Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

327 results about "High throughput sequence" patented technology

4 Answers 4. High-throughput sequencing specifically refers to sequencing techniques like Illumina that allow you to sequence massive amounts of DNA at once (hundreds of thousands of strands), as opposed to older techniques such as cloning the cDNA in plasmids, followed by sequencing.

Enhancement and release seedling resource class evaluation method based on environmental DNA polymerization analysis

The invention discloses a method for evaluating enhancement and release seedling resources based on environmental DNA polymerization analysis. The method comprises the following steps: carrying out gridding partition on a target water area, collecting a water sample through a designed sampling scheme, and carrying out DNA extraction and high-throughput sequencing to obtain species sequence information of each sampling point. Sequencing data is subjected to species identification by using a bioinformatics method, released species are identified, a spatial abundance model is established, and a preliminary distribution map is generated. And establishing a DNA degradation kinetic model in combination with water area environmental parameters, and carrying out reverse correction on abundance distribution. And through a resource inversion model coupled with hydrodynamics, analyzing biomass distribution characteristics and migration laws of the release group, and obtaining a resource evaluation result. And finally, a species environment preference model is constructed based on migration path analysis, an optimal release area is matched in a target water area, a scientific scheme including release point locations, opportunities and quantity is generated, and a whole-process technical support and a decision basis are provided for enhancement and release.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI +1

Nucleic acid aptamer for specific recognition of morphine and application of nucleic acid aptamer

The invention provides a nucleic acid aptamer for specific recognition of morphine and application of the nucleic acid aptamer, and belongs to the technical field of biosensing and detection. The nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO: 1. The screening method is based on a Capture-SELEX technology and comprises the key steps that streptavidin magnetic beads are used for fixing an ssDNA library, estradiol, deabietic acid and totarol are introduced to serve as reverse screening substances so as to remove non-specific sequences, and finally the high-specificity aptamer is obtained through high-throughput sequencing and affinity determination. The dissociation constant of the aptamer and morphine is 127.31 nM, and the aptamer shows high affinity and high specificity. The invention further relates to application of the aptamer in preparation of a sensor and a kit for detecting morphine, and a new technical means is provided for rapid detection of morphine.
Owner:INST OF URBAN SAFETY & ENVIRONMENTAL SCI BEIJING ACAD OF SCI & TECH +1

Eukaryotic algae outbreak early warning method and system based on genus-level specific recognition

The invention relates to the technical field of environmental monitoring and water ecological safety, in particular to a eukaryotic algae outbreak early warning method and system based on genus-level specific recognition. The method comprises the following steps: collecting a water body sample at a monitoring position according to a preset sampling plan, collecting an environment measurement value, and respectively obtaining environment parameter data, a water sample sampling identifier and a sampling timestamp; extracting nucleic acid from the water sample at the monitoring position based on the water sample sampling identifier, performing targeted amplification, and performing high-throughput sequencing at the same time to obtain eDNA original sequencing data; therefore, by constructing the eukaryotic algae outbreak early warning process based on genus-level specific recognition, the problems that in a traditional method, sampling disturbance is uncontrollable, sequence judgment precision is insufficient, trend recognition is lagged, and an early warning link is not transparent are solved, and the accuracy, stability and traceability of early judgment of algae outbreak are improved.
Owner:GUANGZHOU MUNICIPAL ENG DESIGN & RES INST CO LTD +1

Intelligent identification method for transgenic crops based on high-throughput sequencing

The invention belongs to the technical field of biological detection, and discloses a transgenic crop intelligent identification method based on high-throughput sequencing, which comprises the following steps: acquiring multi-platform high-throughput sequencing original data and sample metadata, evaluating quality by platforms, dividing according to a sample partitioning rule, and generating a quality-controlled data block set; distributing data blocks to a plurality of parallel computing nodes, synchronously executing technical detection to obtain technical fact fragments, aggregating and supplementing batch statistical information, and generating a technical fact report; matching the judgment rule set, carrying out parallel judgment, triggering expert rechecking on boundary cases, and integrating to generate a supervision judgment conclusion set; the method comprises the following steps: extracting original sequencing reads of all samples, generating a unique hash for each read, constructing a processing track chain, integrating metadata and visual evidence, generating a credible authentication report, dividing different scene versions, and performing targeted distribution; and extracting identification cases for mining and clustering, generating optimization suggestions, and feeding back the optimization suggestions to the quality control rule base and the judgment rule base.
Owner:TIANJIN CUSTOMS IND PROD SAFETY TECH CENT

High-throughput sequencing method and system for monitoring acute lymphocytic leukemia (MRD)

The invention belongs to the technical field of tumor molecular diagnosis and biological information analysis, and relates to a high-throughput sequencing method and system for monitoring acute lymphocytic leukemia (MRD). Through targeted sequencing with a unique molecular identifier and / or a double-chain tag, error modeling based on a background noise spectrum and statistics / machine learning pseudo variation filtering, ultra-deep accurate detection of IG / TCR cloning and related gene low-frequency variation is realized. And an artificial intelligence recurrence risk prediction model is established by combining a time sequence MRD index, cloning diversity and clinical information, and a structured clinical report is output and docked with LIS / HIS. According to the method, the sensitivity and the specificity of ALL minimal residual disease detection can be remarkably improved, dynamic evaluation on leukemia cloning evolution and recurrence risks is realized, and a reliable basis is provided for individualized treatment decision and long-term follow-up visit.
Owner:SICHUAN ACADEMY OF MEDICAL SCI SICHUAN PROVINCIAL PEOPLES HOSPITAL

Application of circular RNA in preparation of cerebral stroke diagnosis product

Provided is an application of a circular RNA in the preparation of a cerebral stroke diagnosis product, belonging to the field of circular RNA medical treatments. Provided is a kit, comprising a reagent and / or test paper and / or gene chip for detecting a circular RNA-circ-Magi1. The nucleotide sequence of the circular RNA-circ-Magi1 is as shown in SEQ ID NO: 1 or SEQ ID NO: 4. Further provided is the application of a detection system for the diagnosis, assisted diagnosis or prognosis evaluation of cerebral stroke, and a detection reagent of the circular RNA-circ-Magi1 in the preparation of a kit, test paper, chip or high-throughput sequencing platform for the diagnosis, assisted diagnosis or prognosis evaluation of cerebral stroke.
Owner:YUANSHENG BIOTECH (TSING DAO) CO LTD

Gene editing-based directional culture method and system for MICP functional bacteria

The invention relates to the technical field of microbial directional cultivation, in particular to a gene editing-based MICP functional bacteria directional cultivation method and system, and the method comprises the following steps: obtaining an original strain library with MICP activity, carrying out strain activation on the original strain library, carrying out high-throughput sequencing on the original strain library, and carrying out gene mining on an initial sequence; the method comprises the following steps: carrying out gene editing on strains in an initial strain library by using a gene editing tool, carrying out shake-flask activation on engineered candidate strains to obtain an activated recombinant bacterium solution, carrying out high-density culture on the activated recombinant bacterium solution by using a pre-constructed fermentation tank, screening out an MICP strain with the optimal function, carrying out continuous passage bacterium function detection on the optimal MICP strain, and carrying out high-density culture on the MICP strain with the optimal function. And based on the MICP functional bacteria, finishing directional cultivation of the MICP functional bacteria based on gene editing. According to the invention, directional cultivation of the MICP functional bacteria is efficiently realized by accurately targeting the key gene with the MICP function, and the MICP functional bacteria are corrected when the problems of function instability and the like exist, so that the more stable MICP functional bacteria are obtained.
Owner:CHONGQING UNIV

Improved method for methylation biomarker generation and analysis

PCT designated stageWO2026043738A1Microbiological testing/measurementHuman DNA sequencingCpG site
Disclosed are methods of preparing a composition of non-naturally occurring DNA, comprising: (a) extracting DNA from a sample of a subject; (b) contacting the extracted DNA or its derivative with a panel of oligonucleotide probes designed to hybridize to a plurality of preselected genomic regions, thereby generating selected DNA, wherein at least 50% of the preselected genomic regions are CpG regions that each comprises at least 3 CpG sites and a CpG density of at least 0.02 CpG / bp, wherein the preselected genomic regions cover 10-500 Mb of sequence space in human genome, wherein the extracted DNA or its derivative or the selected DNA or its derivative is further treated with an agent or a combination of agents that discriminates between methylated and unmethylated cytosines; and (c) performing high-throughput sequencing on the selected DNA or its derivative and generating sequencing reads.
Owner:NATERA INC +4

Microsatellite instability detection method based on single-sample high-throughput sequencing for microsatellite site micro-offset

The invention discloses a microsatellite instability detection method based on single-sample high-throughput sequencing for microsatellite site micro-offset, and relates to the technical field of bioinformatics, and the microsatellite instability detection method comprises the following steps: processing a sequencing sequence of a to-be-detected sample obtained by a high-throughput sequencing technology to obtain a comparison file; according to the method, selection and quality control of microsatellite sites are strictly controlled, a microsatellite instability detection method based on single-tumor sample high-throughput sequencing can be used for analyzing the repetition times of candidate microsatellite site repetition units without depending on a control sample, and meanwhile, the method has very good sensitivity to a sample with relatively large offset, so that the accuracy of the microsatellite instability detection is greatly improved. The method can also be applied to other cancer species with MSI characteristics, and can adapt to detection requirements of different cancer species by adjusting candidate microsatellite loci no matter whether a micro-migration condition exists or not, provide visualization, assist in seeing the degree of microsatellite migration, facilitate manual recheck and reduce misjudgment.
Owner:XIAMEN SPACEGEN BIOTECH CO LTD +1

Liriodendron tulipifera cell nucleus extraction method suitable for CUTTag technology and application of liriodendron tulipifera cell nucleus extraction method

The invention discloses a method and a device suitable for CUAMP. The invention discloses a method for extracting liriodendron tulipifera cell nucleuses by a Tag technology and application of the liriodendron tulipifera cell nucleuses. Hybridized liriodendron tulipifera calluses are used as materials, and protoplasts are released through enzymolysis solution vacuumizing and mild enzymolysis for 1.5 h; the method comprises the following steps: sequentially purifying by using a W5 solution and mannitol, detecting the activity by FDA, cracking by using an NE buffer solution, and washing by using a Wash buffer solution in two steps, thereby obtaining 2 * 10 < 6 >-3 * 10 < 6 > high-purity and high-integrity cell nucleuses. The obtained core is clean in background and complete in membrane structure, and can be directly used for CUTamp; tag is used for building a library, so that the magnetic bead capturing efficiency is improved by 46%, and protein-DNA interaction high-throughput sequencing under the condition of low sample size is realized. The method disclosed by the invention is simple and convenient to operate and good in repeatability, and provides key technical support for epigenetic research of rare tree species such as liriodendron tulipifera.
Owner:NANJING UNIV +1

A method and system for germline mutation detection with low false positive rate

PendingCN122314091AGermline mutationNucleotide
This invention provides a germline mutation detection method and system with a low false positive rate. The system is computer-executed and includes: first, performing a PCR repeat cluster consistency test on sequence alignment files generated from high-throughput sequencing reads, down-regulating the base count weights of inconsistent sites within the cluster; then, based on the sample-specific background error baseline, calculating the variation confidence index of each genomic site using an empirical Bayesian framework to obtain candidate single nucleotide variants (SNPs); obtaining candidate insertion / deletion variants through read clustering and physical verification of insertion fragment lengths; subsequently, performing a dual-engine cross-feedback iteration on the two candidate types until convergence, integrating and filtering, and outputting a structured mutation detection report. This invention significantly reduces the false positive rate of both SNPs and insertion / deletion variants while maintaining sensitivity, and improves the detection capability of complex insertion / deletion variants.
Owner:HANGZHOU BOSHENG BIOTECHNOLOGY CO LTD +2

MeDIP-MSRE-based whole genome methylation detection method

The invention discloses a whole genome methylation detection method based on MeDIP-MSRE, and belongs to the technical field of epigenetics detection. According to the method, methylation immunoprecipitation sequencing and a methylation sensitive restriction enzyme technology are innovatively combined, firstly, a methylation specific antibody is used for conducting immunoprecipitation on sample DNA, and whole genome methylation fragments are enriched; then carrying out enzyme digestion on the enriched product by adopting methylation sensitive restriction enzyme, specifically removing an unmethylated DNA region, and reserving a complete methylation sequence; and finally, constructing a methylation map through high-throughput sequencing. According to the method, traditional hydrosulfite chemical conversion is not needed, DNA damage and base conversion deviation caused by the traditional hydrosulfite chemical conversion are avoided, meanwhile, high sensitivity of MeDIP and high specificity of methylation sensitive restriction endonuclease are fused, and the fidelity, sensitivity and specificity of detection are remarkably improved.
Owner:ZHONGKE JINCHEN BIOTECHNOLOGY (HEFEI) CO LTD

