A goose mitochondrial genome sequencing primer set and high-throughput sequencing method
By designing a set of primers for whole-genome sequencing of goose mitochondria and employing multiplex PCR amplification and high-throughput sequencing methods, the challenges of full coverage and deep sequencing of the mitochondrial genome were solved, achieving efficient and low-cost sequencing results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- JIANGSU INST OF POULTRY SCI
- Filing Date
- 2026-02-24
- Publication Date
- 2026-06-26
AI Technical Summary
Existing technologies struggle to achieve high-throughput deep sequencing while ensuring full coverage of the mitochondrial genome, and are complex, costly, and difficult to accurately detect low-frequency mutations.
A primer set for goose mitochondrial whole genome sequencing was designed, and the primers were divided into two subsets. Multiplex PCR amplification and high-throughput sequencing were performed. By combining specific amplification product lengths and sequencing platform compatibility, a coverage of 99.6% and a sequencing depth of over 1000X were achieved, while reducing the data volume requirements.
Achieve high coverage and deep sequencing with minimal data volume, reduce sequencing costs, improve detection accuracy, reduce template usage, and be compatible with mainstream sequencing platforms.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a primer set and a high-throughput sequencing method for goose mitochondrial genome sequencing. Background Technology
[0002] Geese genetic resources are an indispensable component of my country's livestock and poultry germplasm resources and biodiversity. Their effective protection and sustainable utilization are of profound significance for ensuring sustainable agricultural development. Therefore, accurate genetic diversity assessment and germplasm resource identification of goose breeds are particularly important.
[0003] Animal cells contain two genetic systems: the nuclear genome and the mitochondrial genome. Mitochondrial DNA possesses an independent genetic system, does not follow Mendelian inheritance laws, and is characterized by its simple structure, lack of homologous recombination, rapid evolutionary rate, and strict maternal inheritance. It is widely used in fields such as species origin and evolution, population genetic structure, species identification, and economic trait association analysis. Due to the high copy number of mitochondrial DNA, only a small number of individual samples are needed to effectively reflect the genetic structure of a population. By analyzing the genetic diversity of mitochondrial DNA in different goose breeds, we can understand their genetic background, population history and dynamics, and formulate scientific conservation plans. Mitochondrial DNA is a powerful tool for tracing the origin and domestication history of domestic geese. Studies have shown that most domestic goose breeds in China, such as the Zhejiang White Goose and the Sichuan White Goose, may have originated from the Swan Goose, while the Landes Goose and the Lohmann Goose may have originated from the Greylag Goose. The full length of the goose mitochondrial genome is approximately 16743 bp, containing one D-loop control region, 13 protein-coding genes, 2 rRNA genes (12S rRNA and 16S rRNA), and 22 tRNA genes. Mitochondrial DNA exhibits a wide variety of mutations, including large insertions / deletions, small insertions / deletions, and point mutations. These mutations can occur in both coding and non-coding regions.
[0004] Although mitochondrial DNA is an ideal genetic marker, its sequencing technology still faces challenges. Traditional cesium chloride density gradient centrifugation can obtain relatively pure mitochondrial DNA, but the process is time-consuming and labor-intensive, requiring high sample volume and quality. Other enrichment techniques, such as hybridization capture, are costly and cumbersome; long-fragment PCR is relatively simple, but requires high sample integrity, and long-fragment amplification is prone to errors and struggles to cover regions with high secondary structure. Some existing methods for mitochondrial sequencing using multiplex PCR struggle to achieve uniform and sufficient sequencing depth while ensuring complete mitochondrial genome coverage; gaps may appear in some complex regions due to low amplification efficiency. To accurately detect low-frequency mutations in mitochondria, deep sequencing is required, which means that sequencing depth must be significantly increased while maintaining sequence coverage. However, current technologies capable of efficiently capturing complete mitochondrial DNA and performing high-throughput deep sequencing are still limited, and the procedures are often quite complex.
[0005] Therefore, there is an urgent need to develop a goose mitochondrial DNA sequencing method capable of deep sequencing. Summary of the Invention
[0006] The purpose of this invention is to provide a primer set and a high-throughput sequencing method for goose mitochondrial genome sequencing, which simplifies the operation steps, allows for higher sequencing depth even with a smaller amount of data, and reduces sequencing costs.
[0007] This invention is implemented as follows:
[0008] This invention provides a primer set for whole-genome sequencing of goose mitochondria, the primer set sequences being shown in SEQ ID NO.1-SEQ ID NO.156, and the primer pairs shown in SEQ ID NO.1-SEQ ID NO.156 are divided into two subsets, with primer pairs of adjacent sequences in different subsets.
[0009] In a specific embodiment of the present invention, the primer set is divided into primer subset 1 and primer subset 2, wherein the primer sequences in primer subset 1 are shown as SEQ ID NO.1-SEQ ID NO.78, and the primer sequences in primer subset 2 are shown as SEQ ID NO.79-SEQ ID NO.156.
[0010] The primer set for goose mitochondrial whole-genome sequencing provided by this invention, consisting of 78 primer pairs, effectively achieves full-length coverage of goose mitochondria, with a coverage rate exceeding 99.6%. This allows for higher sequencing depth with minimal data volume, reducing sequencing costs. The aforementioned amplification primers also reduce template usage. Furthermore, the primer set provided by this invention produces amplification products with relatively short lengths (approximately 237 bp), compatible with mainstream sequencing platforms' PE150 and longer read lengths, facilitating sequencing.
[0011] In the implementation of this invention, primer pairs of adjacent sequences are in different subsets, and the amplification products of any two primer pairs within the same primer subset do not overlap. This arrangement prevents the overlapping of sequences within the same subset from causing the amplification product of the overlapping part to be too long, thus affecting the amplification efficiency of the overall amplification reaction.
[0012] The present invention also provides the application of the primer set for goose mitochondrial whole genome sequencing in high-throughput sequencing of the goose mitochondrial genome.
[0013] The present invention provides a method for high-throughput sequencing of the mitochondrial genome of a goose, the method comprising the following steps: (1) extracting genomic DNA from the goose to be tested; (2) performing PCR amplification on the genomic DNA of the sample to be tested using the primer subsets described in the present invention, thereby obtaining amplification products of different primer subsets, and mixing the amplification products of different primer subsets; (3) performing high-throughput sequencing analysis.
[0014] In one alternative implementation, in step (2), the amplification products of different primer subsets are mixed in equal molar amounts and then adapters and index sequences are added. After a second round of amplification, high-throughput sequencing analysis is performed.
[0015] In a specific example, the PCR amplification system for each primer subset is shown in Table 1 below:
[0016] Table 1
[0017] .
[0018] In a specific example, the PCR reaction procedure for each group is shown in Table 2 below:
[0019] Table 2
[0020] .
[0021] In one embodiment, the second-round amplification primer pair is:
[0022] P7: CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCCTTGGCACCCGAG.
[0023] P5: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC.
[0024] The italicized "X" indicates the index sequence, which can be referenced from the index sequences used in the Illumina platform. In multiplexing, it serves as a unique identifier to distinguish different samples.
[0025] In a specific example, the second-round amplification system is shown in Table 3 below:
[0026] Table 3
[0027] .
[0028] In one specific example, the procedure for the second round of PCR reaction is shown in Table 4 below:
[0029] Table 4
[0030] .
[0031] In step (3) of this invention, high-throughput sequencing analysis and phylogenetic tree construction can be performed according to conventional methods in the field. During this process, adapters and low-quality data in the sequencing data can also be routinely removed. Short sequences are located at the corresponding positions in the goose mitochondrial genome using SOAPaligner software. Sequencing results information, such as the number of short sequences, the size of the target region coverage, and the average sequencing depth, are statistically analyzed. SOAPsnp is used to find the genotype of the site in the target region. GATK software is used to find the insertion / deletion information contained in the sequence.
[0032] The sample used to extract the genomic DNA of the goose to be tested in step (1) of this invention can be any sample containing genomic DNA, such as blood, feathers, tissues or organs.
[0033] This invention also provides the application of the aforementioned high-throughput sequencing method for the goose mitochondrial genome in detecting different mutation types and haplotypes. By performing routine comparative analysis on the sequencing data, information on different mutation types and haplotypes can be obtained.
[0034] Compared with the prior art, the present invention has the following advantages:
[0035] (1) Conventional sequencing to capture the full length of mitochondrial sequences is a cumbersome and expensive process. The PCR primers designed in this invention can effectively cover the full length of the goose mitochondrial genome after multiplex amplification using at least two primer subsets.
[0036] (2) In second-generation sequencing, nuclear genomic DNA constitutes the vast majority of the total DNA in the sample, while the proportion of mitochondrial genome in the second-generation sequencing data is relatively small. To solve the problem of insufficient sequencing data, the total sequencing data volume must be increased, which leads to increased costs. This invention uses a designed primer set for library construction to perform high-throughput sequencing, which can obtain higher sequencing depths (above 1000X) with a very small amount of data (20~200Mb), thereby improving the accuracy of the results. The price is only one-fifth of that of conventional sequencing and one-tenth of that of second-generation sequencing. The comparison is shown in Table 5.
[0037] Table 5 Comparison of different methods for obtaining the full-length mitochondrial genome
[0038] . Attached Figure Description
[0039] Figure 1 Primer pair grouping diagram.
[0040] Figure 2 Flowchart of high-throughput sequencing.
[0041] Figure 3 The assembled goose mitochondrial genome structure.
[0042] Figure 4 Phylogenetic tree of goose mitochondrial haplotypes. Detailed Implementation
[0043] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0044] Unless otherwise specified, the 78 primer pairs in the PCR multiplex amplification primer set of this invention are shown in Table 6:
[0045] Table 6 Primer pairs
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054] Of the 78 primer pairs mentioned above, adjacent primer pairs are located in different subsets (primer subset 1 and primer subset 2, respectively), such as... Figure 1 As shown, the primer sequences in primer subset 1 are shown in SEQ ID NO.1-SEQ ID NO.78, and the primer sequences in primer subset 2 are shown in SEQ ID NO.79-SEQ ID NO.156.
[0055] The features and performance of the present invention will be further described in detail below with reference to embodiments.
[0056] Example 1
[0057] This embodiment provides a high-throughput mitochondrial whole-genome sequencing method for blood samples from Lingxian white geese. The overall flowchart is shown below. Figure 2 As shown.
[0058] (1) Ten blood samples were randomly selected from Lingxian white geese and extracted using the DP348 (TIANampBlood DNA Kit) blood genomic DNA extraction kit.
[0059] (2) Design and synthesize the primer set in Table 6 (78 pairs in total), and mix them into two primer pools, 1 and 2, according to Set. The primer synthesis and purification method is HPLC.
[0060] (3) Perform the first round of multiplex PCR amplification:
[0061] The PCR reaction system is shown in Table 7 (the same for groups 1 and 2):
[0062] Table 7
[0063] .
[0064] The PCR reaction procedure is shown in Table 8 (the same for groups 1 and 2):
[0065] Table 8
[0066] .
[0067] The first-round amplification products (approximately 237 bp in length) were purified and recovered using AMPure XP magnetic beads, and groups 1 and 2 were mixed in equimolar amounts.
[0068] (4) Use the DNA mixed in the previous step as a template for the second round of amplification.
[0069] The primers for the second round of amplification are as follows:
[0070] P7: CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCCTTGGCACCCGAG.
[0071] P5: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC.
[0072] The italicized "X" indicates an index sequence of 8 bases in length, which serves as a unique identifier in multiplex sequencing to distinguish different samples.
[0073] The second-round amplification system is shown in Table 9:
[0074] Table 9
[0075] .
[0076] The PCR reaction procedure is shown in Table 10:
[0077] Table 10
[0078] .
