Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

70 results about "Bioinformatics software" patented technology

Popular software for bioinformatics. Everyday bioinformatics is done with sequence search programs like BLAST, sequence analysis programs, like the EMBOSS and Staden packages, structure prediction programs like THREADER or PHD or molecular imaging/modelling programs like RasMol and WHAT IF. More:

Multi-epitope fusion diagnosis antigen for African swine fever virus as well as preparation method and application thereof

The invention discloses a multi-epitope fusion diagnosis antigen for African swine fever virus as well as a preparation method and application thereof. An ASFV (African swine fever virus) important structural protein gene encoding amino acid sequence is analyzed, screened and recombined through bioinformatics software, a multi-epitope fusion antigen gene is built and synthesized and is expressed in bacillus coli; through screening, the recombinant multi-epitope fusion antigen ASFV-meAg6 is obtained, so that diagnosis antigen protein with strong specificity and high sensitivity is provided foran ASFV serological diagnosis method.
Owner:SHIHEZI UNIVERSITY

Method for detecting bird flue virus H5N1 subtype based on liquid phase chip

The present invention relates to liquid phase chip method of detecting bird flu virus H5N1 subtype. The liquid phase chip technology includes the homogeny analysis on all the H5 and N1 serum subtype nucleic acid sequence capable of being searched in the nucleic acid sequence bank by means of biological informatic means to find out conservative region, design degenerate primer and specific probe on the H5 and N1 gene fragment and couple the specific probe with fluorescent coding microsphere to make specific detecting microsphere as the liquid phase chip; and recognizing the H5 and N1 gene fragment specifically with the liquid phase chip through two rounds of PCR reaction and reading out the detection result in the chip detection instrument. The method can detect bird flu virus H5N1 subtype quickly for early diagnosis.
Owner:WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI

Method for detecting flu and H5N1 avian influenza virus by using liquid chip

The invention relates to a method for detecting influenza viruses, in particular to a method for detecting influenza viruses and H5N1 subtype avian influenza virus by a liquid-phase chip, belonging to the technical field of medical monitoring. The method is a fast and highly efficient one which can identify FluA and FluB influenza viruses including the H5N1 subtype avian influenza virus by types. With the utilization of a liquid-phase chip technology and the application of bioinformatics knowledge and related bioinformatics software, the liquid-phase chip which can specifically distinguish H5 and N1 gene fragments, NP gene fragment of the FluA influenza virus and HA gene fragment of the FluB influenza virus is manufactured. The method has the advantages that fast detecting and early-stage diagnosis of the FluA and the FluB influenza viruses including the H5N1 subtype highly pathogenic avian influenza virus can be carried out; and a basis for developing other fast and highly effective detecting methods for detecting various subtype influenza viruses is provided. The method is characterized by detecting multiple types of viruses, short response time and high sensitivity, thus determining that the method has wide application prospect.
Owner:JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL

Method for obtaining oligonucleotide probe

The invention discloses a method for obtaining an oligonucleotide probe. The method for obtaining the oligonucleotide probe comprises the following steps: downloading original sequences of pSc119.2, pAs1, pTa-535, pTa71, pAWRC.1 and CCS1 from a national center of biotechnology information (NCBI) website; analyzing the downloaded sequences by using bioinformatics software DNAMAN; seeking repeated core units in these sequences; returning to the NCBI website to compare by using a blastn tool for finding out a core oligonucleotide sequence of which the length is below 60bp to carry out probe synthesis; carrying out probe synthesis on a lot of oligonucleotide sequences which are primarily screened out; gradually carrying out a fluorescence in situ hybridization (FISH) test after probe synthesis; verifying the function of the probe, and verifying whether the synthetic oligonucleotide sequence can play the FISH effects of pSc119.2, pAs1, pTa-535, pTa71, pAWRC.1 and CCS1 or not, so as to obtain the oligonucleotide probe. By adopting the method disclosed by the invention, complicated procedures of the existing probe marking technique are removed, the problem of marking failure of the probe is removed, and the cost is reduced.
Owner:SICHUAN AGRI UNIV

Group of specific polypeptides and application thereof in preparing reagents for early diagnosis of lung cancer

