Primer, detection kit and method for detecting TERC gene whole exome sequence mutation

A technology of whole exons and sequencing primers, which is applied in the fields of life science and biology, can solve the problems of low abundance and monotony of non-specific amplification products, and achieve the effects of low cost, simple operation, and improved amplification specificity

Inactive Publication Date: 2018-09-14
杭州艾迪康医学检验中心有限公司
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Touch-down PCR amplification can ensure that the combination of the forward and reverse amplification primers and the sample DNA template occurs between the most complementary sequences. When the annealing temperature is reduced to the level where non-specific amplification occurs, the specific amplification product is At this time, there is already a geometric number of initial advantages, and the abundance is high. In the remaining amplification reactions, the specific amplification products compete with the non-specific amplification products, but due to the low abundance of non-specific amplification products , the specific amplification product is always preferentially amplified, resulting in a single dominant specific amplification product

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, detection kit and method for detecting TERC gene whole exome sequence mutation
  • Primer, detection kit and method for detecting TERC gene whole exome sequence mutation
  • Primer, detection kit and method for detecting TERC gene whole exome sequence mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] The primers for detecting the mutation of the entire exon sequence of the TERC gene include: forward and reverse primers for amplifying the mutation of the entire exon sequence of the TERC gene; its base sequence is:

[0046] TERC-F: TGTAAAACGACGGCCAGTCCTCATGGCCGGAAATGGAACT

[0047] TERC-R: AACAGCTATGACCATGAGGGGTGACGGATGCGCACGAT.

[0048] Preferably, the primers also include a pair of sequencing primers, the base sequence of which is

[0049]M13-F: TGTAAAACGACGGCCAGT

[0050] M13-R: AACAGCTATGACCATG.

[0051] In the detection, first use the above-mentioned forward and reverse primers to amplify the mutation of the whole exon sequence of the TERC gene to obtain the amplified product, then use the above-mentioned pair of sequencing primers to sequence the amplified product to obtain the gene of the amplified product sequence.

[0052] The kit for detecting the mutation of the whole exon sequence of TERC gene, including: sample DNA extraction reagent (for example, use ...

Embodiment 2

[0065] Detection process:

[0066] (1) Use the blood DNA extraction kit (Tiangen Biology) to extract the genomic DNA in the blood sample:

[0067] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed.

[0068] 2) Add 20 μl proteinase K solution and mix well.

[0069] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0070] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0071] 5) Put the solution and floc...

Embodiment 3

[0096] The nucleic acid detection kit of the present invention is used to detect clinical samples.

[0097] 20 anticoagulant blood samples from patients with dyskeratosis congenita were taken for inspection, and the genomic DNA in the samples was extracted according to the detection process described in Example 2, and reagents were prepared and tested.

[0098] Add 2 ul of the genomic DNA solution of each sample extracted according to the detection process described in Example 2 into the PCR reaction solution of the detection system. Do positive, negative and blank controls at the same time. Detect with common PCR instrument, the time is 160 minutes.

[0099] Electrophoresis results such as figure 1 As shown, it shows that the primers TERC-F and TERC-R of the present invention can effectively amplify blood samples, and the band is single.

[0100] The results of forward sequencing of TERC gene C408G of sample 1 are as follows: figure 2 As shown, it is wild type, and no C4...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method, primer and detection kit for detecting TERC gene whole exome sequence mutation of a dyskeratosis congenita patient. The primer comprises forward and reverse primers amplifying a TERC whole exome sequence and a pair of sequencing primers. According to the method, primer and detection kit for detecting TERC gene whole exome sequence mutation of the dyskeratosis congenita patient, Touch-down PCR amplification and Sanger sequencing are combined so that the mutation situation of the TERC whole exome sequence in the body of the dyskeratosis congenita patient can befast detected, and a TERC gene has two mutation sites of C408G and GC107-108AG.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and particularly relates to a primer, a method and a kit for detecting the mutation of the whole exon sequence of TERC gene. Background technique [0002] Dyskeratosis congenita (dskeratosis eongenita, DC) is a bone marrow failure syndrome with genetic heterogeneity, with an incidence of about 1 / 1 million. About 80% to 90% of typical DC patients have the triad of abnormal skin and mucous membranes, which are manifested as reticular pigmentation of the skin, atrophy of the finger (toe) nails, and leukoplakia of the oral mucosa. At present, the mutated genes reported in the literature that can cause DC mainly include CTC1, DKC1, TERC, TERT, TINF2, NHP2, NOP10 and WRAP53. It has been reported in the literature that these genes have three modes of inheritance, which are X-linked recessive inheritance, autosomal recessive inheritance, and autosomal dominant inheritance. However, the gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6883C12Q1/6869C12N15/11
CPCC12Q1/6869C12Q1/6883C12Q2600/156C12Q2531/113C12Q2535/101
Inventor王淑一吴鹏飞单战
Owner杭州艾迪康医学检验中心有限公司