 can be induced to knock out in myeloid cells, thus more accurately mimicking the disease process; (3) To provide a new in vivo research tool for studying the role of RUNX1 in the occurrence, development and progression of chronic myeloid leukemia; (4) It can be used for drug screening, efficacy evaluation and disease mechanism research.

[0012] This invention, for the first time, constructs a chronic myeloid leukemia (CML) mouse model using the following combination of methods: (1) specifically and inducibly knocking out the RUNX1 gene in myeloid cells using the LYZ2-CreERT2 system; (2) crossing the above-mentioned RUNX1 conditional knockout mice with SCL-tTA / BCR-ABL double transgenic mice to construct a RUNX1 conditional knockout CML mouse model. This model possesses both myeloid-specific RUNX1 function loss and BCR-ABL-driven CML phenotype at the genetic level. Therefore, it provides a new, stable, and reproducible in vivo research model for studying the role of RUNX1 in the development and progression of CML.

[0013] This invention successfully constructed a mouse model of chronic myeloid leukemia with conditional knockout of the RUNX1 gene, which is of great significance for the development of LSCs targeting the RUNX1 gene and provides a new approach for the treatment of CmL disease. Attached Figure Description

[0014] Figure 1 This describes the hybridization process for transgenic mice.

[0015] Figure 2 This is the result of RUNX1 genotyping identification in F1 generation LYZ2-CRE-ERT2 / RUNX1 dual-gene mice. Experimental conditions: PCR amplification of the RUNX1 gene fragment, 1.2% agarose gel electrophoresis; sample numbers 57–66; 3 replicates; 165 bp is wild-type, 233 bp is homozygous.

[0016] Figure 3 Genotyping results of LYZ2-CreERT2 in F1 generation LYZ2-CRE-ERT2 / RUNX1 dual-gene mice. Experimental conditions: PCR amplification, electrophoresis analysis; sample numbers 57–66; 3 replicates.

[0017] Figure 4 Genotyping results of RUNX1 in mice 91 and 101 (SCL-tTA / Bcr-abl / LYZ2-CRE-ERT2 / RUNX1 positive individuals). Experimental conditions: PCR detection; sample numbers 85–103; 3 replicates.

[0018] Figure 5 Genotyping results of LYZ2-CreERT2 in mice 91 and 101. Experimental conditions: PCR detection; sample numbers 91, 93, 100, 101, and 103; replicates 3 times.

[0019] Figure 6 Genotyping results of Bcr-abl / SCL-tTA mice 91 and 101. Experimental conditions: PCR detection; sample numbers 91, 100, and 101; 3 replicates.

[0020] Figure 7 Results were obtained using Western blotting. Experimental conditions: RUNX1 protein was detected in spleen, bone marrow, liver, and kidney tissues; samples were numbered 91 (control group) and 101 (induction group); the assay was repeated three times; semi-quantitative analysis was performed using grayscale analysis software. Detailed Implementation

[0021] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to examples of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0022] I. Materials 1. Laboratory mice and their housing environment The RUNX1 gene conditional knockout mice used in this experiment were purchased from Cyagen Biosciences, with one male and two females; LYZ2-CRE-ERT2 mice and SCL-tTA / Bcr-abl mice were obtained from the Experimental Animal Center of Guangdong Pharmaceutical University (SPF grade).

[0023] The mice were housed at the Experimental Animal Center of Guangdong Pharmaceutical University (SPF grade), with the temperature controlled at 18-22℃, humidity at 50%-70%, and automatic light control (12h light / 12h dark). Cages, feed, and bedding were all sterilized, and drinking water was sterile. The housing was disinfected daily, and bedding was changed twice a week to ensure the environment met SPF-grade animal requirements.

[0024] 2. Animal Ethics Statement All animal experiments involved in this invention have been reviewed and approved by the Laboratory Animal Ethics Committee of Guangdong Pharmaceutical University. All experimental procedures strictly follow the national "Regulations on the Management of Laboratory Animals" and related animal ethics norms, minimizing the number of animals and their suffering.