The invention discloses a group of specific polypeptides with amino acid sequences shown in SEQ ID Nos. 1-29 in the sequence list, and also discloses application of the specific polypeptides in preparing reagents for early diagnosis of lung cancer. The specific polypeptides of the invention are identified by the steps of performing comparative analysis through a serum polypeptide map in combination with bioinformatics software, identifying differentially expressing polypeptides and analyzing by mass spectrometry. The specific polypeptides disclosed by the invention can be used for preparing reagents for early diagnosis of lung cancer, and has a wide application prospect.
Owner:BIOMEDICAL ANALYSIS CENT OF ACADEMY OF MILITARY MEDICAL SCI

Anti-human Delta-like4 humanized antibody and preparation and application thereof

The present invention provides anti-human DLL4 (delta-like 4) humanized monoclonal antibody H3L2 and a preparation method and application thereof. A CDR-grafting-based FR region important base reversible mutant humanized antibody of a murine monoclonal antibody is designed by use of bioinformatics software, the heavy chain variable region of the anti-human DLL4 humanized antibody has an amino acid sequence shown as SEQ IDNO: 3, the light chain variable region of the anti-human DLL4 humanized antibody has an amino acid sequence shown as SEQ IDNO: 4; and the humanized antibody H3L2 is capable of high affinity binding to human DLL4 antigen (KD value of 2.26* 10<-12>M), can specifically target HUVEC cell surface DLL4 antigen, blocks DLL4 inhibition effect on HUVEC cell proliferation, and retains the biological activity of the parent murine monoclonal antibody. An antibody-based treatment method for diagnosis and treatment of diseases characterized by DLL4 overexpression is provided.
Owner:CHINA PHARM UNIV

Polypeptide-ELISA (enzyme linked immunosorbent assay) kit for detecting H7N9 subtype avian influenza virus NA (neuraminidase) specific antibody

InactiveCN105445459APeptide-ELISA detection of specific antibodies is fastStrong specificityBiological material analysisBiological testingElisa kitHorse radish peroxidase
The invention relates to a detection kit, in particular to a polypeptide-ELISA (enzyme linked immunosorbent assay) kit for detecting a H7N9 subtype avian influenza virus NA (neuraminidase) specific antibody. The kit comprises a 96-hole ELISA plate precoated with H7N9 NA linear B cell epitope polypeptide, positive serum, negative serum, an antibody marked with HRP (horse radish peroxidase), a sample diluent, a concentrated cleaning solution, a color development solution and a stop solution. NA linear B cell epitope of a Zhejiang strain of the H7N9 subtype avian influenza virus is predicted with bioinformatics software, corresponding polypeptides are artificially synthesized and then the ELISA plate is coated with the polypeptides; the NA specific antibody in serum is detected in a polypeptide-ELISA manner, and the polypeptide-ELISA kit is established. The polypeptide-ELISA kit for detecting the H7N9 subtype avian influenza virus NA specific antibody does not require expensive equipment such as a PCR (polymerase chain reaction) instrument and the like, has the advantages of quickness, simplicity, convenience, sensitivity, high specificity and the like and can be widely used in grassroots units.
Owner:ZHEJIANG PUKANG BIOTECH

Molecular design of porcine parvovirus-like particle B cell epitope insertion site

The invention relates to a molecular design of porcine parvovirus-like particle B cell epitope insertion site and belongs to the field of genetic engineering vaccine. Structure modeling of porcine parvovirus (PPV) capsid protein VP2 is performed by using bioinformatics software and the location of four extrusive Loop structures is determined by three-dimensional structure analysis. Firstly, on the basis of molecular simulation and literature support, we infer that loop 2,4 region can act as insertion sites of exogenous epitope gene. As is shown through experiments, after respective deletion of corresponding genes in PPV VP2 Loop2 (212aa-245aa), Loop (413aa-424aa) and then expression by adenovirus expression system, all recombinant virus with deletion mutations of Loop 2,4 can assemble regular virus-like particles [PPV: delta V LPs]. The invention also relates to an application of recombinant PPV delta V P2 virus-like particles of exogenous gene expressed by the recombinant virus in vaccination and the like.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Method for analyzing human blood group genotype based on high-throughput sequencing, and application thereof

The invention discloses a method for analyzing the human blood group genotype based on high-throughput sequencing, and belongs to the field of bioinformatics. In the method, first high-throughput sequencing data of human blood sample DNA are obtained, and further the sequencing data are processed through sequence comparison, mutation detection, and gene annotation to complete the analysis and verification of the blood group genotype. The invention establishes a whole gene sequencing blood typing cloud platform for the first time, the NGS technology is used to reveal the molecular mechanism ofhuman GPA, GPB, and GPE, complex GP (A-B-A), GP (B-A-B), and GP (A-B) fragments are sequenced and analyzed, polymorphism characteristics of glycoprotein heterozygous genes are analyzed in detail and the corresponding glycoprotein molecular type is determined through BWA / GATK and other bioinformatics software, mutant genes are overexpressed and an antigenic type of the MNS system is verified, and thereby difficult problems of clinical blood transfusion reactions and the diagnosis and treatment of immune diseases caused by heterozygous glycoprotein polymorphism molecules are solved.
Owner:SHENZHEN BLOOD CENT

Recombinant peanut allergen and mutant and preparation method and application of recombinant peanut allergen and mutant

The invention discloses a recombinant peanut allergen and a mutant and a preparation method and application of the recombinant peanut allergen and the mutant. The recombinant peanut allergen is a non-natural mutant derived from a natural allergen, and the amino acid sequence of the recombinant peanut allergen is shown as SEQ ID NO: 1. A coding gene of the recombinant peanut allergen is artificially synthesized after codon optimization by using a gene engineering technology; and the epitope of the coding gene is analyzed by adopting biological informatics software, and directional displacement is performed on one or more sites with high antigenicity by a site-directed mutagenesis method to reduce the allergenicity of the allergen, and thus the recombinant peanut allergen mutant with low allergenicity is constructed. The recombinant peanut allergen with high purity and a mutant protein of the allergen are obtained by protein expression under an artificial controlled condition. Compared with a natural peanut allergen, the invention has the advantages that the bonding capacity of the recombinant protein mutant bonded with specific immunoglobulin E (IgE) is obviously reduced, and the recombinant protein mutant can be safely applied to diagnosis and treatment of allergic diseases and even judgment of other protein allergenicity.
Owner:THE SECOND AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV

Combined detection method for pregnancy folate metabolism, calcium metabolism and H-type hypertension

The invention relates to a combined detection method for pregnancy folate metabolism, calcium metabolism and H-type hypertension. The method is characterized in that bioinformatics knowledge and related bioinformatics software are utilized to perform homology analysis, peripheral SNP analysis, frequency analysis, base content analysis and SNP peripheral sequence analysis on the sequence information of multiple SNP loci (rs10512366, rs1544410, rs1801131, rs1801133, rs2234693, rs9340799, rs731236, rs7975232 and rs1801394) which can retrieved in an open database, and then a specific multiple PCR primer system and a multiple LDR probe system are designed and optimized. The method has the advantages that fragment length analysis is performed by combining the multiple PCR-LDR technology and the capillary electrophoresis technology of a genetic analyzer to achieve SNP detection typing, and the method is large in flux, high in specificity and flexibility, stable in result, good in repeatability and fast in detection.
Owner:上海联吉医学检验所有限公司

Method for identifying Gaoyou duck varieties by utilizing molecular bioinformatics

The invention relates to a method for identifying Gaoyou duck varieties by utilizing molecular bioinformatics, belonging to the technical filed of biological variety identification. In the invention, the sequences of gene b of cytochrome of mitochondrial DNA of a Gaoyou duck and the duck variety to be tested are accurately obtained on the basis of gene cloning and DNA sequencing technologies, a plurality of bioinformatics software is utilized to accurately figure out the haplotype, variation locus, haplotype diversity, average nucleotide difference, nucleotide ramification degree, pure genetic distance, Kimura dual-parameter genetic distance among varieties, variety colony cluster result images and haplotype phylogenetic trees of each variety, and the genetic information difference among the varieties is utilized to identify the true and false of the Gaoyou duck varieties through software precise calculation and analysis results.
Owner:JIANGSU INST OF POULTRY SCI

Arborescent polypeptide for conducting cell therapy on HPV infection and screening method, preparation method and application of arborescent polypeptide

The invention relates to an arborescent polypeptide for conducting a cell therapy on HPV infection. The arborescent polypeptide is characterized by being formed by connecting four carboxyl groups of a C-terminal of an HPV epitope peptide with three amino groups of a poly-L-arginine framework composed of arginine residues, wherein an amino acid sequence of the epitope peptide is Tyr-Met-Leu-Asp-Leu-Gln-Pro-Glu-Thr-Gly-Gly-Gly. The invention further provides a screening method, a preparation method and application of the arborescent polypeptide. Through design and analysis of multiple kinds of combined bioinformatic software, the capacity of finding a new epitope is improved, the epitope loading orientations achieve consistency, and the specific combination capacity and reaction sensitivity of the epitope peptide are exponentially improved in unit space. The epitope peptide is single in structure and property and has the great advantages of being high in specificity, free of potential biological hazards and capable of achieving stardardization in preparation process.
Owner:江苏安泰生物技术有限公司