A method for serialization extraction of highly variable exons

PendingCN122290698AInformation densityExon
This invention discloses an efficient RNA data preprocessing method to address the problems of low processing efficiency and low information density in high-throughput sequencing data. Its core steps include: (1) introducing a parallel processing scheme for high-throughput sequence data, rapidly mapping RNA-seq data to a reference genome to generate a BAM file; (2) extracting base sequences and expression levels and storing them as compact PKL format files; (3) extracting all exon position information by parsing the genome annotation file; (4) combining multi-sample expression level data to screen for highly variable exons and constructing a high-information-density feature list based on the sample set; and (5) accurately extracting target sequences from the preprocessed file based on this list. Compared to traditional methods, this innovative approach achieves triple optimization: full-process parallel processing for accelerated computation, high-compression data storage, and adaptive feature selection. Processing speed is increased by 3-5 times, and data volume is reduced by more than 90%, making it suitable for high-throughput RNA-seq data analysis with large sample sizes.
Owner:TIANJIN UNIV

Specific primer group for simultaneously detecting 54 urinary tract infection related pathogens and 26 drug-resistant genes and related detection method thereof

The invention discloses a specific primer group for simultaneously detecting 54 urinary tract infection-related pathogens and 26 drug-resistant genes and a related detection method thereof, which is characterized in that the specific primer group aiming at the 54 urinary tract infection-related pathogens and 26 key drug-resistant genes is designed and is combined with an ultra-multiplex PCR (Polymerase Chain Reaction) and high-throughput sequencing technology, so that the specific primer group can be used for simultaneously detecting the 54 urinary tract infection-related pathogens and 26 key drug-resistant genes, and the specific primer group can be used for simultaneously detecting the 54 urinary tract infection-related pathogens and 26 key drug-resistant genes. One-stop synchronous detection is achieved, the limitation that traditional pathogen culture is long in period and difficult to culture and the detection rate of pathogens is low is broken through, and the defects that in an existing molecular detection technology, target spot coverage is small, and pathogens and drug-resistant genes cannot be analyzed synchronously are overcome. The method provides key technical support for clinically and rapidly formulating a precise anti-infection treatment scheme, reducing blind medication and delaying development of drug resistance, meanwhile, reduces diagnosis and treatment cost and time cost caused by multiple times of detection, and has extremely high clinical application value.
Owner:PEKING UNIVERSITY FIRST HOSPITAL (PEKING UNIVERSITY FIRST CLINICAL MEDICAL COLLEGE) +1

Method for analyzing orange peel microbial community structure difference based on high-throughput sequencing technology

The invention discloses a method for analyzing orange peel microbial community structure difference based on a high-throughput sequencing technology, which comprises the following steps: S1, standardized preparation of a sample: collecting orange peel, opening the orange peel, drying in the shade, turning the orange peel and sun-drying until the water content is less than or equal to 12% to obtain an orange peel sample; s2, crushing the orange peel sample, adding a buffer solution containing an impurity adsorbent, and performing water bath and centrifugation to remove flavonoid and polysaccharide impurities; extracting DNA by adopting a DNA extraction kit, and verifying the integrity and purity of the DNA; s3, designing primers for the specific high-resolution sequencing areas of bacteria and fungi, constructing a PCR system by using high-fidelity enzyme, performing amplification, and constructing a sequencing library after recovering target fragments; and S4, obtaining sequence data through a high-throughput sequencing platform, generating a flora feature table, calculating an Alpha diversity index to evaluate the community richness, analyzing and evaluating the community differentiation degree through Beta diversity, and screening core differential flora by adopting a standard that LDAscore is greater than 2. The efficient analysis on the structure difference of the orange peel microbial community is realized.
Owner:MOUTAI INST