[0025] 3. Instruments and reagents Multifunctional microplate reader workstation Flex Station 3 (MolecμLardevices); Handheld tissue homogenizer E6600 (Beyotime Biotechnology); Electrophoresis system DYY-11 (Beijing Liuyi Instrument Factory); Vortex mixer XW-80A (Qilin Bell Instrument Manufacturing Co., Ltd.); Dry heater D1100 (Labnet, USA); GeneAmp PCR System 9700 (Gene Company Limited); Electronic analytical balance AL104 (METTLER TOLEDO, Switzerland); MolecμLar Imager® ChemiDoc™ XRS+System gel imaging system (Bio-Rad, USA); SW-CJ-2F clean bench (Shanghai Boxun Medical); Centri-5810R benchtop high-speed centrifuge (Eppendorf, Germany); 2.5 / 10 / 20 / 100 / 200 / 1000 pipettes (Eppendorf, Germany); LOP-B-4 ice maker (Anting, Shanghai); VE-186 transfer tank (Tianeng, Shanghai); TY80s horizontal shaker (Guowang, Jintan); TS-8 decolorizing shaker (Kirin Bell); 5200MμL Ti Tannon (Tianeng, Shanghai); Lab Auto autoclave (SANYO, Japan); PROG0002 ultrapure water system (Millipore, USA); BSA (Nachuan); 30% acrylamide solution (MDBio, Inc.); Tris Base (Superpure) (Nachuan); Tris-HCl (1.5M, 8.8) (Beyotime Biotechnology); Tris-HCl (1.0M, 6.8)8) (Beyotime Biotechnology); SDS (Nachuan); Ammonium persulfate (APS) (Nachuan); TEMED (Sigma-Aldrich, USA); BCA protein concentration assay kit (Beyotime Biotechnology); Protein marker (Thermo Scientific, USA); SDS-PAGE loading buffer (Beyotime Biotechnology); Skim milk powder (Sigma-Aldrich, USA); DreamTaq Hot StartGreen PCR Master Mix (Thermo Scientific, USA); Water, nuclease-free (Thermo Scientific, USA); Platinum™ Direct PCR Universal Master Mix (Invitrogen, USA); DL2000 DNA Marker (TaKaRa, Japan); 50xTAE nucleic acid electrophoresis buffer (Beyotime Biotechnology); Agarose (BIOWEST, France); Tamoxifen (Sigma-Aldrich, USA); Corn oil (Aladdin); Nucleic acid dye (AAT Bioquest, USA); c-Abl rabbit monoclonal antibody (Cell Signaling, USA) Technology / 2862T); RUNX1 polyclonal antibody (Proteintech, USA / 19555-1-AP); RUNX2 polyclonal antibody (Proteintech, USA / 20700-1-AP); RUNX3 polyclonal antibody (Proteintech, USA / 27099-1-AP); β-actin internal control antibody (Proteintech, USA / 66009-1-Ig); HRP-labeled antiimmunoassay secondary antibody (Cell Signaling Technology, USA); Phosphate-buffered saline (PBS) (Boster Biological); Tween 20 (Guangzhou Weijia Technology); Sodium chloride (MDBio, Inc.); Glycine (MDBio, Inc.); RUNX F2 (Invitrogen, USA); RUNX R3 (Invitrogen, USA); LYZ-F1 (Invitrogen, USA); LYZ-R2 (Invitrogen, USA); LYZ-F3 (Invitrogen, USA); LYZ-R4 (Invitrogen, USA); BCR R (Invitrogen, USA); BCR ConR (Invitrogen, USA); BCR FF (Invitrogen, USA); BCR ConF (Invitrogen, USA); tTA RR (Sangon Biotech (Shanghai) Co., Ltd.); tTA FF (Sangon Biotech (Shanghai) Co., Ltd.); II. Methods for constructing a mouse model of chronic myeloid leukemia with conditional knockout of the RUNX1 gene 1. The procedure for constructing a mouse model of chronic myeloid leukemia with conditional knockout of the RUNX1 gene is as follows: Figure 1 As shown: First, RUNX1 gene conditional knockout mice and LYZ2-CRE-ERT2 mice were crossed and identified. The F1 generation mice carrying the LYZ2-CRE-ERT2 / RUNX1 gene were identified. Then, the F1 generation LYZ2-CRE-ERT2 / RUNX1 double transgenic mice and SCL-tTA / Bcr-abl double transgenic mice were crossed and identified. The F2 generation SCL-tTA / Bcr-abl / LYZ2-CRE-ERT2 / RUNX1 quadrature transgenic mice were identified.

