Kit for detecting male infertility and use
By detecting peptides and nucleic acids of IQCN gene mutations, the challenges of predicting male infertility and evaluating assisted reproductive technologies have been solved, providing new diagnostic and treatment methods and improving fertilization success rates.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CENT SOUTH UNIV
- Filing Date
- 2022-08-26
- Publication Date
- 2026-06-02
AI Technical Summary
In the current technology, there are difficulties in predicting male infertility and assessing the effectiveness of assisted reproductive technologies, especially in the lack of effective diagnostic markers and assessment methods for fertilization failure caused by sperm head malformation.
By identifying the mutation location and mutation type of the IQCN gene, we can provide peptide (IQCN protein truncated) and nucleic acid detection methods to predict fertilization risk, assess the effectiveness of assisted reproductive technologies, and develop biomarkers for the diagnosis and treatment of male infertility.
It enables early diagnosis of male infertility and effective assessment of assisted reproductive technologies, providing new treatment pathways and improving fertilization success rates.
Smart Images

Figure CN115232198B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of molecular biomedicine, and more specifically, to a reagent kit and application for detecting male infertility. Background Technology
[0002] Fertilization is the process by which male and female gametes fuse, initiating the development of a new organism. Complete fertilization failure is a common problem in assisted reproductive technologies. The failure rate of intracytoplasmic sperm injection (ICSI) is 1%–3%, with nearly half caused by male factors. Among these, severe sperm head malformation is a common cause of male-derived fertilization failure.
[0003] The acrosome and sperm collar are two important structures that work in conjunction with various functional proteins to ensure successful fertilization. Round-headed sperm disorder (RBO) can lead to fertilization failure due to the absence of the acrosome structure and the lack of the oocyte activating factor PLCζ. Additionally, there is another head malformation characterized by acrosome detachment that also causes fertilization failure; its causative genes are ACTL9 and ACTL7A, which encode actin-like proteins located in the acrosome and involved in acrosome anchoring.
[0004] The sperm collar is a temporary structure that participates in the elongation and condensation of the sperm cell nucleus during spermatogenesis. This structure consists of a perinuclear ring and inserted microtubule structures. Studies have shown that microtubule-associated proteins or intraflagellate transport (IFT) may be involved in sperm collar assembly, and defects in related genes in mice, such as Kif3a, Ift88, and Clip-170, can lead to sperm head malformations and infertility.
[0005] Sperm head reshaping is accompanied by acrosome specialization; however, it remains unclear whether defects in the sperm head lead to acrosome structural abnormalities and whether this type of sperm head malformation is associated with human fertilization failure.
[0006] Therefore, avoiding the prediction of fertilization risks is a challenge in assessing the effectiveness of assisted reproductive technologies. Summary of the Invention
[0007] To address the aforementioned issues, this application is the first to discover the correlation between the IQCN gene and the risk of male-derived fertilization. It predicts fertilization risk based on the mutation location and mutation type of the IQCN gene, thereby assessing the effectiveness of the fertilization process in assisted reproductive technologies.
[0008] Based on this, the primary objective of this application is to provide a polypeptide, which is a truncated form of the IQCN protein, and the truncated form of the IQCN protein is associated with a phenotype of fertilization failure.
[0009] In one embodiment, compared to the wild-type IQCN protein, the truncated IQCN protein lacks the peptide encoded by the exon 4 region of the IQCN gene and at least a portion of the peptide encoded by the exon 3 region.
[0010] In one embodiment, the truncated peptide of the IQCN protein includes a deletion peptide formed by at least one mutation of wild-type IQCN protein, namely p.Gln304Ter and p.Gln818Argfs*9.
[0011] The second objective of this application is to provide a nucleic acid encoding the polypeptide described above.
[0012] In one embodiment, the nucleic acid is mutated compared to the wild-type IQCN gene, and the mutation includes at least one of nonsense mutation and frameshift mutation, located in the region between the start position of the IQCN gene coding region and the end position of exon 3.
[0013] In one embodiment, the mutation is located in the exon 3 region of the IQCN gene.
[0014] In one embodiment, the mutation includes at least one of c.910C>T and c.2453_2454del.