Immunology identification method for Brucella A19-delta VirB12 molecular marker vaccine

The invention discloses an immunology identification method for Brucella A19-delta VirB12 molecular marker vaccine. The method comprises the following steps: a, carrying out bioinformatics software analysis according to the VirB12 gene characteristics of Brucella A19, so as to obtain an active sequence, wherein the corresponding DNA sequence is a polypeptide 074 DNA sequence: GGCCTGACGGACAACAACTGCCCTCCTCCCGGTGATACGTACGCAA; b, conducting artificial synthesis on the sequence obtained in the step a by taking the DNA sequence as a template, so as to obtain polypeptide, wherein the amino acid sequence of the polypeptide is a polypeptide 074 amino acid sequence: GLTDNNCPPPGDTQ; c, taking the active polypeptide ingredient obtained in the step b as an envelope antigen. According to the method, the problem that an immune animal and a clinic sick animal are difficult to identify is solved, and the practical application value in preventing, controlling, eliminating and purifying cattle brucellosis is high.
Owner:VETERINARY INST XINJINAG ACADEMY OF ANIMAL SCI CLINIC MEDICAL SCI RES CENT XINJIANG ACADEMY OF ANIMAL HUSBANDRY SCI

Related protein group with differential expression in early pancreatic cancer model and application thereof

In the invention, differential expression of proteins in tissues of normal pancreas and the pancreas of a rat with pancreatic intraepithelial neoplasia and early pancreatic cancer can be respectively dynamically detected by establishing a 7,12-dimethyl benzophenanthrene (DMBA)-induced rat pancreatic intraepithelial neoplasia and pancreatic cancer model and applying the DIGE (difference gel electrophoresis) protein analysis technology, bioinformatics software is utilized for screening out the proteins which synchronously significantly vary with expression of cancerization degree of the pancreatic cancer, and the mass spectrometry technology is further utilized for performing identification so as to determine the specific proteins with the differential expression during the occurrence of the early pancreatic cancer. The invention discloses a related protein group with the differential expression in the pancreas tissues in an early pancreatic cancer model, the related proteins have strong specificity, and the related proteins can be utilized as protein markers for early diagnosis of the pancreatic cancer, thereby providing an effective method for clinical early diagnosis of the pancreatic cancer. A PMF (peptide mass fingerprinting) map of differential protein points can be searched in a database of National Center for Biotechnology Information (NCBI) by utilizing Mascot software.
Owner:SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE

Recombinant horse allergen and mutant and preparation methods and applications thereof

The invention discloses a recombinant horse allergen and a mutant and preparation methods and applications thereof. The recombinant horse allergen is a non-natural mutant derived from a natural allergen, and the amino acid sequence of the recombinant horse allergen is shown as SEQ ID NO:1. An encoding gene of the recombinant horse allergen is artificially synthesized after codon optimization by using a gene engineering technology, the epitope of the encoding gene is analyzed by adopting bioinformatics software, and orientated displacement is performed specific to one or more high-antigenicity loci through a site-specific mutagenesis method to lower the allergenicity, so that a recombinant horse allergen mutant with low allergenicity is constructed. Protein expression is performed under an artificial control condition, so that a high-purity recombinant horse allergen and a mutant protein thereof are obtained. Compared with a natural horse allergen, the recombinant protein mutant has remarkably-lowered bonding capability with specific IgE (Immunoglobulin E), and can be safely applied to diagnosis and treatment of anaphylactic diseases and even judgment of the level of the allergenicity of other proteins.
Owner:THE SECOND AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV

Carya cathayensis auxin efflux carrier protein CcPILS gene cloning and expression analysis method