[0026] 2. Mouse genotyping (1) Extraction of mouse tail genomic DNA After the hybrid progeny mice reached 3 weeks of age, their tails were clipped to approximately 0.5 cm and stored in 1.5 mL EP tubes. A lysis buffer was prepared by adding 1 mL of Lysis Buffer to 30 μL of Proteinase K, and then adding 20 μL of the lysis buffer to the EP tube (to ensure complete lysis, the tail must be submerged in the liquid; if not, increase the amount of lysis buffer). The tube was incubated at room temperature for 15 min to ensure complete reaction. A dry heater was preheated to 98°C, and the sample was heated for 1 min to extract mouse DNA.

[0027] (2) PCR The primer list is as follows

[0028] The primer sequences for genotyping identification of RUNX1 transgenic mice are shown in SEQ ID NO. 1 and SEQ ID NO. 2: Amplification reaction system 25 μL The mixture contained 12.5 μL of PCR premix containing Tap DNA polymerase, 1.5 μL of mouse DNA sample, 1 μL of upstream primer RUNX1F (10 μM), 1 μL of downstream primer RUNX1R (10 μM), and 9 μL of ultrapure water. Reaction conditions: 95℃ for 3 min, 95℃ for 15 s, 60℃ for 15 s, 72℃ for 5 min, 72℃ for 5 min, repeat 5 steps for 35 cycles, hold at 16℃; The primer sequences for genotyping identification of LYZ2-CreERT2 transgenic mice are shown in SEQ ID NO. 3~SEQ ID NO. 6. Amplification reaction system 25 μL The sample contained 0.1 μL of Tap DNA polymerase, 1 μL of mouse DNA sample, 0.5 μL of P1 (10 pmol / μL), 0.5 μL of P2 (10 pmol / μL), 14.9 μL of ultrapure water, 2 μL of 10x Taq PCR buffer, and 1 μL of 2.5 mM dNTP. Reaction conditions: 94℃ for 3 min, 94℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 72℃ for 5 min, repeat 5 steps for 35 cycles, hold at 16℃; The primer sequences for genotyping Bcr-abl / SCL-tTA transgenic mice are shown in SEQ ID NO. 7~SEQ ID NO. 12. The amplification reaction system was 20 μL, which included 10 μL of PCR premix containing Tap DNA polymerase, 2 μL of mouse DNA sample, 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), and 6 μL of ultrapure water. Reaction conditions: 94℃ for 5 min, 94℃ for 30 s, 61℃ for 30 s, 72℃ for 1 min, 72℃ for 5 min, repeat 5 steps for 34 cycles, hold at 16℃; (2) Agarose gel electrophoresis The PCR amplification products were subjected to 1.2% agarose gel electrophoresis; The criteria for determining the RUNX1 gene knockout results are as follows: mice with a band of approximately 165 bp are wild-type mice, mice with a band of approximately 233 bp are homozygous mice, and mice with both bands of approximately 233 bp and approximately 165 bp are heterozygous mice. Criteria for determining the LYZ2-CreERT2 gene knockout results: If P1 & P2 do not show a 753bp band and P3 & P4 show a 655bp band, the mice are homozygous; if P1 & P2 show a 753bp band and P3 & P4 show a 655bp band, the mice are heterozygous; if P1 & P2 show a 753bp band and P3 & P4 do not show a 655bp band, the mice are wild-type. The criteria for determining the Bcr-abl gene identification result are: the appearance of a band of approximately 550 bp, and the simultaneous amplification of an internal control band of approximately 324 bp. The criteria for determining the SCL-tTA gene identification result is the appearance of a band of approximately 750 bp.

[0029] (3) Results (1) Genotyping of F1 generation mice RUNX1 conditional knockout mice were crossed with LYZ2-CRE-ERT2 mice, numbered 84-102 (F1) and 138 (F1). Genotyping was performed on the F2 generation, and the RUNX1 genotyping results are as follows: Figure 2As shown, the identification results showed that mice 60 (F1) and 65 (F1) both showed a 233bp band, indicating that these mice were homozygous for RUNX1. Mice 61 (F1), 57 (F1), 58 (F1), 59 (F1), 62 (F1), 63 (F1), and 64 (F1) all showed double bands of 165bp and 233bp, indicating that these mice were heterozygous for RUNX1.

[0030] Genotyping of the F1 generation using the LYZ2-CreERT2 method was performed, and the results are as follows: Figure 3 As shown, the identification results indicate that mice 57 (F1), 58 (F1), 59 (F1), 61 (F1), 63 (F1), 64 (F1), and 66 (F1) did not show a 753bp band at P1 & P2, but showed a 655bp band at P3 & P4, meaning that these mice are all LYZ2-CreERT2 homozygous mice.

