Unlock instant, AI-driven research and patent intelligence for your innovation.

Glucose-6-phosphate dehydrogenase deficiency detection kit and detection method

A technology of phosphate dehydrogenase and detection kit, which is applied in the field of biochemistry, can solve the problems of poor repeatability of some results in instrument specifications and reagent selection diversity, obstacles to extensive development, and limited clinical application, so as to reduce mental burden and improve Health economic benefits, the effect of making up for the high false positive rate

Pending Publication Date: 2022-05-13
广州源古纪科技有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among women with G6PD gene deficiency, carriers of the disease-causing gene (heterozygotes) are common in the population, and the enzyme activity is variable; but female heterozygotes will pass the disease-causing gene to the next generation, such as during their pregnancy, childbirth, Acute hemolysis during lactation can lead to neonatal hemolysis, neonatal kernicterus, or developmental growth retardation
[0004] Existing genetic diagnosis methods can better solve the problem of detecting heterozygotes in women with G6PD deficiency, but the current conventional genetic diagnosis methods are generally cumbersome to operate, low in throughput, and prone to false negatives or false positives, resulting in missed diagnosis , misdiagnosis and other shortcomings, cannot become the best choice for clinical gene diagnosis
For example, the allele-specific oligonucleotide probe hybridization method requires more complicated steps such as elution of the hybridization box after the polymerase chain reaction (Polymerase Chain Reaction, PCR), and the control of hybridization and elution conditions has brought many problems to the method. Possibility of misdiagnosis and missed diagnosis; multiple allele-specific PCR method is economical and simple, but this method has high requirements for primer design, and in the PCR reaction system, multiple pairs of primers may interfere with each other, which will affect the results; high The resolution melting curve method is easy to operate, but for the detection of different mutation sites, multi-tube operations are often required, and the throughput is low. However, the results of single-tube multi-site detection are difficult to interpret, and the clinical application is limited.
CN103695554A and others have developed a gene detection membrane strip and related primers for the diagnosis of G6PD deficiency to detect more than ten common mutation sites reported for G6PD deficiency, but the site coverage is not comprehensive enough, which may cause missed diagnosis, which is not conducive to this study. Genetic screening and early intervention of diseases
CN104450925A et al. used fluorescent quantitative PCR to design primers and probes for common sites covering most G6PD mutation populations, so as to type them separately, but there are still differences in standardized procedures, instrument specifications and reagent selection, which make some results repeated. Poor sex and other deficiencies hinder its widespread development
CN104450925A etc. use the method of PCR combined with generation sequencing to amplify all exons of G6PD gene and perform direct sequencing to improve the detection rate of patients and carriers, but this method is complicated to operate and the amplification effect of many exons is not good , there are miscellaneous peaks or incomplete peaks, and poor quality, which is difficult to apply to clinical routine detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] This embodiment provides a glucose-6-phosphate dehydrogenase deficiency detection kit and a primer set; the primer set uses bioinformatics knowledge and related bioinformatics software to detect glucose -6-Phosphate dehydrogenase deficiency pathogenic gene G6PD c.1376, c.1388 site nucleic acid sequence information, use PrimerExpressSoftware5.0 software to design PCR primers; Described primers include amplification primers G6PD-F, G6PD-R And sequencing primers M13F, M13R, its base sequence is:

[0023] G6PD-F: TGCCAAACGACGGTTAGTGCAGGGGTCGTCCTCTA;

[0024] G6PD-R: AAGGTATGACCATGCACCTGCCATAAATATAGGGGAT;

[0025] M13F: TGCCAAACGACGGCCAAAGTC;

[0026] M13R: AGCTATGACCATGAAC;

[0027] Multiplex PCR method is used to perform PCR amplification on the samples to be detected; the PCR amplification products are used to construct the amplicon library, and ISP (IonSphere TM Particles, Ion microspheres) templates were prepared, sequenced on the IonTorrentPGM system, and related s...