[0015] A third objective of this application is to provide the application of a reagent for detecting IQCN gene mutations or truncated IQCN proteins in the preparation of a kit for detecting male infertility.
[0016] In one embodiment, the mutation includes at least one of nonsense mutation and frameshift mutation, and the mutation is located in the region between the start position of the coding region of the IQCN gene and the end position of exon 3.
[0017] In one embodiment, the mutation is located in the exon 3 region of the IQCN gene.
[0018] In one embodiment, the mutation includes at least one of c.910C>T and c.2453_2454del.
[0019] In one embodiment, compared to the wild-type IQCN protein, the truncated IQCN protein lacks the peptide encoded by the exon 4 region of the IQCN gene and at least a portion of the peptide encoded by the exon 3 region.
[0020] In one embodiment, the truncated peptide of the IQCN protein includes a deletion peptide formed by at least one mutation of wild-type IQCN protein, namely p.Gln304Ter and p.Gln818Argfs*9.
[0021] The fourth objective of this application is to provide a primer composition product for detecting IQCN gene mutations.
[0022] In one embodiment, the primer composition product includes at least one pair of primers of the sequences shown in SEQ ID NO:1-2, SEQ ID NO:3-4, SEQ ID NO:5-6, SEQ ID NO:7-8, SEQ ID NO:9-10, SEQ ID NO:11-12, SEQ ID NO:13-14, and SEQ ID NO:15-16.
[0023] The fifth objective of this application is to provide a peptide detection product, which includes a reagent that specifically identifies the aforementioned peptides.
[0024] In one embodiment, the peptide detection product includes an antibody that specifically recognizes the peptide.
[0025] The sixth objective of this application is to provide a kit for detecting male infertility, comprising the above-mentioned primer composition product and / or the above-mentioned peptide detection product.
[0026] In one embodiment, the kit also includes a probe, dNTPs, DNA polymerase, double-stranded specific fluorescent dye, internal control primers, and one or more of the following in water.
[0027] The seventh objective of this application is to provide an expression vector having the nucleic acid as described above.
[0028] The eighth objective of this application is a recombinant cell comprising the expression vector as described above.
[0029] The ninth objective of this application is to provide the use of at least one of the above-mentioned nucleic acids, peptides, expression vectors, and recombinant cells in the preparation of a drug for treating male infertility.
[0030] This application is the first to discover the correlation between the IQCN gene, truncated IQCN protein, and the risk of male-derived fertilization. Fertilization risk can be predicted based on the mutation location and type of the IQCN gene or the truncated IQCN protein, thereby assessing the effectiveness of assisted reproductive technology in the fertilization process. Furthermore, the IQCN gene and truncated IQCN protein can also serve as diagnostic biomarkers for male-derived fertilization failure and infertility, and can be used in the development of drugs for the treatment of primary male infertility, thus providing a new pathway for the treatment of primary male infertility. Attached Figure Description
[0031] To more clearly illustrate the technical solutions in the specific embodiments of this application or the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0032] Figure 1 This is a schematic diagram of the genetic information of a patient with an IQCN gene mutation in Example 1 of this application;
[0033] Figure 2 This is a diagram showing the fertilization status and sperm phenotype detection results of the IQCN-mutant patient in Example 1 of this application;
[0034] Figure 3 This is a graph showing the sperm phenotype detection results of Iqcn knockout mice in Example 3 of this application;
[0035] Figure 4 This is a graph showing the fertilization capacity test results of Iqcn knockout mice in Example 3 of this application;
[0036] Figure 5 This is a diagram showing the localization of Iqcn during mouse spermatogenesis and the changes in the sperm collar structure of mice after IQCN knockout in Example 3 of this application.
[0037] Figure 6 This is a schematic diagram of the embryo formed after Iqcn knockout mice undergo assisted oocyte activation therapy in Example 3 of this application;
[0038] Figure 7 This is the sequencing result of the Iqcn gene in the Iqcn knockout mice in Example 3 of this application. Detailed Implementation
[0039] Reference will now be made to detailed embodiments of this application, one or more of which are described below. Each example is provided for explanation and not for limitation of this application. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to this application without departing from its scope or spirit. For example, features described or illustrated as part of one embodiment may be used in another embodiment to produce further embodiments.
[0040] Therefore, this application is intended to cover such modifications and variations falling within the scope of the appended claims and their equivalents. Other objects, features, and aspects of this application are disclosed in or will be apparent from the following detailed description. It will be understood by those skilled in the art that this discussion is merely a description of exemplary embodiments and is not intended to limit the broader aspects of this application.
[0041] As mentioned above, the current process for diagnosing and monitoring cachexia is quite complex and costly, and there is a lack of effective biomarker testing reagents for the diagnosis and monitoring of cachexia.
[0042] To address at least one of the aforementioned technical problems, a first aspect of this application provides a nucleic acid for predicting male-derived fertilization risk, wherein the nucleic acid is a mutant of the IQCN gene, and this nucleic acid is associated with fertilization risk. In this application, "fertilization risk" refers to the susceptibility (degree of likelihood of failure) of a male individual to fertilization failure during natural fertilization or in vitro fertilization treatment. Fertilization failure refers to the inability of a male individual's sperm to fertilize all available oocytes.
[0043] This application, through the collection of male semen samples and the use of whole exome sequencing (WES), has made a groundbreaking discovery of two new mutations in the IQCN gene that are associated with fertilization risk.
[0044] The IQCN gene, located on chromosome 19, has four exons and encodes 1180 amino acids. Genotype-tissue expression (GTEx) databases show that IQCN is specifically expressed in the testes. Bioinformatics analysis indicates that IQCN contains six IQ motifs (IQxxxRGxxxR or I / L / VQxxxRxxxxR / K). However, information on the expression and function of the IQCN gene has not yet been reported. This application, through the aforementioned two mutations, is the first to discover the correlation between the expression and function of the IQCN gene and the fertilization process, which can then be used to predict the risk of male-derived fertilization, thereby assessing the effectiveness of assisted reproductive technology fertilization; it can also serve as a diagnostic biomarker for male-derived fertilization failure and infertility, contributing to the development of drugs for the treatment of male primary infertility, thus providing a new pathway for the treatment of male primary infertility.
[0045] This application provides information regarding two novel mutations, both located in exon 3 of the IQCN gene, which are a nonsense mutation and a frameshift mutation, respectively. Specifically, the two novel mutations are: a nonsense mutation c.910C>T and a frameshift mutation c.2453_2454del, both located in exon 3 of the IQCN gene. Both mutations are proposed for the first time by the applicant and have not been reported in any existing studies.
[0046] Based on the above research, this application provides an isolated nucleic acid, which is a mutant of the IQCN gene. This nucleic acid is associated with fertilization risk and is used to encode a truncated version of the IQCN protein. Specifically, in one case, the nucleotide sequence of this nucleic acid, compared with the wild-type IQCN gene, has a c.910C>T mutation, meaning that the 910th position of the cDNA sequence of this nucleic acid, compared with the wild-type IQCN gene, is mutated from C to T, resulting in a nonsense mutation. This causes amino acid 304 in the third exon of this gene to change from glutamine to a stop codon, thus causing the IQCN protein to become a truncated protein. In another case, the nucleotide sequence of this nucleic acid, compared with the wild-type IQCN gene, has a c.2453_2454del mutation, where the 2453rd and 2454th positions of its cDNA sequence are deleted, resulting in a frameshift mutation. This causes amino acid 818 in the third exon of this gene to change from glutamine to arginine, and continues to encode 9 more amino acids before terminating, thus causing the IQCN protein to become a truncated protein. Based on the IQCN gene mutations discovered in this application, it is understood that nonsense mutations or frameshift mutations located in the region between the start position of the IQCN gene coding region and the end position of exon 3 may be highly associated with fertilization risk.
[0047] In one embodiment of this application, the aforementioned nucleic acid is DNA. Those skilled in the art should understand that, here, the specific location and mutation type of the mutation site have been clarified. Therefore, the nucleic acids applicable to this application include, but are not limited to, DNA, mRNA, and cDNA. Furthermore, the nucleic acid sequence in this application can be any one or both strands of a complementary double strand. Based on the complementarity of nucleic acid sequences and the nucleic acid sequence information provided in this application, those skilled in the art can obtain another nucleic acid sequence complementary to a given nucleic acid sequence.
[0048] The isolated nucleic acids can be obtained from samples through extraction and purification, or through artificial synthesis or mutation, and can be freely used in fields related to fertilization risk, such as detection, treatment, drug development, or research. For example, a direct application is to detect the presence of the mutation information for predicting fertilization risk provided in this application in the sample. It should be noted that the specific information on the gDNA and cDNA sequences of the IQCN gene can be obtained by searching ENSG00000130518 and ENST00000600328.7 on the NCBI website, respectively.
[0049] This application provides an isolated polypeptide, a truncated version of the IQCN protein, which is a mutant polypeptide associated with fertilization risk. Specifically, in one case, compared to the IQCN protein, the mutant polypeptide has a mutation at position 304 where wild-type glutamine (Gln, Q) is mutated to a stop codon (Ter), resulting in a truncated IQCN protein. In another case, compared to the IQCN protein, the mutant polypeptide has a mutation at position 818 where wild-type glutamine (Gln, Q) is mutated to arginine, and then continues encoding for 9 more amino acids before terminating, resulting in a truncated IQCN protein. It is understood that the IQCN protein truncated versions obtained from the above two mutations lack the peptide encoded by the exon 4 region of the IQCN gene and a portion of the peptide encoded by the exon 3 region, thus leading to fertilization failure.
[0050] The isolated peptides described above can be obtained through extraction and purification, and are freely used in PID-related fields such as detection, treatment, drug development, or research. For example, a direct application is to detect the peptides to determine whether the mutation information provided in this application exists in the sample. It should be noted that the specific sequence information of the wild-type IQCN protein can be obtained by searching NP_079525.1 on the NCBI website.
[0051] It should be noted that the detection methods for the aforementioned nucleic acids or peptides in the test sample generally include the following steps: sample processing, detection, and result determination. Sample processing refers to the treatment of the test sample. The specific processing method depends on the actual object being detected, also known as the detection target. For example, if the target is nucleic acid, the sample processing method involves extracting the nucleic acid from the sample. The type of sample itself is also selected based on the type of detection target. For example, when the detection target is nucleic acid, the sample may include, but is not limited to, semen, prostatic fluid, and testicular tissue. Generally, the relevant sample only needs to contain the detection target. The detection step also depends on the selected detection target. Different detection targets require different detection methods. For example, when the detection target is nucleic acid, sequencing can be used to determine the sequence information of the sample's nucleic acid. The specific sequencing method does not constitute a limitation of this application; those skilled in the art can select an appropriate sequencing method based on the suggestions in this application.
[0052] In one specific embodiment of this application, Sanger sequencing is used to detect nucleic acids in the sample. Nucleic acids extracted from the sample are amplified by PCR using primers, and the amplified fragments are then subjected to Sanger sequencing. Result interpretation refers to comparing the detection results with certain standards to draw a conclusion. The method of result interpretation is also related to the selection of the detection target.
[0053] In one specific embodiment of this application, the sequencing results are compared with a standard sequence. If the nucleic acid sequence of the sample to be tested contains one of the two mutations disclosed in this application, it can be used to predict the risk of fertilization failure in the subject during assisted reproductive treatment, or as one of the bases for diagnosing the subject with male primary infertility.
[0054] To detect the presence of the aforementioned nucleic acids in a sample, this application provides a primer composition product for detecting these nucleic acids. This primer composition product contains primers for detecting the aforementioned nucleic acids and, based on the subject's IQCN gene mutation status, predicts the subject's fertilization risk, thereby enabling the detection of primary male infertility. The primer composition product can optionally detect both IQCN gene mutations identified in this application simultaneously, or it can optionally detect only one of them.
[0055] In some specific embodiments, the primer composition product includes at least one pair of primers with sequences shown in SEQ ID NO:1-2, SEQ ID NO:3-4, SEQ ID NO:5-6, SEQ ID NO:7-8, SEQ ID NO:9-10, SEQ ID NO:11-12, SEQ ID NO:13-14, and SEQ ID NO:15-16. The primer composition product covers all four exon regions of the IQCN gene and enables the detection of IQCN gene loci associated with fertilization risk based on the primer composition product.