[0031] comprehensive Figure 2 and Figure 3 Based on the identification results, the F1 generation LYZ2-CreERT2 / RUNX1 mice were crossed with SCL-tTA / Bcr-abl double transgenic mice for breeding and culture to obtain F2.

[0032] Genotyping of F2 generation mice The F1 generation mice were further crossed with SCL-tTA / Bcr-abl double transgenic mice, numbered 84-102 (F2) and 138 (F2). Genotyping of the F2 generation was performed, with the RUNX1 genotyping results as follows: Figure 4 As shown, the identification results showed that mice 100 (F2) and 103 (F2) both showed a 165bp band, indicating that these mice were RUNX1 wild-type (WT) mice. Mice 85 (F2), 86 (F2), 87 (F2), 88 (F2), 89 (F2), 90 (F2), 91 (F2), and 101 (F2) all showed double bands of 165bp and 233bp, indicating that these mice were RUNX1 heterozygous mice.

[0033] Genotyping of the F2 generation was performed on the Bcr-abl / SCL-tTA line, and the results of the Bcr-abl / SCL-tTA genotyping were as follows: Figure 6 As shown, the identification results showed that mice No. 91 (F2), No. 100 (F2), and No. 101 (F2) all showed bands of 165bp, 324bp, and 750bp respectively, indicating that these mice were all Bcr-abl / SCL-tTA genotype mice.

[0034] Genotyping of the F2 generation using the LYZ2-CreERT2 method was performed, and the results are as follows: Figure 5 As shown, the identification results showed that mice 91 (F2), 93 (F2), 100 (F2), 101 (F2), and 103 (F2) all showed a 753bp band at P1 & P2 and a 655bp band at P3 & P4, indicating that these mice were all LYZ2-CreERT2 heterozygous mice.

[0035] In summary, we have successfully constructed mice that are positive for RUNX1, Lyz2-creERT2, Bcr-abl, and SCL-tTA genes.

[0036] III. Western blotting detection Mice numbered 91 (F2) and 101 (F2) were used. One mouse was given an intraperitoneal injection of 20 mg / kg tamoxifen corn oil solution once daily for 5 consecutive days. The other mouse, a 6-8 week old SCL-tTA / Bcr-abl / LYZ2-CreERT2 / RUNX1 quadrigene transgenic mouse, served as the control group and was given the same dose of corn oil intraperitoneally. After the completion of tamoxifen administration, the mice were closely monitored for any adverse reactions to the treatment. One week later, both the tamoxifen treatment group and the control group were sacrificed. Total protein was extracted from bone marrow cells, spleen cells, liver tissue, and kidney tissue. The protein content was determined by the BCA method, and the protein samples were separated by SDS-PAGE, transferred to PVDF membranes, and blocked with 5% skim milk powder. Rabbit monoclonal antibodies RUNX1 (19555-1-AP, 1:1000), RUNX2 (20700-1-AP, 1:1000), RUNX3 (27099-1-AP, 1:1000), Bcr-abl (2862T, 1:1000), and β-actin (81115-1-RR, 1:1000) were added and incubated overnight at 4°C. Horseradish peroxide (HRP)-labeled goat anti-rabbit IgG (1:5000) diluted with 5% BSA was added, and the mixture was incubated at room temperature for 30 min. The membrane was washed three times with TBS for 5 min each time. Protein bands were detected using ECL chromogenic buffer, and images were taken and analyzed using a gel imaging system.

[0037] The protein concentrations of each tissue cell were measured, and the final loading amounts were as follows:

[0038]

[0039] Western blotting results as follows Figure 7As shown, in spleen and bone marrow cells that primarily express the RUNX1 gene, detection was performed using a primary antibody against RUNX1, with β-actin as an internal control. The results showed that, compared to the control group, the RUNX1 protein band in the spleen and bone marrow tissues of mice induced by tamoxifen was significantly reduced or disappeared in the approximately 48–55 kDa range, indicating that the RUNX1 gene was effectively knocked out in myeloid cells.

[0040] In summary, the expression of the RUNX1 gene was suppressed, the RUNX1 gene was successfully knocked out, and a conditional knockout RUNX1 gene chronic myeloid leukemia mouse model was successfully obtained.