Embodiment 2

[0034] This embodiment also provides a method for detecting human G6PD gene using the kit of the present invention, which includes the following steps: using the primers in the kit containing specific sequences to PCR amplify the DNA of the human genome; hybridizing the amplified DNA; Detection of bound DNA on the surface of the gene chip.

[0035] The present invention also provides a detection method of the glucose-6-phosphate dehydrogenase deficiency detection kit, which also includes a detection system PCR amplification reaction solution and a sequencing system reaction solution.

[0036] Further, the detection system PCR amplification reaction solution also includes 2×PCRBuffer, dNTPs and KODFX DNA polymerase; the sequencing system reaction solution also includes EDTA, absolute ethanol, 75% ethanol, HIDI and BigdyeTerminatorV3.1; the The sequencing system reaction solution also includes a sequencing purification solution, which includes exonuclease I and calf small intest...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a glucose-6-phosphate dehydrogenase deficiency disease detection kit and a primer group. The primer group is characterized in that a PCR (Polymerase Chain Reaction) primer is designed by utilizing bioinformatics knowledge and related bioinformatics software according to nucleotide sequence information of c.1376 and c.1388 loci of a glucose-6-phosphate dehydrogenase deficiency disease-causing gene G6PD, which can be retrieved in a public database, and by utilizing Primer ExpressSoftware5.0 software; the primers comprise amplification primers G6PD-F and G6PD-R and sequencing primers M13F and M13R, and the base sequence of the primers is G6PD-F: TGCCAAACGACGGTTAGTGCAGGGGTCGTCCTTA, the base sequence of the primers is TGCAAACGACGGTTAGTGCAGGGGTCGTCCTTA, and the base sequence of the primers is TGCAAACGACGGTTAGTGCAGGGTCGTCCTTA G6PD-R: AAGGTATGACCATGCACCTGCATAATATAGGGGGAT, G6PD-R: AAGGTATGACCATGCACCTGCATAATATGGGAT The M13F is TGCCAAACGACGGCCAAAGTC, and the M13F is M13R: AGCTATGACCATGAAC, M13R: Carrying out PCR amplification on the to-be-detected sample by adopting a multiplex PCR method; the method comprises the following steps: constructing an amplicon library by using a PCR amplification product, preparing an ISP template, sequencing on an IonTorrentPGM system, and analyzing a related sequencing sequence by using software. According to the invention, primers for amplifying c.1376 and c.1388 sites of the G6PD gene are designed, and a stable amplification system is constructed by adopting a PCR (Polymerase Chain Reaction) technology. The amplification efficiency can be optimal by adjusting reaction conditions such as primer concentration, annealing temperature and the like.

Description

technical field [0001] The invention relates to the technical field of biochemistry, in particular to a glucose-6-phosphate dehydrogenase deficiency detection kit and detection method. Background technique [0002] G6PD deficiency is the most common hereditary enzyme deficiency disease, commonly known as favism, affecting about 400 million people worldwide. my country is one of the high-incidence areas of this disease. There are about 100 million patients with G6PD deficiency, mainly distributed in the provinces south of the Yangtze River, especially in Hainan, Guangdong, Guangxi, Yunnan, Guizhou, Sichuan and other provinces. The disease is usually asymptomatic, but the patient's red blood cells are easily damaged by certain substances and hemolysis occurs, leading to hemolytic anemia, drug-induced hemolysis, infectious hemolysis, favism, etc., the most serious is neonatal hemolysis, leading to Kernicterus thus develops into lifelong mental retardation or death in children....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6837C12N15/11
CPCC12Q1/6883C12Q1/6837C12Q2600/156C12Q2600/16C12Q2600/166C12Q2531/113C12Q2537/143C12Q2535/122C12Q2565/501C12Q2545/113
Inventor 段志峰
Owner 广州源古纪科技有限公司