InactiveCN106591321ASolve the difficulty of graftingSolve the difficulty of breed selectionMicrobiological testing/measurementPlant peptidesRNA extractionOpen reading frame
The invention discloses a Carya cathayensis auxin efflux carrier protein CcPILS gene cloning and expression analysis method. The method includes the steps of: material preparation, RNA extraction and purification, CcPILS gene RACE, bioinformatics analysis, and temporal and spatial expression analysis. The method provided by the invention clones Carya cathayensis PIL homologous gene CcPILS by RACE technique, the gene has a full-length sequence of 1541bp, wherein the open reading frame sequence is 1263bp, bioinformatics software analysis is applied to predict that the sequence encodes 420 amino acids, the CcPILS protein molecular weight is about 46.22KD, PI is 5.38, the protein is located at an endoplasmic reticulum membrane, is equipped with 5 transmembrane hydrophobic structural domains respectively at the N terminal and C terminal, and is separated by a middle hydrophilic loop. The gene has high homology with Arabidopsis thaliana AtPILS5 and AtPILS7, and belongs to Clade III subtribe of PILS gene family. Fluorescence quantitative RT-PCR analysis shows that before and after Carya cathayensis grafting, CcPILS has expression trend in scion consistent with that in rootstock, and provides a beneficial promoting effect on solution of the problems of difficult Carya cathayensis grafting, difficult variety breeding and difficult quality improvement, etc.
Owner:ZHEJIANG FORESTRY UNIVERSITY

B-cell epitope of VP(viral protein)3 of DHAV (duck hepatitis A virus)-1 as well as identification method and application of B-cell epitope

The invention belongs to the technical field of bioengineering and particularly relates to a B-cell epitope of VP(viral protein)3 of DHAV (duck hepatitis A virus)-1 as well as an identification method and an application of the B-cell epitope. The identification method of the B-cell epitope comprises the following steps: obtaining a target fragment of the VP3; constructing recombinant expression plasmid pG-EX-VP3, preparing VP3 recombinant protein, preparing a polyclonal antibody of the VP3 recombinant protein, determining the median lethal dose ELD50 of the DHAV-1 on chicken embryos or duck embryos, determining the neutralizing titer of the polyclonal antibody of the VP3 recombinant protein and identifying the B-cell epitope on the VP3. The linear B-cell epitope of the VP3 is predicted with comprehensive application of bioinformatics software, epitope peptide is artificially synthesized, identification is performed on the synthetic epitope peptide in combination with an indirect ELISA (enzyme linked immunosorbent assay) method, and reference can be provided for deep development of follow-up DHAV-1 immunological research, construction of novel diagnostic preparations and development of polypeptide vaccines.
Owner:SICHUAN AGRI UNIV

Positioned processed and damaged Gly m Bd 60K protein antigen region based on phage display technology and screening method

The invention discloses a positioned processed and damaged Gly m Bd 60K protein antigen region based on a phage display technology and a screening method. An amino acid sequence of the antigen regionis shown in SEQ ID NO.16. The method utilizes a series of bioinformatics software and refers to a three-dimensional crystal structure of analyzed beta-conglycinin in a PDB database, studies the processed and damaged Gly m Bd 60K protein antigen region by the phage display technology, and performs accurate positioning on the region where antigenicity of a Gly m Bd 60K protein is reduced due to different processing methods through presenting the Gly m Bd 60K protein and an overlapping protein of the Gly m Bd 60K protein on the surface of a phage. The method provided by the invention provides a theoretical basis for processing method screening in the food industry, and an application product for rapidly detecting a desensitization effect of processed food can be further developed.
Owner:HENAN UNIVERSITY OF TECHNOLOGY

Identification method of group of genomic characteristic mutation fingerprints associated with homologous recombination repair defects

The present invention discloses a genomic characteristic mutation fingerprint related to hHRD type homologous recombination repair defects and comprises a combination characteristic of a single nucleotide variation (SNV) and insertion deletion (Indel) genomic fingerprint, and an identification method thereof. The fingerprint characteristics can be subjected to high-throughput whole-genome resequencing, bioinformatics software analysis and statistical correlation analysis and are used to identify infectious diseases or tumors with the characteristic mutation fingerprints, especially hepatitis Bvirus infection and related diseases, including liver cirrhosis, liver fibrosis and liver cancer. The mutation fingerprint can also be used to guide methods and uses of treatments of targeted drugs targeting the homologous recombination defects on a variety of the various tumors with the hHRD homologous recombination repair defects, including but not limited to breast cancer, ovarian cancer, endometrial cancer, endometrioid carcinoma, ovarian clear cell carcinoma, prostate cancer, gastric cancer, skin cancer, hepatitis B virus infection or related liver cirrhosis, liver cancer and bile duct cell cancer.
Owner:THE WEST CHINA SECOND UNIV HOSPITAL OF SICHUAN +1

