Method for capturing genome target sequence based on Crispr/cas9 and application thereof in high-throughput sequencing

A genome and high-throughput technology, applied in the biological field, can solve problems such as unsuitable for single-gene genetic disease detection

Pending Publication Date: 2017-09-22
SUZHOU GENESCI CO LTD
View PDF5 Cites 37 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Based on liquid-phase capture high-throughput sequencing technology, the market mainly includes Agilent's whole-exon capture kit, Roche's solid-phase hybridization method and liquid-phase hybridization method. Although the DNA sequences captured by these products are only the whole genome Compared with whole genome sequencing, it has great advantages in terms of cost and time spent in some areas, but the price of each sample is still more than several thousand yuan, which is beyond the affordability of ordinary people and is not suitable for large-scale screening. Detection of monogenic genetic diseases
Moreover, the disadvantage of these technologies is that a large number of long fragments (150-200bp) of DNA need to be synthesized, amplified by PCR, and transcribed into biotin-modified RNA.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for capturing genome target sequence based on Crispr/cas9 and application thereof in high-throughput sequencing
  • Method for capturing genome target sequence based on Crispr/cas9 and application thereof in high-throughput sequencing
  • Method for capturing genome target sequence based on Crispr/cas9 and application thereof in high-throughput sequencing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1. Method for capturing target gene sequence in genome based on Crispr / cas9

[0055] The following example takes the BRCA1 and BRCA2 genes in the genomic DNA of human 293T cells as an example.

[0056] According to the exons of BRCA1 gene (GI: 262359905) and BRCA2 gene (GI: 568815585) as the target gene sequence.

[0057] 1. Preparation of transcription RNA template

[0058] 1. Design and synthesis of primers for transcription RNA template

[0059] According to the exons of BRCA1 gene (GI: 262359905) and BRCA2 gene (GI: 568815585) in the target genome, 63 BRCA1 gRNA (sequence 158-220) and 96 BRCA2 gRNA (sequence 221-313) were designed, and these gRNAs can guide CAS9 enzyme divides all exons of BRCA1 and BRCA2 into multiple fragmented products of 100-300bp in size.

[0060] Based on 63 BRCA1gRNA and 96 BRCA2gRNA, respectively design the amplification primers for 63 BRCA1 exon transcription RNA template and 93 BRCA2 exon transcription RNA template amplification primers as f...

Embodiment 2

[0117] Example 2. High-throughput sequencing target sequence

[0118] 1. High-throughput sequencing library construction

[0119] 1. End repair, phosphorylation and adding dA tail

[0120] (1) Add the following reagents to the sterilized EP tube as shown in Table 4:

[0121] Table 4 shows the end repair, phosphorylation and dA tail system

[0122]

[0123] (2) Use a pipette to mix gently, and centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0124] (3) Put the reaction tube in the PCR machine, and run the program in Table 5 to obtain the reaction product:

[0125] table 5

[0126]

[0127] 2. Connector connection

[0128] (1) Add the following components to the reaction product obtained in step 1:

[0129] Table 6

[0130]

[0131] T4 DNA Ligase, NEB (Beijing) Co., Ltd., NEB (Beijing) Co., Ltd., M0202L.

[0132] Y connector (UAF / AI1)

[0133] UAF AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T

[0134] AI1GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for capturing a genome target sequence based on Crispr / cas9 and application thereof in high-throughput sequencing. The method for capturing a target gene sequence from a genome DNA on the basis of a Crispr / cas9 system comprises the steps that 1, a plurality of gRNAs are designed and synthesized according to the target gene sequence; 2, the multiple gRNAs and a cas9 enzyme are adopted for performing a cleavage reaction on the genome DNA, and a cleavage product containing multiple 100-300 bp fragmentation products is obtained; 3, the multiple 100-300 bp fragmentation products in the cleavage product are captured. On the basis of the CRISPR gene, the target sequence is edited and captured, and the method can be used for high-throughput sequencing and is applicable to screening of specific population with family heredity, the public physical examination market and the like.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and particularly relates to a method for capturing genome target sequences based on Crispr / cas9 and its application in high-throughput sequencing. Background technique [0002] CRlSPR / Cas (Clusteredregularly interspaccd short palindromic repeats / CRlSPR-associatednuclease) technology is a new DNA targeted editing tool developed in 2013, and was named one of the top ten scientific breakthrough technologies in 2013 by the American Science Journal. Cas9 nuclease, S.pyogenes, is an RNA-mediated nuclease that can catalyze the cleavage of double-stranded DNA at specific sites. The cutting site is located at 3 bases of the upstream sequence of NGG PAM (Protospacer Adjacent Motif). The NGG of the PAM sequence must be connected behind the target and located on the strand of DNA complementary to the gRNA. Its DNA-specific recognition is achieved by a short hairpin RNA structure, while DNA cutting is performed by C...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/90C40B50/06C12Q1/68
CPCC12N9/93C12N15/113C12N15/907C12N2310/10C12Q1/6869C12Y603/02019C40B50/06C12Q2535/122
Inventor郭良让王德华张佩琢
OwnerSUZHOU GENESCI CO LTD