Primer and method for detecting HLA-B*5701 typing
A technology for HLA-B and sequencing primers, applied in the fields of life science and biology, can solve problems such as low incidence, and achieve the effects of simple operation, good specificity, and reduced cost and difficulty
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] The present invention will be further described below in conjunction with specific embodiments and accompanying drawings. It should be noted that the routine conditions and methods not described in the examples are generally used by experimenters in the field: for example, the fourth edition of the "Refined Molecular Biology Experiment Guide" edited by Osper and Kingston, Or follow the procedures and conditions recommended by the manufacturer.
[0048] A primer for detecting the HLA-B*5701 genotype, the primer is designed to span the intron of the HLA-B gene, and the specific amplification primer designed in the second and third exons, including:
[0049] The base sequences of the primers for amplifying the HLA-B*5701 gene and the primers for amplifying the internal reference gene are respectively:
[0050] HLA-B*5701-F: TGTAAAACGACGGCCAGTGAACATGAAGGCCTCCGCG
[0051] HLA-B*5701-R: AACAGCTATGGCCATACATCACCTGGATGATGTG
[0052] actin-F: CTAACTGCGCGTGCGTTCT
[0053] acti...
Embodiment 2
[0065] (1) Operation process of extracting blood genomic DNA:
[0066] 1) Add 20 μL Proteinase K solution to 200 μL blood and mix well.
[0067] 2) Add 200 μL buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0068] 3) Add 200 μL of absolute ethanol, shake and mix well for 15 seconds, at this time flocculent precipitation may appear, centrifuge briefly to remove water droplets on the inner wall of the tube cap.
[0069] 4) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in the collection tube), centrifuge at 12,000rpm (13,400×g) for 30s, discard the waste liquid, and put the adsorption column CB3 back into the collection tube middle.
[0070] 5) Add 500 μL buffer GD to the adsorption column CB (please check whether absolute ethanol has been added before...
Embodiment 3
[0099] Take blood samples from 20 cases of healthy physical examination, extract genomic DNA according to the method described in Example 2, prepare reagents, and detect whether the samples have HLA-B*5701 alleles. Add 2 μl of each sample to the detection system PCR reaction solution. Amplify with a common PCR instrument for 160 minutes. After PCR amplification, the results showed that among the 20 samples, sample No. 17 had a band, and the band was single and the size was correct, indicating that sample No. 17 was HLA-B*5701; after sequencing, it was confirmed to be HLA by comparison with the standard sequence -B*5701 allele. The results of agarose gel electrophoresis of 20 samples are as follows: figure 1 As shown, the sequence comparison chart of sample No. 17 is as follows figure 2 shown.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