Claims

1. A method for constructing a RUNX1 conditional knockout mouse model of chronic myeloid leukemia, characterized in that, Includes the following steps: S1: RUNX1 gene conditional knockout mice and LYZ2-CreERT2 mice were crossed and identified. The F1 generation mice were identified as carrying LYZ2-CreERT2 / RUNX1. S2: F1 generation LYZ2-CreERT2 / RUNX1 double transgenic mice and SCL-tTA / Bcr-abl double transgenic mice were crossed and identified. F2 generation mice carrying the SCL-tTA / Bcr-abl / LYZ2-CreERT2 / RUNX1 gene were obtained, thus creating a chronic myeloid leukemia mouse model with conditional knockout of the RUNX1 gene.

2. The construction method according to claim 1, characterized in that, In steps S1 and S2, the genotypes of F1 and F2 generation RUNX1 transgenic mice were identified using PCR. The amplification reaction system consisted of 25 μL, including 12.5 μL of PCR premix containing Tap DNA polymerase, 1.5 μL of mouse DNA sample, 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), and 9 μL of ultrapure water. The PCR amplification program was as follows: 95℃ for 3 min, 95℃ for 15 s, 60℃ for 15 s, 72℃ for 5 min, 72℃ for 5 min, repeated for 5 steps and 35 cycles, and held at 16℃. The upstream primer sequence for RUNX1 genotype identification is shown in SEQ ID NO. 1, and the downstream primer sequence is shown in SEQ ID NO.

2.

3. The construction method as described in claim 2, characterized in that, The criteria for determining the RUNX1 gene knockout results are as follows: mice with a band of approximately 165 bp on 1.2% agarose gel electrophoresis are wild-type mice, mice with a band of approximately 233 bp are homozygous mice, and mice with both bands of approximately 233 bp and approximately 165 bp are heterozygous mice.

4. The construction method according to claim 1, characterized in that, In steps S1 and S2, the genotype identification of LYZ2-CreERT2 transgenic mice in F1 and F2 generations was performed using PCR. The amplification reaction system was 25 μL, containing 0.1 μL of Tap DNA polymerase, 1 μL of mouse DNA sample, 0.5 μL of primers (10 pmol / μL), 14.9 μL of ultrapure water, 2 μL of 10x Taq PCR buffer, and 1 μL of 2.5 mM dNTP. The primer sequences for LYZ2-CreERT2 transgenic mouse genotype identification are shown in SEQ ID NO. 3~SEQ ID NO.

6. The reaction program for the PCR amplification system was as follows: reaction conditions: 94℃ for 3 min, 94℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, 72℃ for 5 min, repeated for 5 steps and 35 cycles, and held at 16℃.

5. The construction method as described in claim 4, characterized in that, Criteria for determining the LYZ2-CreERT2 gene knockout results: 1.2% agarose gel electrophoresis showed a band of approximately 655bp, indicating homozygous mice; approximately 753bp band and approximately 655bp band were observed, indicating heterozygous mice; approximately 753bp band and no approximately 655bp band were observed, indicating wild-type mice.

6. The construction method according to claim 1, characterized in that, In step S2, the genotype identification of F2 generation Bcr-abl / SCL-tTA transgenic mice was performed using PCR. The amplification reaction system was 20 μL, which included 10 μL of PCR premix containing Tap DNA polymerase, 2 μL of mouse DNA sample, 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), and 6 μL of ultrapure water. The primers for genotype identification of Bcr-abl / SCL-tTA transgenic mice are shown in SEQ ID NO. 7~SEQ ID NO.

12. The reaction program of the PCR amplification system was as follows: 94℃ for 5 min, 94℃ for 30 s, 61℃ for 30 s, 72℃ for 1 min, 72℃ for 5 min, repeated for 5 steps and 34 cycles, and held at 16℃.

7. The construction method as described in claim 6, characterized in that, The criteria for identifying the Bcr-abl gene are: a band of approximately 550 bp appearing on 1.2% agarose gel electrophoresis, and an internal control with a band of approximately 324 bp being amplified simultaneously; the criteria for identifying the SCL-tTA gene are: a band of approximately 750 bp appearing on 1.2% agarose gel electrophoresis.

8. The construction method according to claim 1, characterized in that, The constructed RUNX1 gene conditionally knocked out chronic myeloid leukemia mouse model can be applied to LSCs targeting drugs against the RUNX1 gene.

9. A chronic myeloid leukemia mouse model with conditional knockout of the RUNX1 gene constructed using the method described in any one of claims 1-8.