RV (rabies virus) dominant-epitope peptide antigen and application thereof

The invention discloses an RV (rabies virus) dominant-epitope peptide antigen and an application thereof, and belongs to the technical field of rabies vaccines. In the invention, dominant-epitope antigen segments are screened by using bioinformatics software, coding genes of the dominant-epitope antigen segments are amplified through PCR (polymerase chain reaction), and the coding genes are efficiently expressed in escherichia coli, thereby obtaining a high-purity antigen; and an indirect ELISA (enzyme-linked immuno sorbent assay) test shows that the obtained antigen can detect protective antibodies in immune human or dog serums. A dominant-epitope peptide segment antigen expressed by genetic engineering is adopted to replace a whole-virus antigen so as to improve the detection specificity, and through carrying out detection by compositely using various specific antigens, the detection sensitivity is significantly improved.
Owner:INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA

Promoter sequence based on BnaCnng52950D gene, recombinant vector and application

The invention belongs to the field of gene engineering and molecular biology, and particularly relates to a promoter sequence of a cabbage type rape BnaCnng52950D gene, a recombinant vector built according to the promoter sequence and application. A promoter element included in the sequence is predicted through bioinformatic software, and a plant expression vector is built for performing qualitative detection on the promotor activity. The result shows that a cloned sequence can drive the expression of a GUS reporter gene in the bases of pod stalks and leaves. The acquisition of the promoter provides a powerful tool for the transgenic research of rapeseed, and lays a certain foundation for the research of the rapeseed and genetically close species thereof.
Owner:SOUTHWEST UNIVERSITY

mRNA nucleoplasmic ratio variation-based method for identifying miRNA target gene and application thereof

The invention belongs to the technical field of biology, and relates to a rapid and accuracy message Ribonucleic Acid (mRNA) nucleoplasmic ratio variation-based method for identifying a mirna Ribonucleic Acid (miRNA) target gene, and to application of the method in the biomedical field. The method is realized through the following technical scheme of: predicting possible target genes of a certain miRNA through the conventional miRNA target prediction bioinformatics software, such as Targetscan; measuring the mRNA nucleoplasmic ratio variation of the possible target genes in a cell by utilizing a biochip or real-time quantitative Polymerase Chain Reaction (PCR); searching the possible target genes with an mRNA nucleoplasmic ratio of more than 1; and further confirming in the protein level through Western blot.
Owner:INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA

Mycobacterium tuberculosis specificity CTL epitope peptides and application thereof

The invention relates to mycobacterium tuberculosis specificity CTL epitope peptides and application thereof and belongs to the field of molecular biology and immunology. Through prediction of biological informatics software, selection of HLA-A2 limitation CTL epitope, modification of partial epitope peptides and synthesis and activity comparison and screening of epitope peptides, the obtained four 9-peptides of Rv2629-p190-2L, Rv2629-p190-1Y2L, Rv2629-p274 and / or Rv2629-p315 of the HLA-A2 limitation CTL epitope of mycobacterium tuberculosis protein Rv2629 have higher affinity and higher stability; the IFN-gamma levels for inducing PBMCs generation of a tuberculosis patient are obviously higher than that of a normal control group and a tuberculosis dormant infection group; the CTL ability for stimulating the PBMCs generation of the tuberculosis patient to secrete IFN-gamma is obviously higher than that of the normal control group and the tuberculosis dormant infection group; all the four 9-peptides can induce to generate CTL with killing activity to target cells, and the killing activity can be correspondingly improved along with increasing of effect and target ratio; CTL generated by stimulating modified peptides of Rv2629-p190-2L and Rv2629-p190-1Y2L can identify mother peptide Rv2629-P190. The mycobacterium tuberculosis specificity CTL epitope peptides can serve as a tuberculosis cell-mediated immunity inducer and can be a novel candidate epitope of antituberculous epitope vaccine or an immunity diagnosis reagent.
Owner:THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY

Liquid-phase chip for detecting flu and H5N1 avian influenza virus and specific detection primer and preparation method thereof