[0056] Furthermore, this application provides a kit for detecting the above-mentioned nucleic acids, including but not limited to the primer composition products described above. To detect the above-mentioned mutations more efficiently and accurately, this application provides a nucleic acid detection kit, the reagents of which include at least one pair of primers of the sequences shown in SEQ ID NO:1-2, SEQ ID NO:3-4, SEQ ID NO:5-6, SEQ ID NO:7-8, SEQ ID NO:9-10, SEQ ID NO:11-12, SEQ ID NO:13-14, and SEQ ID NO:15-16, as specifically shown in Table 1, used to detect mutations in different exon regions of the IQCN gene. Specifically, it can be used to detect nonsense mutations c.910C>T and frameshift mutations c.2453_2454del on the IQCN gene.
[0057] Table 1
[0058] Primer Sequence Exon 1-F SEQ ID NO:1:GCCTTCTAGAATCCCCACCC Exon 1-R SEQ ID NO:2:CACGAACCCTCGCAAACAAG Exon 2-F SEQ ID NO:3:GGAATAAATTTCCTCATCTTTGCAC Exon 2-R SEQ ID NO:4:CCCTGATGCATAGCCTGGAG Exon 3-F-1 SEQ ID NO:5:GATGGAAAAAGGGAGGCGGA Exon 3-R-1 SEQ ID NO:6:CTATGTGGACGAGGCAGGTG Exon 3-F-2 SEQ ID NO:7:CCAGTGAGTCTGGACGCAAA Exon 3-R-2 SEQ ID NO:8:CTGAGGTGTTGGGAGTTCCG Exon 3-F-3 SEQ ID NO:9:AGACTCTGTGTCTGGCCTCT Exon 3-R-3 SEQ ID NO:10:CAGCATACCCTGGACCTCAC Exon 3-F-4 SEQ ID NO:11:CCAAGCCAGAGGACAGACAG Exon 3-R-4 SEQ ID NO:12:AAGATGGCCCCATCAATCCC Exon 4-F-1 SEQ ID NO:13:GTCTTCCCCAAGTGGTTCCC Exon 4-R-1 SEQ ID NO:14:CCATTTGCTGCTGCCTCATC Exon 4-F-2 SEQ ID NO:15:CAGTGTCTTGGGCCTCCG Exon 4-R-2 SEQ ID NO:16:CAGAGTTCTCTTCCCTCTGGG
[0059] In addition, this application also provides another nucleic acid detection kit, in which the reagents include nucleic acid probes with identifiable labels.
[0060] In one embodiment, the kit also includes one or more of dNTPs, DNA polymerase, double-stranded specific fluorescent dye, internal control primers, and water, for performing sequencing methods to detect mutations in the IQCN gene associated with fertilization risk.
[0061] In some specific embodiments, the reagents used for PCR amplification of the IQCN gene in the kit are shown in Table 2.
[0062] Table 2
[0063] reagents volume Green, Master, Mix, 2× 25μl RNase-free, water 22μl DNA template 2μl (approximately 50ng) IQCN-F primer 0.5 μl (10 μmol / L) IQCN-R primer 0.5 μl (10 μmol / L) Total 50μl
[0064] When the target of detection is a peptide, this application also provides a peptide detection product to detect the presence of the peptide in the sample to be tested. The peptide detection product includes reagents for the peptide. Specifically, the peptide detection product may be an antibody that specifically recognizes the truncated IQCN protein associated with fertilization risk.
[0065] This application provides an expression vector having the aforementioned nucleic acid for expressing the aforementioned truncated IQCN protein associated with fertilization risk.
[0066] This application provides a recombinant cell comprising the above-described expression vector, which is capable of secreting the above-described truncated IQCN protein associated with fertilization risk.
[0067] This application provides the use of at least one of the above-mentioned nucleic acids, peptides, expression vectors, and recombinant cells in the preparation of drugs for treating male infertility.
[0068] The embodiments of this application will be described in detail below with reference to examples, but this application is not limited to these embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0069] Example 1: Detection of IQCN gene mutations
[0070] This embodiment identified two homozygous pathogenic variants in the IQCN gene in a fertilization failure cohort using whole-exome sequencing (WES). Patient 1 carried a homozygous nonsense mutation in the IQCN gene (c.910C>T; p.Gln304Ter); Patient 2 carried a homozygous frameshift mutation in the IQCN gene (c.2453_2454del; p.Gln818Argfs*9). Figure 1As shown in Figure A, both mutation sites are located on exon 3, and bioinformatics software predictions indicate that mutations at these two sites will cause truncation of the IQCN protein. The amino acid sequences of these two mutation sites are conserved across species, as detailed below. Figure 1 As shown in B.