Rabbit-source BCR sequence primer group based on high-throughput single cell V (D) J sequencing and application of rabbit-source BCR sequence primer group

The invention provides a rabbit-source BCR sequence primer group based on high-throughput single cell V (D) J sequencing and application of the rabbit-source BCR sequence primer group. The primer group comprises a specific nested PCR (Polymerase Chain Reaction) primer pair (the sequence is as shown in SEQ ID NO.1-12) aiming at a rabbit BCR heavy chain (IgA / IgE / IgG / IgM) and a light chain (IgK / IgL). Through microfluid single-cell separation, nested PCR amplification and high-throughput sequencing, the naturally paired rabbit BCR full-length V (D) J sequence can be efficiently obtained. According to the rabbit-derived BCR sequence sequencing primer provided by the invention, B cell receptor library information of different tissue sources can be quickly and efficiently obtained. According to the method, paired antibody sequence information can be specifically obtained, B cell response diversity after rabbit immunization vaccine or pathogen infection can be better known, and important data support is provided for design, optimization, effect evaluation and the like of biological products.
Owner:LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)

Medicinal plant genome assembly method and system based on high-throughput sequencing

The invention relates to the technical field of genome assembly, in particular to a medicinal plant genome assembly method and system based on high-throughput sequencing. The method comprises the following steps: acquiring a target sequencing sequence, and screening a function influence sequence; performing repetitive classification on the target sequencing sequence to obtain a non-repetitive sequence cluster and a repetitive sequence cluster, and dividing the repetitive sequence cluster into a functional repetitive sequence and a non-functional repetitive sequence; determining dynamic association strength by combining expression abundance of functional genes, content detection of medicinal components and base overlapping characteristics of adjacent sequences; constructing an association network; and according to the dynamic association strength in the association network, aiming at the functional association type repetitive sequence, the non-functional association type repetitive sequence and the adjacent non-repetitive sequence, respectively carrying out sequence splicing by adopting a differential assembly path to obtain a complete genome assembly result. According to the method, the problems of splicing errors, fragment breakage and redundancy caused by repeated sequences can be solved, and the assembly accuracy and integrity are remarkably improved.
Owner:XIAN BOTANICAL GARDEN SHAANXI PROV

Adeno-associated virus with engineered capsid

ActiveUS12630841B2Genetic material ingredientsVirus peptidesHeart Muscle CellCardiac cell
The present disclosure provides recombinant adeno-associated virus (rAAV) virions with an engineered capsid protein identified using a high-throughput sequencing screen or rational design. In particular, the disclosure provides AAV5 virions and capsid proteins with increased transduction efficiency in cardiac cells, increased cell-type selectivity, and / or other desirable properties.
Owner:TENAYA THERAPEUTICS INC

Molecular beacon and high-throughput sequencing library absolute quantification method thereof

The invention relates to the technical field of biology, and discloses a molecular beacon and a high-throughput sequencing library absolute quantification method thereof, and a fluorescent molecular beacon oligonucleotide (Oligo) sequence comprises a nucleotide chain (Loop chain) of a sequencing library recognition region, a first universal sequence region at the 5'upstream of the nucleotide chain (Loop chain) of the sequencing library recognition region, and a second universal sequence region at the 3 'downstream of the nucleotide chain (Loop chain) of the sequencing library recognition region; 5'of the first universal sequence region is modified into a fluorophore, and 3 'of the second universal sequence region is modified into a quenching group; and a nucleotide chain of the sequencing library recognition region is from an Illumina anmena sequencing platform or an MGI Huazai sequencing platform. The invention comprises a fluorescent molecular beacon for high-throughput sequencing library sequencing before-loading quantification, a sequence applied to a high-throughput sequencing platform and a detection method for library absolute quantification based on the molecular beacon, and overcomes the defects of a current gold standard detection method in technology and efficiency. The quantitative precision of the sequencing library is ensured; meanwhile, the economic and time cost of an actual application end is greatly reduced.
Owner:WUHAN KANGCE TECH CO LTD +1

Preparation method of strand-specific library for rapidly detecting multiple types of RNA (Ribonucleic Acid) and high-throughput sequencing technology

