Glucose-6-phosphate dehydrogenase deficiency detection kit and detection method
A technology of phosphate dehydrogenase and detection kit, which is applied in the field of biochemistry, can solve the problems of poor repeatability of some results in instrument specifications and reagent selection diversity, obstacles to extensive development, and limited clinical application, so as to reduce mental burden and improve Health economic benefits, the effect of making up for the high false positive rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0022] This embodiment provides a glucose-6-phosphate dehydrogenase deficiency detection kit and a primer set; the primer set uses bioinformatics knowledge and related bioinformatics software to detect glucose -6-Phosphate dehydrogenase deficiency pathogenic gene G6PD c.1376, c.1388 site nucleic acid sequence information, use PrimerExpressSoftware5.0 software to design PCR primers; Described primers include amplification primers G6PD-F, G6PD-R And sequencing primers M13F, M13R, its base sequence is:
[0023] G6PD-F: TGCCAAACGACGGTTAGTGCAGGGGTCGTCCTCTA;
[0024] G6PD-R: AAGGTATGACCATGCACCTGCCATAAATATAGGGGAT;
[0025] M13F: TGCCAAACGACGGCCAAAGTC;
[0026] M13R: AGCTATGACCATGAAC;
[0027] Multiplex PCR method is used to perform PCR amplification on the samples to be detected; the PCR amplification products are used to construct the amplicon library, and ISP (IonSphere TM Particles, Ion microspheres) templates were prepared, sequenced on the IonTorrentPGM system, and related s...
Embodiment 2
[0034] This embodiment also provides a method for detecting human G6PD gene using the kit of the present invention, which includes the following steps: using the primers in the kit containing specific sequences to PCR amplify the DNA of the human genome; hybridizing the amplified DNA; Detection of bound DNA on the surface of the gene chip.
[0035] The present invention also provides a detection method of the glucose-6-phosphate dehydrogenase deficiency detection kit, which also includes a detection system PCR amplification reaction solution and a sequencing system reaction solution.
[0036] Further, the detection system PCR amplification reaction solution also includes 2×PCRBuffer, dNTPs and KODFX DNA polymerase; the sequencing system reaction solution also includes EDTA, absolute ethanol, 75% ethanol, HIDI and BigdyeTerminatorV3.1; the The sequencing system reaction solution also includes a sequencing purification solution, which includes exonuclease I and calf small intest...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com