[0071] Both patients exhibited fertilization failure phenotypes after sperm fertilization, such as... Figure 2 As shown in Figure A, further detection of PLCζ, the main molecular marker for sperm activation of oocytes, revealed that in normal sperm, PLCζ is located at the sperm equator, while in mutant sperm, PLCζ is abnormally located at the sperm neck. The proportion of mutant sperm exhibiting a cone-shaped head and a thinner head was significantly higher than in normal males, as detailed below. Figure 2 As shown in Figure C. Transmission electron microscopy revealed abnormalities in the sperm cell nuclear structure of this patient, and the anchoring of the sperm acrosome to the cell nucleus was not firm, specifically as follows: Figure 2 As shown in D, the perinuclear ring structure is loose, and the proportion of the sperm acrosome in the head is significantly increased, specifically as follows: Figure 2 As shown in E.
[0072] Example 2: Phenotypic Verification Experiment of Iqcn Knockout Mice
[0073] This embodiment involves Iqcn knockout (IQCN) - / - The mice were obtained through a custom-designed process by Cyagen (Suzhou) Biotechnology Co., Ltd. Based on the Iqcn gene sequencing results of the mice, the start and end positions of the Iqcn gene knockout sequence, as well as the knockout length, are detailed below. Figure 7 As shown.
[0074] Iqcn knockout (Iqcn - / - In mice, sperm is associated with fertilization failure and a defective acrosome phenotype. (Iqcn) - / - Mice are completely infertile, specifically as follows: Figure 3 As shown in Figure A, no significant differences were observed in testicular volume and size. Specifically, as follows: Figure 3 B and Figure 3 As shown in C, no significant difference was observed in the total sperm count. Specifically, as follows... Figure 3 As shown in D.
[0075] Further observation of sperm morphology revealed Iqcn - / - The proportion of mouse sperm exhibiting head malformations increased significantly, specifically as follows: Figure 3 E and Figure 3 As shown in F. Transmission electron microscopy of sperm revealed abnormalities in sperm ultrastructure, including discontinuous acrosomes and loose plasma membranes, as detailed below. Figure 3 As shown in G. Staining with the sperm acrosome outer membrane molecular marker Lectin revealed abnormalities in sperm acrosome structure and a significantly increased proportion, as shown in... Figure 3 As shown in H and 3I.
[0076] Furthermore, by using Iqcn knockout mice for insemination, it was found that all fertilization eggs failed after insemination, specifically as follows: Figure 4 As shown in A and 4B. By monitoring the calcium ion oscillations in the oocyte cytoplasm after injection, it was found that sperm injection into mutant mice failed to activate oocytes to produce calcium oscillations, as detailed below. Figure 4 As shown in C. PLCζ staining of sperm revealed that in normal mouse sperm, PLCζ protein was located in the acrosome region of the sperm, while in knockout mice, the PLCζ signal disappeared. Specifically, as shown in Figure C. Figure 4 As shown in D.
[0077] In addition, in Iqcn - / - In mice, Iqcn was found to be located on the sperm collar structure, specifically as follows: Figure 5 As shown in Figure A, Iqcn knockout mice exhibit abnormal sperm collar structure assembly and sperm head malformation, specifically as follows: Figure 5 B Figure 5 C and Figure 5 As shown in D.
[0078] like Figure 6 As shown, the experiment demonstrated that Iqcn knockout mice successfully completed fertilization after assisted oocyte activation therapy. ICSI assisted oocyte activation therapy significantly improved the efficacy of Iqcn knockout mice. - / - Both mice and men carrying homozygous Iqcn variants are effective treatments.
[0079] In summary, this application is the first to discover that Iqcn gene mutations and the corresponding truncated IQCN protein can serve as novel genetic diagnostic indicators for male-derived fertilization failure and infertility, thus providing a new pathway for the treatment of primary male infertility; it can also serve as a biomarker for predicting fertilization risk, thereby assessing the effectiveness of assisted reproductive technology fertilization processes.
[0080] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0081] The above embodiments merely illustrate several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims.
Claims
1. A polypeptide, characterized in that, The polypeptide is a truncated version of the IQCN protein, which is associated with a phenotype of fertilization failure. The truncated version of the IQCN protein lacks a peptide encoded by the exon 4 region of the IQCN gene and at least a portion of the peptide encoded by the exon 3 region. The peptides missing in the truncated version of the IQCN protein include deletions in the wild-type IQCN protein caused by a nonsense mutation in p.Gln304Ter.
2. The polypeptide according to claim 1, characterized in that, The truncated peptides of the IQCN protein also include the deleted peptides of the wild-type IQCN protein formed by the p.Gln818Argfs*9 frameshift mutation.
3. A nucleic acid encoding a polypeptide, characterized in that, The polypeptide is a truncated version of the IQCN protein, which is associated with a phenotype of fertilization failure. The nucleic acid is mutated compared to the wild-type IQCN gene, and the mutation includes at least one of nonsense mutations and frameshift mutations. The mutation is located in the region between the start position of the coding region of the IQCN gene and the end position of exon 3. The peptide segment missing in the IQCN protein truncated version includes the deletion peptide segment of the wild-type IQCN protein formed by the p.Gln304Ter nonsense mutation.
4. The nucleic acid according to claim 3, characterized in that, The mutations include the c.910C>T nonsense mutation.
5. The nucleic acid according to claim 3, characterized in that, The truncated peptides of the IQCN protein also include the deleted peptides of the wild-type IQCN protein formed by the p.Gln818Argfs*9 frameshift mutation.
6. The nucleic acid according to claim 5, characterized in that, The mutations also include the c.2453_2454del frameshift mutation.
7. The application of reagents for detecting IQCN gene mutations or truncated IQCN proteins in the preparation of kits for detecting male infertility, characterized in that, The mutation includes at least one of nonsense mutations and frameshift mutations, the mutation being located in the region between the start position and the end position of exon 3 of the IQCN gene coding region; the truncated IQCN protein, compared to the wild-type IQCN protein, lacks a peptide encoded by the exon 4 region of the IQCN gene and at least a portion of the peptide encoded by the exon 3 region; the mutation includes the c.910C>T nonsense mutation, and the peptides missing in the truncated IQCN protein include the deletion peptides formed by the p.Gln304Ter nonsense mutation in the wild-type IQCN protein.
8. The application according to claim 7, characterized in that, The mutations also include the c.2453_2454del frameshift mutation.
9. The application according to claim 7, characterized in that, The truncated peptides of the IQCN protein also include the deleted peptides of the wild-type IQCN protein formed by the p.Gln818Argfs*9 frameshift mutation.
10. A primer composition product, characterized in that, The primer composition product includes primers for detecting the nucleic acids according to any one of claims 3 to 6.
11. The primer composition product according to claim 10, characterized in that, The primer composition product comprises at least one pair of primers of the sequences shown in SEQ ID NO:1~2, SEQ ID NO:3~4, SEQ ID NO:5~6, SEQ ID NO:7~8, SEQ ID NO:9~10, SEQ ID NO:11~12, SEQ ID NO:13~14 and SEQ ID NO:15~16.
12. A polypeptide detection product, characterized in that, The polypeptide detection product includes a reagent that specifically identifies the polypeptides described in any one of claims 1 to 2.
13. The polypeptide detection product according to claim 12, characterized in that, The polypeptide detection product includes an antibody that specifically recognizes the truncated form of the IQCN protein.
14. A reagent kit for detecting male infertility, characterized in that, This includes the primer composition product according to any one of claims 10-11 and / or the peptide detection product according to any one of claims 12-13.
15. The kit according to claim 14, characterized in that, The kit also includes probes, dNTPs, DNA polymerase, double-stranded specific fluorescent dyes, internal control primers, and one or more of the following in water.
16. An expression carrier, characterized in that, The expression vector has the nucleic acid as described in any one of claims 3 to 6.
17. A recombinant cell, characterized in that, The recombinant cells comprise the expression vector as described in claim 16.
Citation Information
Patent Citations
Application of IQCN as target in diagnosis and treatment of complete fertilization failure
CN115074431A