The invention provides a chain-specific library preparation method and a high-throughput sequencing method for rapidly detecting multiple types of RNAs (Ribonucleic Acid). The method comprises the following steps: artificially adding poly A tails at 3'tail ends of multiple RNAs by utilizing poly A polymerase; meanwhile, a polydeoxythymine ribonucleotide primer with deoxyuracil is used for synthesizing single-stranded cDNA under the action of reverse transcriptase, obtained single-stranded cDNA molecules are subjected to a series of reactions and finally subjected to PCR amplification to obtain strand specific libraries of multiple types of RNA, and samples of the libraries can be subjected to computer sequencing.
Owner:SHENZHEN HUADA GENE INST

Sequencing method of immune repertoire

PendingCN121941777AMicrobiological testing/measurementcDNA libraryTarget enrichment
The invention discloses a sequencing method of an immune repertoire, which comprises the following steps: 1) constructing a cDNA library of a sample, the cDNA in the cDNA library being connected with the position information of the cDNA on the sample; 2) enriching cDNA of TCR and / or BCR genes in the cDNA library in a targeted manner to obtain an immune repertoire of the sample; and (3) sequencing the immune repertoire. According to the method disclosed by the invention, targeted enrichment and high-throughput sequencing of TCR and / or BCR sequences are innovatively realized, and gene expression information and spatial position information of each cell in a space are detected at the same time.
Owner:SHENZHEN HUADA SANJIAN QIFA TECHNOLOGY CO LTD

MiRNA related to egg yield of parrot and application of miRNA

The invention relates to the field of molecular markers, and particularly provides miRNA (micro Ribonucleic Acid) related to the egg yield of Melopsis undulata and application of the miRNA. According to the present invention, the high-throughput sequencing technology and the miRNA-mRNA association analysis are adopted to screen the related miRNA for regulating and controlling the parrot egg laying traits, the miRNA is mun-miR-367-3p, the nucleotide sequence of the miRNA is AAUUGCACUUAGCAAUGGUG, and the miRNA can be adopted as the molecular marker related to the parrot egg laying amount, and has important practical application value in the genetic breeding of the parrot egg laying amount traits.
Owner:GUANGDONG ECO ENGINEERING POLYTECHNIC

Method and system for synchronously detecting host chromatin openness and in-vivo microbiome based on transposase

PendingCN121617464ABiostatisticsProteomicsResearch efficiencyEpigenetic Profile
The invention discloses a method and system for synchronously detecting host chromatin openness and in-vivo microbiome based on transposase, and belongs to the technical field of biological sequencing data analysis. According to the method, transposase is used for selectively fragmenting an open chromatin region of a host, and a microbial genome is almost randomly cut, so that synchronous enrichment of host and microbial DNA is realized; after high-throughput sequencing library construction and double-end sequencing, sequencing data is split into host source and non-host source reads through bioinformatics analysis, host chromatin state and microorganism composition are analyzed respectively, and a microorganism-host epigenetic regulation network is constructed; the invention further provides a matched DNA sequencing library and an analysis system, multi-scene research of infectious diseases, intestinal microecology, tumor microenvironment and the like is supported, a public database can be reanalyzed, and potential microbial interaction signals are mined. According to the method, the host-microorganism interaction research efficiency is remarkably improved, and a high-sensitivity and integrated technical scheme is provided for epigenetic regulation mechanism analysis.
Owner:SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI

Specific amplification primer pair for human intestinal archaea flora 16S rRNA amplicon sequencing and application thereof

The invention discloses a specific amplification primer pair for human intestinal archaea flora 16S rRNA amplicon sequencing and application of the specific amplification primer pair, and belongs to the technical field of biology.The primer pair is designed for 16S rRNA high-throughput sequencing and can specifically amplify human intestinal archaea, the length of an amplification product is about 385bp, and the amplification product covers a V4-V5 variable region of a 16S rRNA gene; the invention also optimizes amplification conditions of the primer pair, and experimental results show that the primer pair is superior to a conventional universal primer for bacteria and archaea in the aspect of amplifying species diversity and species abundance of the intestinal archaea, and a standardized method is provided for efficient and accurate amplification of intestinal archaea florae.
Owner:KUNMING UNIV OF SCI & TECH

