Glucose-6-phosphate dehydrogenase deficiency detection kit and detection method

Abstract

The invention provides a glucose-6-phosphate dehydrogenase deficiency disease detection kit and a primer group. The primer group is characterized in that a PCR (Polymerase Chain Reaction) primer is designed by utilizing bioinformatics knowledge and related bioinformatics software according to nucleotide sequence information of c.1376 and c.1388 loci of a glucose-6-phosphate dehydrogenase deficiency disease-causing gene G6PD, which can be retrieved in a public database, and by utilizing Primer ExpressSoftware5.0 software; the primers comprise amplification primers G6PD-F and G6PD-R and sequencing primers M13F and M13R, and the base sequence of the primers is G6PD-F: TGCCAAACGACGGTTAGTGCAGGGGTCGTCCTTA, the base sequence of the primers is TGCAAACGACGGTTAGTGCAGGGGTCGTCCTTA, and the base sequence of the primers is TGCAAACGACGGTTAGTGCAGGGTCGTCCTTA G6PD-R: AAGGTATGACCATGCACCTGCATAATATAGGGGGAT, G6PD-R: AAGGTATGACCATGCACCTGCATAATATGGGAT The M13F is TGCCAAACGACGGCCAAAGTC, and the M13F is M13R: AGCTATGACCATGAAC, M13R: Carrying out PCR amplification on the to-be-detected sample by adopting a multiplex PCR method; the method comprises the following steps: constructing an amplicon library by using a PCR amplification product, preparing an ISP template, sequencing on an IonTorrentPGM system, and analyzing a related sequencing sequence by using software. According to the invention, primers for amplifying c.1376 and c.1388 sites of the G6PD gene are designed, and a stable amplification system is constructed by adopting a PCR (Polymerase Chain Reaction) technology. The amplification efficiency can be optimal by adjusting reaction conditions such as primer concentration, annealing temperature and the like.

Description

technical field [0001] The invention relates to the technical field of biochemistry, in particular to a glucose-6-phosphate dehydrogenase deficiency detection kit and detection method. Background technique [0002] G6PD deficiency is the most common hereditary enzyme deficiency disease, commonly known as favism, affecting about 400 million people worldwide. my country is one of the high-incidence areas of this disease. There are about 100 million patients with G6PD deficiency, mainly distributed in the provinces south of the Yangtze River, especially in Hainan, Guangdong, Guangxi, Yunnan, Guizhou, Sichuan and other provinces. The disease is usually asymptomatic, but the patient's red blood cells are easily damaged by certain substances and hemolysis occurs, leading to hemolytic anemia, drug-induced hemolysis, infectious hemolysis, favism, etc., the most serious is neonatal hemolysis, leading to Kernicterus thus develops into lifelong mental retardation or death in children....

AI Technical Summary

Problems solved by technology

Among women with G6PD gene deficiency, carriers of the disease-causing gene (heterozygotes) are common in the population, and the enzyme activity is variable; but female heterozygotes will pass the disease-causing gene to the next generation, such as during their pregnancy, childbirth, Acute hemolysis during lactation can lead to neonatal hemolysis, neonatal kernicterus, or developmental growth retardation

[0004] Existing genetic diagnosis methods can better solve the problem of detecting heterozygotes in women with G6PD deficiency, but the current conventional genetic diagnosis methods are generally cumbersome to operate, low in throughput, and prone to false negatives or false positives, resulting in missed diagnosis , misdiagnosis and other shortcomings, cannot become the best choice for clinical gene diagnosis

For example, the allele-specific oligonucleotide probe hybridization method requires more complicated steps such as elution of the hybridization box after the polymerase chain reaction (Polymerase Chain Reaction, PCR), and the control of hybridization and elution conditions has brought many problems to the method. Possibility of misdiagnosis and missed diagnosis; multiple allele-specific PCR method is economical and simple, but this method has high requirements for primer design, and in the PCR reaction system, multiple pairs of primers may interfere with each other, which will affect the results; high The resolution melting curve method is easy to operate, but for the detection of different mutation sites, multi-tube operations are often required, and the throughput is low. However, the results of single-tube multi-site detection are difficult to interpret, and the clinical application is limited.

CN103695554A and others have developed a gene detection membrane strip and related primers for the diagnosis of G6PD deficiency to detect more than ten common mutation sites reported for G6PD deficiency, but the site coverage is not comprehensive enough, which may cause missed diagnosis, which is not conducive to this study. Genetic screening and early intervention of diseases

CN104450925A et al. used fluorescent quantitative PCR to design primers and probes for common sites covering most G6PD mutation populations, so as to type them separately, but there are still differences in standardized procedures, instrument specifications and reagent selection, which make some results repeated. Poor sex and other deficiencies hinder its widespread development

CN104450925A etc. use the method of PCR combined with generation sequencing to amplify all exons of G6PD gene and perform direct sequencing to improve the detection rate of patients and carriers, but this method is complicated to operate and the amplification effect of many exons is not good , there are miscellaneous peaks or incomplete peaks, and poor quality, which is difficult to apply to clinical routine detection