40results about How to "Good amplification efficiency" patented technology

The invention provides a method, a kit and an oligonucleotide for detecting relative expression of the MLL5 gene in a sample, and all relate to an upstream primer MLL5-F for detection, an upstream primer MLL5-R for detection and a probe MLL5-Probe for detection, and an upstream primer ABL-F for the internal reference gene ABL, a downstream primer ABL-R and a probe ABL-Probe. The relative expression of the MLL5 gene in clinical samples can be rapidly detected. The invention can be applied to evaluation of therapeutic effect and prediction of prognosis.

The invention discloses a method for detecting bursaphelenchus xylophilus by a loop-mediated isothermal amplification reaction, which belongs to the field of molecular detection of bursaphelenchus xylophilus. The SYG-2 gene of bursaphelenchus xylophilus is taken as a target gene, a LAMP primer group with high specificity on the bursaphelenchus xylophilus is obtained by designing and screening, and the LAMP primer group can specifically distinguish the bursaphelenchus xylophilus and bursaphelenchus mucronatus. The LAMP primer group is used for establishing a LAMP rapid detection method for bursaphelenchus xylophilus, and the method can rapidly and accurately discriminate whether a sample has the bursaphelenchus xylophilus or not. The invention further discloses a LAMP detection kit for the bursaphelenchus xylophilus. The method has the advantages of high specificity, simple operation, short time consuming, and low cost, and is suitable for rapid detection of bursaphelenchus xylophilus carried by monochamus alternates and suitable for monitoring the generation and propagation of the bursaphelenchus xylophilus disease.

The invention discloses a primer for detecting ATRX (X-linked alpha thalassemia mental retardation syndrome) base mutation. The primer is characterized by comprising an ATRX gene No. 7 intron mutationregion; with adoption of a Sanger sequencing technique, the primer can be used for detecting a mutation site rapidly. A detection result completed by adopting the primer is accurate, so that the mutation of a hot spot region can be diagnosed in an auxiliary manner, and the result can also serve as a standard for judging the affection of the mutation site on a relevant disease. The inactive mutation of an ATRX gene can cause absent expression of an ARTX protein, causing unstable telomeres and endless division of cells. Therefore, the detection for ATRX gene mutation is an urgent task for identification and treatment of diseases.

The invention discloses a kit for detecting a ZNF 198-FGFR1 fusion gene in a patient with 8p11 EMS. The kit comprises a primer for amplifying the ZNF 198-FGFR1 fusion gene and a probe, and a primer and a probe of a reference gene ABL. According to the kit, the existence of the ZNF 198-FGFR1 fusion gene and the expression amount of the ZNF 198-FGFR1 fusion gene in the body of the patient with the EMS can be detected quickly. The detection result completed by utilizing the kit is accurate and flexible, can diagnose the EMS in an assistant manner and determine a fusion type, has a strong guiding function on using a targeted target medicament in the early stage of disease, and has important significance in performing in-time intervention treatment, regulating a treatment scheme, evaluating a treatment effect and predicting prognosis.

The invention discloses a method, primer and detection kit for detecting TERC gene whole exome sequence mutation of a dyskeratosis congenita patient. The primer comprises forward and reverse primers amplifying a TERC whole exome sequence and a pair of sequencing primers. According to the method, primer and detection kit for detecting TERC gene whole exome sequence mutation of the dyskeratosis congenita patient, Touch-down PCR amplification and Sanger sequencing are combined so that the mutation situation of the TERC whole exome sequence in the body of the dyskeratosis congenita patient can befast detected, and a TERC gene has two mutation sites of C408G and GC107-108AG.

The invention discloses a method and primers for detecting a fifth exon mutation site of a RUNX1 gene. The method and the primers comprise a forward primer, a reverse primer and a pair of sequencing primers for amplifying the fifth exon mutation site of the RUNX1 gene. The method combines a Touch-down PCR amplification and a Sanger sequencing method, can rapidly detect mutation conditions of the fifth exon mutation site of the RUNX1 gene in an acute myeloid leukemia patient body.

The invention discloses a method, a primer and a kit for detecting 8th and 25th whole exons of a TEX11 gene, wherein the primer and the kit respectively comprise two pairs of forward and reverse primers and two pairs of sequencing primers which are used for amplifying and covering sequences of the 8th and 25th whole exons of the TEX11 gene. On the basis of adoption of a Sanger sequencing method, the two pairs of sequencing primers can be utilized for quickly detecting mutation condition of the sequences of the 8th and 25th whole exons of the TEX11 gene of a patient with azoospermia, wherein a main mutation site M171V on the 8th exon and a main mutation site A698T on the 25th exon are contained. The primer and the method which are disclosed by the invention are accurate and efficient in detection.

The invention discloses a method for detecting relative expression levels of TBLR1-RAR alpha and PRKAR1A-RAR alpha fusion genes by using a fluorescent quantitative PCR technology. The method uses a primer and a probe with specificity. The method can be used for detecting expression levels of the fusion genes such as TBLR1-RAR alpha, PRKAR1A-RAR alpha and PRKAR1A-RAR alpha inside acute promyelocytic leukemia (APL) patients. The method can be used as one of evidences for selection and formulation of APL individual treatment schemes, and is significant for adjusting the treatment schemes, evaluating treatment effect, predicting prognosis and preventing clinical recurrence.

The invention provides oligonucleotide and detection method for detecting the expression level of a NPM1-RARa fusion gene in the body of a patient suffering from acute promyelocytic leukemia. The oligonucleotide comprises a primer and probe for detecting the NPM1-RARa-1 and NPM1-RARa-2 fusion genes. A real-time fluorescence PCR technology and a double-standard curve method using a detection primerand probe of a target gene and a reference gene are adopted, so that expression levels of fusion genes NPM1-RARa-1 and NPM1-RARa-2 in the body of the patient suffering from APL can be detected. The detection time can be effectively saved, and the detection precision is improved. Besides, the oligonucleotide and the detection method can be used as one of bases for selecting and formulating an APLindividualized treatment scheme, have important significance for adjusting a treatment scheme, evaluating the treatment effect, predicting prognosis and intervening treatment in time to avoid hematological recurrence, and are convenient for clinically performing individualized treatment.

The invention discloses a method for detecting congenital renal diabetes insipidus AVPR2 gene mutation, a primer and a kit. The primer and the kit respectively comprise an amplification primer and a sequencing primer for congenital renal diabetes insipidus AVPR2 gene whole exons. Based on PCR amplification and Sanger sequencing, the congenital renal diabetes insipidus AVPR2 gene mutation conditioncan be rapidly detected.

The invention discloses a primer and method for detecting two base mutations of FGD1 659+27T>C and 482-113C>T; a Sanger sequencing technology is adopted and can be used for rapidly detecting the mutation sites. The results of detection completed by means of the primer and the method are accurate, and gene mutation of patients suffering from Aarskog syndrome can be assisted to be diagnosed. By means of the primer and method, whether or not generated gene mutation causes the Aarskog syndrome is judged and analyzed conveniently, and important reference significance is achieved for clinical differentiation and diagnosis on the Aarskog syndrome.

The invention discloses a primer and a method for detecting gene mutation of mitochondria related drug-induced deafness. The primer comprises primers which amplify a mitochondria mtDNA12SrRNA gene sequence, wherein a Sanger sequencing technology and sequencing primers are adopted. According to the method, A1555G and C1494T mutation in a patient can be detected quickly. The detection result is accurate and the method can be used as an effective method of diagnosing hereditary hearing loss of a new born in an auxiliary agent. The primer and method have important reference meaning in early detection and treatment of the disease, rational drug use in infant period and individual treatment, and avoid the tragedy of deafness induced by one needle.

The invention discloses a free DNA preservation reagent which comprises ethylenediamine tetraacetic acid potassium salt (EDTA (ethylene diamine tetraacetic acid) salt), formaldehyde, glycine, Tris- HCL, sodium chloride and deionized water. The cleaning agent comprises the following components in percentage by mass: 1.5-5% of the ethylenediamine tetraacetic acid potassium salt, 0.1-1% of the formaldehyde, 1-3% of the glycine, 5-10% of the Tris-HCL, 1-20% of the sodium chloride and the balance of deionized water. In addition, the invention also discloses a preparation method of the free DNA preservation reagent. The free DNA preservation reagent disclosed by the invention can be used for preserving complete DNA fragments and can be preserved for at least 3-5 days at room temperature, so that the preservation and transportation costs are greatly reduced.

The invention discloses a method and primers for detecting mutation of the NOP10 gene exon 2 mutation site R34W(C100T) sequence. The primers include the forward and reverse primers for amplifying the NOP10 gene exon 2 mutation site R34W(C100T) sequence and a pair of sequencing primers. By combining Touch-down PCR amplification and Sanger sequencing, the mutation of the NOP10 gene exon 2 mutation site R34W(C100T) sequence in the body of a patient suffering from dyskeratosis congenita can be rapidly detected.

The invention discloses primers for detecting c.55C>G and c.238C>T base mutation of an ATP8B1 gene. The primers comprise primers for amplifying c.55C>G and c.238C>T sites of the ATP8B1 gene. By adopting a Sanger sequencing technology, the primers can be used for rapidly detecting c.55C>G and c.238C>T site mutation of the ATP8B1 gene in the body of a patient with progressive familial intrahepatic cholestasis type 1. The detection result completed by using the primers is accurate, and the primers have important reference significance for clinical differential diagnosis of the patient with progressive familial intrahepatic cholestasis type 1.

The invention discloses a method and primers for detection of a polymorphic mutation site of a seventh exon of a WT1 gene. The primers comprise forward and reverse amplification primers for amplification of mutational sites of the seventh exon of the WT1 gene and a pair of sequencing primers. Touch-down PCR amplification and Sanger sequencing method are combined to accurately and specifically detect mutation of the seventh exon of the WT1 gene of patient with leukemia, especially acute myeloblastic leukemia.

The invention discloses primers and method for detecting the mutation of loci where 3821C is larger than T, 3839G is larger than A, 3841G is larger than A and 3895C is larger than T in the region of aJAK3 gene intron 2. The primers include (i) the primers for amplifying the sequence of the JAK3 gene intron 2, and the Sanger sequencing technology and the sequencing primers are adopted. By means ofthe Sanger sequencing technology, the mutant loci can be rapidly found. The method is accurate in detection result and can assist in detecting the mutation conditions of the region. The mutation of the loci where 3821C is larger than T, 3839G is larger than A, 3841G is larger than A and 3895C is larger than T in the region of the JAK3 gene intron 2 can be rapidly detected. The method is accuratein detection result and has reference significance in exploring pathogenesis of diseases.

The invention provides oligonucleotide and a method for detecting ABCG2 gene relative expression quantity in a sample. According to a double-standard-curve method, quantitative standard curves of a reference gene actin and an ABCG2 target gene are constructed respectively by combining a real-time fluorescence PCR technology with a Tapman probe; and expression of ABCG2 in the body of a testee is detected. According to the invention, accurate detection is realized; the test sensitivity is high; and the operation is simple and convenient. A reference and basis can be provided for formulation of chemotherapy regimens of lung cancer patients and individualized treatment of the patients is facilitated.

The invention discloses a method and primers for detecting an ASXL1 gene c. 1934dupG mutation site. The primers include forward and reverse amplification primers for amplifying the ASXL1 gene c. 1934dupG mutation site and a pair of sequencing primers. Through combining Touch-down PCR amplification and Sanger sequencing, the mutation situation of the ASXL1 gene c. 1934dupG site in a patient with acute myeloid leukemia can be accurately and specifically detected.

The invention discloses primers, kit and method for detecting the 12902T>C mutation in an intron 4 region of a phytosterolemia-related gene ABCG8. Through a Sanger sequencing technology, a mutation site in this region can be quickly found. The discovery of the mutation site facilitates the determination and analysis whether the ABCG8 gene mutation causes phytosterolemia and helps to identify the cause of the disease.

The invention discloses primers and a method for detecting mutation of GNAS basic group. The primers comprise hotspot mutation regions of No.5 exons of a GNAS gene; a Sanger sequencing technique is adopted to detect mutation locus quickly. A detection result obtained by the invention is accurate and can assist in diagnosing mutation conditions in the hotspot regions. By utilizing the primers and the method disclosed by the invention, the mutation of the No.5 exons 12384GCC greater than GCT and 12450ATC greater than ATT of the GNAS gene are found for the first time; the discovery of the mutation loci favorably judges and analyzes whether the generated gene mutation can cause related disease or not and assists in screening the cause of diseases.

The invention provides an SSR primer group, which comprises 6 pairs of SSR primers, namely scssr07759, HVM68, Bmac0030, scssr10148, scssr03907 and Bmag0120. The invention also provides a method for malt variety identification by virtue of the SSR primers, wherein the method comprises the following steps: extraction of DNA of a sample of experimental variety, PCR amplification by virtue of the SSR primers, polyacrylamide gel electrophoresis as well as silver staining and SSR spectrum band analysis. The method, through SSR spectrum band analysis after the PCR amplification of the 6 pairs of SSR primers, can be used for identifying experimental malt variety and known malt variety and can be used for constructing a malt variety database. Through malt variety identification by virtue of the specific SSR primer group, the method can be used for rapidly identifying various malt varieties, and the method has the advantages of being rapid and accurate, and convenient in operation.

The invention discloses a detection primer set for LINE-1 and application of the detection primer set. The primer set comprises primers as shown in SEQ ID NO. 1, 2, 7 and 8. The primer set provided byembodiments of the invention has good specificity and excellent amplification efficiency. The primer set can be used for early screening, recurrence diagnosis and treatment monitoring of various tumors, and has the advantages of simplicity, convenience, rapidness and accuracy.

The invention discloses primers and method for detecting the 79th site, 208th site and 435th site of a CDA gene. The primers comprise a forward primer, a reverse primer and a sequencing primer used for amplification of the 79th site, 208th site and 435th site of the CDA gene. The primers and the method disclosed by the invention are used for quickly detecting Lys27Gln, Ala70Thr and Thr145Thr of the CDA gene and provide a reference for a patient about using of difluorine nuclear anti-metabolism anti-tumor medicine gemcitabine.