Hi-C high-throughput sequencing database building method for eucheuma

The invention relates to the technical field of bioinformatics, in particular to a Hi-C high-throughput sequencing database building method for eucheuma. The method comprises the steps of pretreatment, formaldehyde crosslinking, cell lysis and enzyme digestion. The pretreatment comprises the following steps: removing mucus on the surface of the eucheuma in a physical scraping manner; cutting into small blocks, and sequentially cleaning with an interferent cleaning reagent, ethanol and water; the interferent cleaning reagent takes water as a solution and comprises Tris-HCl, EDTA (Ethylene Diamine Tetraacetic Acid) glycerol and PEG (Polyethylene Glycol) 8000. The special Hi-C high-throughput sequencing library building method is provided for the eucheuma, a wax coat on the surface of the eucheuma is treated through a specific pretreatment process, and the level of impurities such as polysaccharides, polyphenols, minerals and various endogenous inhibitors in a sample after subsequent cell lysis can be effectively reduced; and the integrity of the cell nucleus can be maintained as far as possible, so that the eucheuma Hi-C library with extremely high quality (especially high effective data volume) can be constructed.
Owner:BIOMARKER TECH

Crop allergen dynamic baseline construction and credible sharing system based on multi-dimensional heterogeneous data cube

The invention provides a crop allergen dynamic baseline construction and trusted sharing system based on a multi-dimensional heterogeneous data cube, and the system comprises a collection layer which is used for collecting physical information metadata of a to-be-detected sample based on an agricultural environment monitoring terminal, the method comprises the following steps: performing physical detection on a to-be-detected sample through a high-throughput sequencing terminal to generate original mass spectrum data and transcriptome data, and calling meteorological metadata of a region where the to-be-detected sample is located through a third-party meteorological server; the core processing layer is used for generating a dynamic baseline by adopting a central processing server cluster based on the physical information metadata, the original mass spectrum data, the transcriptome data and the meteorological metadata; and the application layer is used for checking the dynamic baseline based on the user query terminal and checking the GLP log based on the checking and auditing terminal. By constructing the multi-dimensional heterogeneous data cube and the dynamic baseline model, standardized data calculation service is provided for safety evaluation of transgenic crops and biotechnology products.
Owner:THE SECOND AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIVERSITY

Positive reporting processing method for pathogen targeted high-throughput sequencing data, computer equipment and readable storage medium

The invention relates to a positive reporting processing method for pathogen targeted high-throughput sequencing data, computer equipment and a readable storage medium. The method is applied to second equipment. Comprising the following steps: sending a pathogen characteristic ciphertext to a first device end, so that the first device end outputs a positive ciphertext prediction intermediate result based on a decision tree model; decrypting an affiliation ciphertext prediction intermediate result returned by the first equipment end through the private key to obtain an affiliation prediction intermediate plaintext, and encrypting the affiliation prediction intermediate plaintext through the public key to obtain an affiliation prediction intermediate ciphertext; sending the positive report prediction intermediate ciphertext to the first equipment end, so that the first equipment end performs pruning processing on the positive report prediction intermediate ciphertext to obtain a target positive report prediction ciphertext; and decrypting the target positive report prediction ciphertext returned by the first equipment end through the private key to obtain a positive report prediction plaintext result, and performing positive report processing on the pathogen high-throughput sequencing data according to the positive report prediction plaintext result. By adopting the method, the positive reporting treatment effect on the pathogen targeted high-throughput sequencing data is improved.
Owner:SANSURE BIOTECH INC +3

A goose mitochondrial genome sequencing primer set and high-throughput sequencing method

PendingCN122279047AFull length effective coverageimprove accuracyGeneticsgenomic DNA
This invention discloses a set of primers and a high-throughput sequencing method for goose mitochondrial genome sequencing. The method comprises (1) extracting genomic DNA from the goose to be tested; (2) performing PCR amplification using the primer set described in this invention; (3) performing high-throughput sequencing; and (4) obtaining the mutation type and haplotype through detection. This invention provides the application of the PCR primers or the goose mitochondrial genome high-throughput sequencing method described in this invention in detecting different mutation types or haplotypes.
Owner:JIANGSU INST OF POULTRY SCI