The invention relates to a method for detecting influenza viruses, in particular to a method for detecting influenza viruses and H5N1 subtype avian influenza virus by a liquid-phase chip, belonging to the technical field of medical monitoring. The method is a fast and highly efficient one which can identify FluA and FluB influenza viruses including the H5N1 subtype avian influenza virus by types.With the utilization of a liquid-phase chip technology and the application of bioinformatics knowledge and related bioinformatics software, the liquid-phase chip which can specifically distinguish H5and N1 gene fragments, NP gene fragment of the FluA influenza virus and HA gene fragment of the FluB influenza virus is manufactured. The method has the advantages that fast detecting and early-stagediagnosis of the FluA and the FluB influenza viruses including the H5N1 subtype highly pathogenic avian influenza virus can be carried out; and a basis for developing other fast and highly effective detecting methods for detecting various subtype influenza viruses is provided. The method is characterized by detecting multiple types of viruses, short response time and high sensitivity, thus determining that the method has wide application prospect.
Owner:JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL

A method and system for download, installing, and manage bioinformatics software and databases

The invention discloses a method for downloading, installing and managing biological information software and database, which comprises the following steps: collecting and sorting various biological information analysis tools; storing in the cloud and build management systems; defining management rules for the use of tools; providing tools to the requesting user based on usage management rules. Asystem for download, installing and manage bioinformatics software and databases is also disclosed. Used to manage, download and install all kinds of bioinformatics software and databases, which can automatically complete the download and installation of a large number of bioinformatics software and databases, and to manage the local bioinformatics software and databases. By unifying the downloadand installation process, it provides a more automated way to complete the download, installation and management of bioinformatics software and databases.
Owner:RUIJIN HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE

Destructive beta-conglycinin beta subunit processing antigen area and screening method based on phage display technological orientation

The invention discloses a destructive beta-conglycinin beta subunit processing antigen area and a screening method based on phage display technological orientation. The amino acid sequence of the antigen area is as shown in SEQ ID NO. 15. By the aid of a series of bioinformatics software and reference of an analyzed beta-conglycinin three-dimensional crystalline structure of a PDB (protein database), the antigen area of ultrahigh-pressure destructive beta-conglycinin is researched by a phage display technology, a beta-conglycinin beta subunit and overlapping protein thereof are represented onthe surface of a phage, and an area with the beta-conglycinin beta subunit with antigenicity reduced by an ultrahigh-pressure is accurately positioned. A theoretical basis for screening processing methods is provided for food industry, and an application product for rapidly detecting the desensitization effect of processed food can be further developed.
Owner:HENAN UNIVERSITY OF TECHNOLOGY

Recombinant soybean allergen, mutant and preparation methods and application of recombinant soybean allergen and mutant

The invention discloses a recombinant soybean allergen, a mutant and preparation methods and application of the recombinant soybean allergen and the mutant. The amino acid sequence of the recombinant soybean allergen disclosed by the invention is shown as SEQ ID NO:1. According to the invention, by a genetic engineering technology, a coding gene of the recombinant soybean allergen is artificially synthesized after codon optimization is carried out; an antigenic epitope of the recombinant soybean allergen is analyzed by adopting bioinformatics software; and by a site-specific mutagenesis method, directional replacement is carried out for one or a plurality of sites with high antigenicity to reduce the allergen property of the recombinant soybean allergen so as to construct the recombinant soybean allergen mutant with low allergen property. The high-purity recombinant soybean allergen and a mutant protein thereof are obtained by carrying out protein expression under the condition of manual control. Compared with a natural soybean allergen, the combination capacity of the recombinant protein mutant with the specificity IgE is obviously reduced and the recombinant soybean allergen and the mutant can be safely applied to diagnosis and treatment of allergic diseases and judgment on the allergen property of other proteins.
Owner:THE SECOND AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV

Design method of high-performance micro gene sequencing and automatic analysis device

The invention provides a design method of a high-performance micro gene sequencing and automatic analysis device, and relates to the technical field of gene sequencing. The high-performance micro gene sequencing and automatic analysis device mainly comprises a miniature sequencer, a desktop server and an automatic data analysis system, wherein a MinIon sequencer is selected as the miniature sequencer; the desktop server with small noise and large storage space is selected; an automatic data analysis system is provided with a galaxy analysis platform; the galaxy provides a frame platform for data analysis; common bioinformatic software and a data set are configured on the platform for people; the flow can be constructed; and automatic operation by a user is facilitated.
Owner:LANGCHAO ELECTRONIC INFORMATION IND CO LTD