[0079] The second-round amplification product, approximately 400 bp in length, was purified and recovered using AMPure XP magnetic beads.
[0080] After the recovered products passed the concentration and length tests, they were sequenced using an Illumina MiSeq instrument in PE300 sequencing mode.
[0081] (5) Mutation type analysis: Remove adapters and low-quality data from the sequencing data; locate short sequences to the corresponding positions in the goose mitochondrial genome using SOAPaligner software; statistically analyze sequencing results, such as the number of short sequences, the size of the target region coverage, and the average sequencing depth; SOAPsnp is used to find the genotype of the site in the target region; GATK software is used to find the insertion / deletion information contained in the sequence.
[0082] Sequencing data and alignment analysis results are shown in Table 11 below:
[0083] Table 11
[0084] .
[0085] The assembled circular diagram of the mitochondrial genome of Lingxian white goose is shown below. Figure 3The goose mitochondrial genome contains 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 non-coding control region. The number of variant sites and haplotypes was counted using DnaSP (v6.12.03) software. A total of 18 variant sites and 8 haplotypes were found in 10 individuals. A phylogenetic tree of goose mitochondrial haplotypes constructed based on the neighbor-joining method is shown below. Figure 4 .
[0086] The sequencing data in Example 1 show that the high-throughput sequencing method for the mitochondrial genome provided by the present invention can achieve high sequencing depth with less data and reduce sequencing costs.
[0087] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A primer set for whole-genome sequencing of goose mitochondria, characterized in that, The primer set sequences are shown in SEQ ID NO.1-SEQ ID NO.156, and the primer pairs shown in SEQ ID NO.1-SEQ ID NO.156 are divided into two subsets, with primer pairs of adjacent sequences in different subsets; preferably, the primer set is divided into primer subset 1 and primer subset 2, wherein the primer sequences in primer subset 1 are shown in SEQ ID NO.1-SEQ ID NO.78, and the primer sequences in primer subset 2 are shown in SEQ ID NO.79-SEQ ID NO.
156.
2. The application of the primer set for goose mitochondrial whole genome sequencing as described in claim 1 in high-throughput sequencing of the goose mitochondrial genome.
3. A method for high-throughput sequencing of the goose mitochondrial genome, characterized in that, The steps include: (1) extracting genomic DNA from the goose to be tested; (2) performing PCR amplification on the genomic DNA of the sample to be tested using the primer subsets described in claim 1 or 2, thereby obtaining amplification products of different primer subsets, and mixing the amplification products of different primer subsets. (3) Perform high-throughput sequencing analysis.
4. The method for high-throughput sequencing of the goose mitochondrial genome according to claim 3, characterized in that, In step (2), the amplification products of different primer subsets are mixed in equal molar amounts, and then adapters and index sequences are added. After a second round of amplification, high-throughput sequencing analysis is performed.
5. The method for high-throughput sequencing of the goose mitochondrial genome according to claim 3, characterized in that, Step (2) The PCR amplification system for each group is as follows: 。 6. The method for high-throughput sequencing of the goose mitochondrial genome according to claim 3, characterized in that, Step (2) The PCR reaction procedure for each group is as follows: 。 7. The method for high-throughput sequencing of the goose mitochondrial genome according to claim 4, characterized in that, The primer pair for the second round of amplification is: P7: CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCCTTGGCACCCGAG; P5: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC; The italicized "X" indicates the index sequence.
8. The method for high-throughput sequencing of the goose mitochondrial genome according to claim 4, characterized in that, The second round of amplification system is as follows: ; The procedure for the second round of PCR reaction is as follows: 。 9. The method for high-throughput sequencing of the goose mitochondrial genome according to any one of claims 3 to 8, characterized in that, The samples used to extract genomic DNA from the geese to be tested are blood, feathers, tissues, or organs.
10. The application of the goose mitochondrial genome high-throughput sequencing method according to any one of claims 3 to 9 in detecting different mutation types and haplotypes.