Method and primers for detecting mutation of NOP10 gene exon 2 mutation site R34W(C100T) sequence
A technology of NOP10-R and NOP10-F, which is applied in the fields of life science and biology, can solve the problems of single and low abundance of non-specific amplification products, and achieve the effect of simple operation, low cost and improved amplification specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] The primers for detecting the whole exon sequence of the No. 2 exon of the NOP10 gene include: forward and reverse primers for amplifying the whole exon sequence of the No. 2 exon of the NOP10 gene; its base sequence is:
[0041] NOP10-F: TGTAAAACGACGGCCAGTTTGACCATTGCATCTTCTATTTTC
[0042] NOP10-R: AACAGCTATGACCATGTCCCCTTTATGGGTGATGCCAC.
[0043] Preferably, the primers also include a pair of sequencing primers, the base sequence of which is
[0044] M13-F: TGTAAAACGACGGCCAGT
[0045] M13-R: AACAGCTATGACCATG.
[0046] In the detection, first use the above forward and reverse primers to amplify the whole exon sequence of exon No. 2 of the NOP10 gene to obtain the amplified product, then use the above pair of sequencing primers to sequence the amplified product to obtain the amplified The gene sequence of the augmented product.
[0047] The kit for detecting the whole exon sequence of exon No. 2 of NOP10 gene, including: sample DNA extraction reagent (for example, use t...
Embodiment 2
[0060] Detection process:
[0061] (1) Use the blood DNA extraction kit (Tiangen Biology) to extract the genomic DNA in the blood sample:
[0062] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed.
[0063] 2) Add 20 μl proteinase K solution and mix well.
[0064] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0065] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0066] 5) Put the solution and floc...
Embodiment 3
[0091] The nucleic acid detection kit of the present invention is used to detect clinical samples.
[0092] 20 anticoagulant blood samples from patients with dyskeratosis congenita were taken for inspection, and the genomic DNA in the samples was extracted according to the detection process described in Example 2, and reagents were prepared and tested.
[0093] Add 2 ul of the genomic DNA solution of each sample extracted according to the detection process described in Example 2 into the PCR reaction solution of the detection system. Do positive, negative and blank controls at the same time. Detect with common PCR instrument, the time is 160 minutes.
[0094] Electrophoresis results such as figure 1 As shown, it shows that the primers NOP10-F and NOP10-R of the present invention can effectively amplify blood samples, and the band is single.
[0095] The NOP10 gene R34W forward sequencing results of sample 1 are as follows: figure 2 As shown, it is wild type, and no R34W m...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap