Primers and method for detecting gene mutation of JAK3 gene intron 2
An intron and sequencing primer technology, applied in the fields of life science and biology, can solve the problem of the loss of kinase activity, and achieve the effect of reducing cost and difficulty, high cost and difficult detection.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] A primer for detecting the mutation of the JAK3 gene intron 2 gene site, the design of the primer is an amplification primer designed for the JAK3 gene intron 2, including:
[0044] Amplify the primer of JAK3 gene intron 2, its base sequence is:
[0045] JAK3-Int 2-F: TGTAAAACGACGGCCAGTTTACAGGCATAAGCCACCG
[0046] JAK3-Int 2-R: AACAGCTATGACCATGACACCCTTCTCCATTACAAAA.
[0047] A test kit for detecting JAK3 gene intron 2 site mutation, comprising
[0048] (i) Blood DNA extraction reagents;
[0049] (ii) detection system PCR reaction solution;
[0050] (iii) Sequencing system reagents;
[0051] Among them, the tissue DNA extraction reagent can be purchased from commercial reagents such as Tiangen DNA extraction kit.
[0052] Detection system PCR amplification reaction liquid includes: 2×PCR Buffer; 2mM dNTPs; KOD FX DNA Polymerase (1U / μl); JAK3 gene intron 2 upstream and downstream primers The concentration of primers JAK3-Int 2-F / R is 10 μM.
[0053] Sequencing syst...
Embodiment 2
[0055] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):
[0056](1) Extract tissue DNA from blood: 1) Extract 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inverting, and place at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed. 2) Add 20 μl proteinase K solution and mix well. 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap. 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap. 5) Add the solution and flocculent precipitate obtained in the previous step i...
Embodiment 3
[0082] The clinical samples of 5 cases were extracted genome, prepared reagents, amplified and sequenced according to the reagents and methods of Examples 1 and 2. Add 1 μl of sample to each detection system PCR reaction solution. Electrophoresis results such as figure 1 As shown, it shows that the primer JAK3-Int 2-F / R of the present invention can effectively amplify the blood sample, and the band is single.
[0083] The test results of the samples were figure 2 , 3 , 4, 5, 6, and 7 show:
[0084] figure 2 It shows the sequence screenshots of JAK3 gene intron 2 mutant type 3821C>T site of samples 1, 3 and 4, indicating that 3821C>T mutation occurred in intron 2 of samples 1, 3 and 4.
[0085] image 3 It shows that the intron 2 mutations of the JAK3 gene of samples 1, 3, and 4 are 3839G>A and 3841G>A site sequencing screenshots, indicating that the intron 2 of samples 1, 3, and 4 has 3839G>A and 3841G>A mutations .
[0086] Figure 4 It shows the sequence screensho...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com