Method and primers for detecting fifth exon mutation site of RUNX1 gene
A technology of mutation sites and exons, which is applied in the fields of life science and biology, can solve the problems of low abundance and singleness of non-specific amplification products, and achieve the effects of low cost, simple operation, and improved amplification specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Primers for detecting the mutation site of exon 5 of RUNX1 gene, including: forward and reverse primers for amplifying the mutation site of exon 5 of RUNX1 gene; its base sequence is:
[0045] RUNX1-exon5-F: ATTAATGATTGGTTATTCAACAG
[0046] RUNX1-exon5-R: AATCTGAGACATGGTCCCTG.
[0047] Preferably, the primers also include a pair of sequencing primers, the base sequence of which is
[0048] RUNX1-exon5-S-F: ATTAATGATTGGTTATTCAACAG
[0049] RUNX1-exon5-S-R: AATCTGAGACATGGTCCCTG.
[0050] In the detection, first use the above-mentioned forward and reverse primers to amplify the mutation site of exon 5 of the RUNX1 gene to obtain the amplified product, and then use the above-mentioned pair of sequencing primers to sequence the amplified product to obtain the amplified product gene sequence.
[0051] The kit for detecting the mutation site of exon 5 of the RUNX1 gene, including: sample DNA extraction reagent (for example, use the kit of Tiangen Bio to extract sample DNA)...
Embodiment 2
[0063] Detection process:
[0064] (1) Use blood DNA extraction kit (Tiangen Bio) to extract genomic DNA from blood samples:
[0065] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed.
[0066] 2) Add 20 μl proteinase K solution and mix well.
[0067] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0068] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0069] 5) Add the solution and flocculent precip...
Embodiment 3
[0095] The nucleic acid detection kit of the present invention is used to detect clinical samples.
[0096] Twenty cases of anticoagulated blood samples from patients with acute myeloid leukemia (AML) were taken for inspection, and the genomic DNA in the samples was extracted according to the detection process described in Example 2, and reagents were prepared and tested.
[0097]Add 2 ul of the genomic DNA solution of each sample extracted according to the detection process described in Example 2 into the PCR reaction solution of the detection system. Do positive, negative and blank controls at the same time, a 96-well ordinary PCR machine can detect 46 samples at the same time, each sample is repeated twice, a positive control, a negative control and a blank control. The detection time is 160 minutes.
[0098] After the amplification product of genomic DNA of each sample is sequenced twice by Sanger, compare the sequencing sequence obtained by the PCR amplification product ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com