The invention provides a glucose-6-phosphate dehydrogenase deficiency disease detection kit and a primer group. The primer group is characterized in that a PCR (Polymerase Chain Reaction) primer is designed by utilizing bioinformatics knowledge and related bioinformatics software according to nucleotide sequence information of c.1376 and c.1388 loci of a glucose-6-phosphate dehydrogenase deficiency disease-causing gene G6PD, which can be retrieved in a public database, and by utilizing Primer ExpressSoftware5.0 software; the primers comprise amplification primers G6PD-F and G6PD-R and sequencing primers M13F and M13R, and the base sequence of the primers is G6PD-F: TGCCAAACGACGGTTAGTGCAGGGGTCGTCCTTA, the base sequence of the primers is TGCAAACGACGGTTAGTGCAGGGGTCGTCCTTA, and the base sequence of the primers is TGCAAACGACGGTTAGTGCAGGGTCGTCCTTA G6PD-R: AAGGTATGACCATGCACCTGCATAATATAGGGGGAT, G6PD-R: AAGGTATGACCATGCACCTGCATAATATGGGAT The M13F is TGCCAAACGACGGCCAAAGTC, and the M13F is M13R: AGCTATGACCATGAAC, M13R: Carrying out PCR amplification on the to-be-detected sample by adopting a multiplex PCR method; the method comprises the following steps: constructing an amplicon library by using a PCR amplification product, preparing an ISP template, sequencing on an IonTorrentPGM system, and analyzing a related sequencing sequence by using software. According to the invention, primers for amplifying c.1376 and c.1388 sites of the G6PD gene are designed, and a stable amplification system is constructed by adopting a PCR (Polymerase Chain Reaction) technology. The amplification efficiency can be optimal by adjusting reaction conditions such as primer concentration, annealing temperature and the like.

The invention discloses a kit for detecting relative expression of PDGFR alpha gene by real-time fluorescent quantitative PCR. The kit comprises an RNA extraction reagent, a reverse transcription reagent, a detection system PCR reaction solution, a positive control substance and a negative control substance, wherein the detection system PCR reaction solution comprises sense and anti-sense primersPDGFR alpha-F and PDGFR alpha-R and probe PDGFR alpha-Probe for detecting target genes, and primers beta-actin-F and beta-actin-R and probe beta-actin-Probe for detecting reference gene beta-actin. The kit for detecting relative expression of PDGFR alpha gene by real-time fluorescent quantitative PCR combines real-time fluorescent PCR technology with a Taqman probe to separately construct quantitative standard curves of the reference gene beta-actin and the target gene PDGFR alpha by using a double standard curve method, and can detect the expression level of PDGFR alpha relative to the internal reference gene in a subject.

The invention relates to primers and a method for detecting TREX1 gene mutation. The primers comprise primers for amplifying whole exon sequences of a TREX1 gene, and a Sanger sequencing technology and sequencing primers are adopted. According to the invention, the mutation of the whole exons of the TREX1 gene can be rapidly detected. The detection result obtained by the invention is accurate, theAicardi-Goutieres syndrome can be diagnosed in an auxiliary manner, and the primers and the method have important reference significance for diagnosis and prognosis of diseases.

The invention provides a detection primer for MTB, and belongs to the technical field of gene detection. The detection primer comprises a forward primer, a reverse primer and an MGB probe primer for amplifying an MTB gene. A digital PCR technology is adopted to detect the MTB, and the designed primers and the MGB probe can expand to be suitable for other digital PCR systems; and the detection primer can detect a low-concentration MTB nucleic acid sample, has very high specificity and sensitivity and a high primer amplification efficiency, greatly improves the detection rate of the MTB, and provides a reliable method for clinical detection of the MTB.

The invention discloses a primer, a method and a kit for detecting whole exon mutation of an SMAD4 gene. The specific primer comprises forward and reverse primers for amplifying and covering all 12 exons of the SMAD4 gene; according to the invention, the Sanger sequencing method is adopted to detect the mutation of the whole exons of the SMAD4 gene, and the mutation of the whole exons of the SMAD4 gene can be rapidly detected. The detection result completed by the method is accurate, whether the SMAD4 gene is mutated or not can be specifically identified, and the accuracy and uniqueness of the determination result are ensured; the kit can assist in disease diagnosis and improve risk assessment of diseases, and has important reference significance for early intervention and early treatment.

The invention discloses a primer for detecting HLA-B*5701 typing. The primer comprises a primer for amplifying HLA-B*5701 and a sequencing primer, and a polymerase reaction-direct sequencing method (PCR-SBT) is adopted and can be used for rapidly detecting HLA-B*5701 alleles related to liver injury caused by flucloxacillin medication. The detection result completed by the method is accurate, and the method has important reference significance for the clinical medication safety of the flucloxacillin.