Primers, kit and method for detecting TREX1 gene mutation
A technology of kits and sequencing primers, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. effect of difficulty
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Primers for detecting the mutation site of TREX1 gene, the primers are designed for the amplification primers designed for the whole exon of TREX1, including:
[0053] The primers for amplifying the whole exon sequence of TREX1 gene, its base sequence is:
[0054] TREX1-1F: TGTAAAACGACGGCCAGTGGGAACGGATGGTGGTGA
[0055] TREX1-1R: AACAGCTATGACCATGAGGGTGAGGTGGTTTCCTTAG
[0056] TREX1-2F1: TGTAAAACGACGGCCAGTTCGCAGACAGGGCAGGATTG
[0057] TREX1-2R1: AACAGCTATGACCATG CACTGGTGAGGCCCAGCATAG
[0058] TREX1-2F2: TGTAAAACGACGGCCAGTCCAACCTGCTCCTAGCCTTCC
[0059] TREX1-2R2: AACAGCTATGACCATGGACAAACACTGTGCCCTCCTC.
[0060] Kits for detecting TREX1 gene mutations, including:
[0061] (i) Blood DNA extraction reagents;
[0062] (ii) detection system PCR reaction solution;
[0063] (iii) Sequencing system reagents;
[0064] Among them, the tissue DNA extraction reagent can be purchased from commercial reagents such as Tiangen DNA extraction kit.
[0065] Detection system PCR ampl...
Embodiment 2
[0068] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):
[0069] (1) Extract tissue DNA from blood:
[0070] 1) Take 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed;
[0071] 2) Add 20 μl proteinase K solution and mix well;
[0072] 3) Add 200 μl buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;
[0073] 4) Add 200 μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent sediment may appear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;
[0074] 5) Add the solution and flocculent ...
Embodiment 3
[0104] The clinical samples of 24 cases were extracted genomes, prepared reagents, amplified and sequenced according to the reagents and methods of Examples 1 and 2. Add 1 μl of sample to each detection system PCR reaction solution. figure 2 , 3 and 4 are the electrophoretic patterns of the amplified products obtained after the blood sample was amplified with TREX1-1F / 1R, TREX1-2F1 / 2R1, and TREX1-2F2 / 2R2 as primers, respectively. The lengths of fragments amplified by the present invention are 337bp, 587bp, and 768bp respectively, and the analysis of the electropherograms shows that the primers TREX1-1F / 1R, TREX1-2F1 / 2R1, and TREX1-2F2 / 2R2 of the present invention are effectively amplified, and the bands single.
[0105] The sequencing results of 24 samples showed that there were 5 mutation sites, and the mutation sites and their numbers are shown in the table below:
[0106]
[0107] Figure 5 The display is a screenshot of TREX1 exon 1 mutant sequencing, indicating that...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap